close

Вход

Забыли?

вход по аккаунту

?

Development of microsatellite DNA markers and their chromosome assignment in the common marmoset.

код для вставкиСкачать
American Journal of Primatology 71:912–918 (2009)
RESEARCH ARTICLE
Development of Microsatellite DNA Markers and Their Chromosome
Assignment in the Common Marmoset
HIDEKI KATOH1,2, SHUJI TAKABAYASHI1, AND TOSHIO ITOH2
1
Institute for Experimental Animals, Hamamatsu University School of Medicine, Hamamatsu, Japan
2
Central Institute for Experimental Animals, Kawasaki, Japan
This study was performed to develop microsatellite DNA markers, which are useful for linkage
analyses, gene mapping and blood chimera analyses in the common marmoset (Callithrix jacchus). We
searched 153 of 295 bacterial artificial clone DNA sequences of the common marmoset that were
archived in the NCBI database in 2004. On the basis of the search, we designed 186 PCR primer sets.
When tested using 5 unrelated individuals, we successfully detected 154 markers with PCR products, of
which 80 (52%) were polymorphic and 74 (48%) were monomorphic. We assigned each of the 154
markers to a human chromosome based on BLAST searches, which was achieved by searching the
entire human genome sequences using an 3 kb section of each forward primer sequence, including
1.5 kb of the upstream and 1.5 kb of the downstream sequences. Combining our assignment data and
the chromosome painting-assisted karyotype of the common marmoset [Sherlock et al., Genomics
33:214–219, 1996], we prepared a list of 154 microsatellite DNA markers that were assigned to human
chromosomes, except for the Y chromosome, which is equivalent to a chromosome map. Using five
microsatellite DNA markers, we have established a fragment analysis method with a sequencer, which
can be routinely used for blood chimera analysis, parentage diagnosis and individual identification.
Am. J. Primatol. 71:912–918, 2009.
r 2009 Wiley-Liss, Inc.
Key words: common marmoset; microsatellite DNA marker; blood chimera; parentage diagnosis;
fragment analysis
INTRODUCTION
The common marmoset (Callithrix jacchus) is a
member of the new world group of monkeys. It is
small in size (adult: 300–400 g), has a relatively long
life span (415 years), is fertile (typically producing
twins or triplets during parturition) over an extended period (10 years) and is easy to handle.
A number of studies have developed genetic
markers for the common marmoset, including those
for biochemical markers [Meireles et al., 1998;
Scheffrahn, 1978], MHC class I and class II polymorphisms [Antunes et al., 1998; Bontrop, 2006;
Middleton et al., 2004; Otting et al., 2002, 2007;
Prasad et al., 2006; Rölleke et al., 2006; Wu et al.,
2000], mitochondrial DNA RFLPs [Faulkes et al.,
2003; Kocher et al., 1989; Tagliaro et al., 1997],
minisatellite markers [Signer & Jeffreys, 1993] and
microsatellite markers [Nievergelt et al., 1998].
Furthermore, karyotype analysis of the marmoset
was completed by Sherlock et al. [1996].
Microsatellite DNA markers have been generated for humans and a number of laboratory animals
such as mice and rats. They have been used to create
a genetic map, which is useful for locating specific
genes of interest such as biochemical marker genes
and mutations related to genetic diseases. Nievergelt
r 2009 Wiley-Liss, Inc.
et al. [1998] developed 13 polymorphic microsatellite
markers based on the sequencing of several genomic
DNA segments of the common marmoset, which
were integrated in the M13 plasmid of E. coli.
Raveendran et al. [2008] also developed 14 polymorphic microsatellite markers, which can be
detected using a DNA genetic analyzer. Ross et al.
[2007] have used microsatellite DNA markers for
studies on germline chimerism and paternal care in
C. kuhlii.
Currently, the NCBI database (nucleotide) contains many bacterial artificial clones (BACs) of the
common marmoset that are identified by three key
words: ‘‘callithrix,’’ ‘‘jacchus’’ and ‘‘draft.’’ Using
Contract grant sponsors: Ministry of Education, Culture, Sports,
Science and Technology of Japan; Ministry of Health, Labor and
Welfare, Japan.
Correspondence to: Hideki Katoh, Institute for Experimental
Animals, Hamamatsu University School of Medicine, 1-20-1
Handayama, Higashi-ku, Hamamatsu 431-3192, Japan. E-mail:
hideki-k@hama-med.ac.jp, hhidekik@yahoo.co.jp
Received 3 August 2008; revised 31 May 2009; revision accepted
6 June 2009
DOI 10.1002/ajp.20729
Published online 27 July 2009 in Wiley InterScience (www.
interscience.wiley.com).
Microsatellite DNA Marker for Common Marmoset / 913
these sequence data, we designed primer sets for
microsatellite DNA markers and successfully identified 154 markers with PCR products including 80
polymorphic markers.
In this study, we present a list of 154 microsatellite markers that are useful for linkage analyses,
gene mapping and blood chimera analyses. We also
propose a tentative chromosome map of the common
marmoset with these markers.
METHODS
Common Marmosets
In 1983, 11 pairs of marmosets were introduced
from the ICI (London, UK) to the Central Institute
for Experimental Animals (CIEA, Kawasaki, Japan).
They have been maintained by random mating to
retain genetic heterogeneity. In 2006, we obtained 20
pairs of marmosets at fifth to sixth generations from
the CIEA. Marmosets used in this study were
randomly selected from the CIEA and our marmoset
colonies with reference to their pedigrees.
The experimental protocol and design were
approved by the Animal Experimentation Committee
of Hamamatsu University School of Medicine and
performed according to the Guidelines for Animal
Experimentation.
Microsatellite Markers and Genetic
Nomenclature
The genomic DNA sequence data for 295
clones were downloaded from the NCBI database
(http: // www.ncbi.nlm.nih.gov/entrez/query.fcgi?db 5
nucleotide&cmd 5 search&term 5). The sequences
of 153 clones were analyzed with GENETYX
Ver.7.0 (Genetyx, Tokyo, Japan) to develop the
primer sets. The accession number of each clone is
given in Table II. We designed 186 forward and
reverse primer sequences with a length of 20–25 bp
and containing 45–60% GC content. The primers
were designed to produce an 100–400 bp product
consisting of more than ten CA repeats. The primer
sets were synthesized by Invitrogen (Carlsbad, CA).
The microsatellite markers were named according to
the international genetic nomenclature for mice and
rats. Thus, the marker names were constructed
based on Cj (C. jacchus), D (DNA), Ham (laboratory
code for the Hamamatsu University School of
Medicine) and a number, e.g., CjD1Ham1 or
D1Ham1 or Ham1.
PCR and Electrophoresis
Blood and skin samples were collected in
centrifuge tubes containing 500 ml lysis buffer
(100 mM Tris-HCl: pH 7.5, 12.5 mM EDTA2Na,
150 mM NaCl, 1.0% SDS, 50 mg/ml proteinase K)
and then incubated at 551C for 1 h with gentle
shaking. We then added 500 ml of a phenol/chloro-
form/isoamyl alcohol mixture (Nippongene, Tokyo,
Japan) and mixed gently by shaking. The mixture
was then centrifuged at 15,000 rpm for 10 min. The
supernatant was transferred into a new tube and
500 ml of chloroform was added. The resulting
mixture was centrifuged at 15,000 rpm for 10 min.
The supernatant was transferred into a tube containing 1,000 ml of 100% ethanol to extract the
genomic DNA. We then centrifuged the samples at
15,000 rpm for 10 min to separate the DNA pellet.
The supernatant was removed and the pellet
containing the genomic DNA was washed in
1,000 ml of 70% ethanol, centrifuged at 15,000 rpm
for 10 min and left to dry at room temperature. The
genomic DNA was subsequently dissolved in 100 mM
TE (Nippongene) for use as the template in PCR.
The PCR mixtures were prepared following the
manufacturer’s instructions for Taq polymerase
(Takara, Kyoto, Japan). Briefly, 20 ml of the PCR
mixture consisted of 0.5 ml Primer F (10 mM), 0.5 ml
Primer R (10 mM), 2.0 ml PCR buffer (10 ), 1.5 ml
dNTP (2.5 mM), 0.1 ml Taq (5 U/ml), 1.0 ml template
DNA (100 ng/ml) and 14.4 ml distilled water. PCR was
performed using a PTC-100TM (Programmable
Thermal Controller, MJ Research, Watertown, MA)
under the following conditions: 941C for 2 min,
followed by 35 cycles at 941C for 20 sec, 571C for
30 sec and 721C for 40 sec and ending with a single
extension at 721C for 3 min. The resulting PCR
products were electrophoresed for 40 min at 100 V
using 3% agarose ME (Iwai, Tokyo, Japan) in TBE
buffer. The gel was then stained for 15 min in EtBr
solution and the band pattern was recorded using
FAS III (Toyobo, Osaka, Japan).
Genotyping Using an Automated Sequencer
A single base difference in the PCR product can
be detected by conducting DNA fragment analysis
with an automated sequencer. We developed a
genotyping system using an ABI3100 sequencer with
five microsatellite markers located on different
chromosomes: D4Ham1, D6q (or D14) Ham21,
D10qHam51, D11Ham187 and D21Ham11. Each
marker produces a different size PCR product and
maps to a unique chromosome. The 50 end of the
forward primers was labeled with 6-FAM, VIC,
6-FAM, NED and PED, respectively, by Applied
Biosystems Japan (Tokyo, Japan). The markers were
amplified using the fluorescence-labeled primers
(10 pmol/ml) according to the method described
above.
We mixed 2.5, 10.0, 5.0, 2.5 or 10.0 ml of each
PCR product (D4Ham1, D21Ham11, D6q (or D14)
Ham21, D10qHam51 and D11Ham187, respectively)
with 70 ml of distilled water. One microliter of the
mixture was added to 10 ml of a mixture of 20 ml LIZ
size standard and 360 ml HiDi formamide (Applied
Biosystems Japan) in a 96-well plate (Applied
Am. J. Primatol.
914 / Katoh et al.
Biosystems Japan). The mixture was denatured at
951C for 5 min and then cooled on ice. The mixture
was then sequenced using an ABI3100 sequencer
(Applied Biosystems Japan) according to the manufacturer’s protocol.
RESULTS
Newly Developed Microsatellite DNA Markers
We searched 153 of 295 BAC DNA sequences
that were archived in the NCBI database in 2004 to
select the microsatellite DNA markers. On the basis
of the search, we designed 186 PCR primer sets. The
primer sets were used to identify microsatellite
markers in the genomic DNA of five marmosets
randomly selected from the CIEA colony.
The PCR results are given in Table I. The PCR
products were divided into five groups according to
the predicted product sizes. Of the 186 primer sets,
157 (84.4%) produced PCR products. Twenty-two
(76%) of 29 markers without PCR products belonged
to the 101–150 and 151–200 bp groups. The proportion of the primer sets with PCR products to the
primer sets designed in this study was 75.4–95.1%.
We searched the entire human genome sequences using an 3 kb section of each forward
primer sequence of 157 microsatellite DNA markers,
including the sequence 1.5 kb upstream and
1.5 kb downstream, with the BLAST search
(http://www.ncbi.nlm.nih.gov/BLAST/). One hundred
and fifty-four forward primer sequences were assigned to the human autosomes and the X chromosome, whereas three were not assigned to any human
chromosome. The 154 microsatellite DNA markers
with their primer sets are given in Table II and are
listed in the order of chromosome numbers of
common marmosets, which was previously assigned
by chromosome painting techniques with human
chromosomes [Sherlock et al., 1996].
Fragment Analysis
We developed a fragment analysis method to
routinely perform blood chimera analysis, parentage
diagnosis and individual identification. We selected
five polymorphic markers, D4Ham1, D6q (or D14)
Ham21, D10qHam51, D11Ham187 and D21Ham11
based on PCR product sizes ranging from 100 to
200 bp. When we genotyped 48 marmosets using an
ABI3100 sequencer, we identified 10 alleles (150,
188, 190, 192, 194, 196, 198, 200, 202 and 204 bp) for
D4Ham1, 7 alleles (140, 144, 146, 148, 150, 152 and
154 bp) for D6q (or D14) Ham21, 7 alleles (95, 97, 99,
101, 103, 105 and 107 bp) for D10qHam51, 4 alleles
(201, 207, 213 and 215 bp) for D11Ham187 and 14
alleles (133, 137, 147, 149, 153, 155, 157, 159, 165,
167, 169, 171, 173 and 175 bp) for D21Ham11.
Heterozygosity of each marker was 0.235, 0.197,
0.223, 0.711 and 0.287, respectively.
Genotyping Using Skin and Blood DNA
Samples
Figure 1 shows PCR band patterns of the
D3Ham146 marker using skin and blood DNA
samples of three marmosets. Marmosets H485 and
H499 showed the same band patterns in skin and
blood samples, respectively. However, H502 showed
a single band with a skin DNA sample, but two bands
using a blood DNA sample, in which a smaller-sized
band showed stronger staining than the larger-sized
band. These results indicate that the H502 blood was
contaminated with that of littermates that shared
the placenta and also that blood samples are
inappropriate for DNA genotyping.
DISCUSSION
We successfully assigned 154 microsatellite DNA
markers on human chromosomes. Of these, 77
markers were polymorphic. Owing to the low
number of individuals used for the identification of
polymorphisms, we may underestimate the number
of polymorphic markers.
In this study, we designed 186 primer sets using
153 of 295 BACs that were archived in the NCBI
database in 2004. In 2008, the number of BACs had
increased to 435. By using these additional clones
(n 5 282), we may be able to prepare additional
microsatellite DNA markers and increase the number of polymorphic markers to improve the chromosome map.
TABLE I. The Distribution of PCR Product Sizes of Newly Developed Microsatellite DNA Markers Developed in
This Study
Product size (bp)
predicted
101–150
151–200
201–250
251–300
4301
The number of microsatellite markers
Am. J. Primatol.
No. primer sets
designed (%)
41
65
41
29
10
186
No. primer sets with
product (%)
35
49
39
26
8
No. primer sets with
no product (%)
(85.4)
(75.4)
(95.1)
(89.7)
(80.0)
6 (14.6)
16 (24.6)
2 (4.9)
3 (10.3)
2 (20.0)
157 (84.4)
29 (15.6)
Microsatellite DNA Marker for Common Marmoset / 915
TABLE II. Microsatellite DNA Markers of the Common Marmoset That Were Developed in This Study
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
Ham Markers
(NCBI AC Number)
Ham149 (150224)
Ham6
(150225)
Ham157 (150228)
Ham161 (150616)
Ham144 (150728)
Ham29 (150728)
Ham18 (150221)
Ham35 (150221)
Ham113 (150459)
Ham177 (148733)
Ham20 (148733)
Ham190 (150612)
Ham64 (150612)
Ham186 (150805)
Ham60 (150809)
Ham90 (150829)
Ham91 (150830)
Ham117 (151030)
Ham57 (150452)
Ham65 (150725)
Ham31 (150726)
Ham13 (150377)
Ham147 (150298)
Ham8
(150298)
Ham164 (150599)
Ham163 (150600)
Ham34 (150611)
Ham181 (151430)
Ham55 (151430)
Ham74 (151035)
Ham146 (150216)
Ham155 (150009)
Ham158 (150295)
Ham96 (150295)
Ham123 (150455)
Ham1
(149550)
Ham176 149550
Ham2
(149550)
Ham185 (151019)
Ham184 (151021)
Ham172 (151381)
Ham129 (150605)
Ham67 (150605)
Ham46 (150717)
Ham78 (151025)
Ham132 (150613)
Ham45 (150718)
Ham71 (151546)
Ham133 (150456)
Ham22 (150462)
Ham171 (148501)
(148501)
Ham3
Ham41 (148551)
Ham72 (150617)
Ham44 (150719)
Ham89 (150816)
Ham66 (151488)
Ham125 (152015)
Ham193 (152015)
Ham167 (150464)
Ham200 (152846)
Ham21 (149839)
Ham141 (150012)
Ham159 (150220)
Ham105 (151934)
Ham17 (150287)
Ham15 (150292)
Ham37 (150292)
Ham137 (150453)
Ham25 (150453)
Ham154 (151016)
Ham116 (151034)
Marmoset
Chromosome
Human chromosomes
(BLAST search result)
13q (NT_024524.13)
1p
13q (NT_027140.6)
9q (NT_024000.16)
9q (NT_008470.18)
1q
22q (NT_011520.11)
5q (NT_006713.14)
2
5q (NT_029289.10)
5q (NT_034772.5)
4q (NT_077444.3)
3
4q (NT_016354.18)
6p (NT_007592.14)
6q (NT_007299.12)
4
6q (NT_025741.14)
6q (NT_007422.13)
5p
20q (NT_028392.5)
5q
6p or 10pq
17q (NT_010755.15)
15q (NT_010194.16)
2p (NT_022184.14)
6q or 14
2q (NT_022135.15)
2q (NT_005403.16)
Primer F
(Forward)
gaaactcatctcctacctga
gagctgttgggtagttttcacca
cagccaacatgcttctcagt
tccgaataacagtgagccaa
gtttgaagatggggtttcacac
gtagggtgacttatgaaagcacag
agtggaggctgcagtgagttgtg
caggatggtctcgatctcttg
tgcacgcacatacacaggattg
aggactgggatgtgcagaagg
acagagaagtcctgttagacc
ctatgctgggcaagcacgtct
cagtgcctcagacacaaagg
ggatacaatggggaacagaac
tgctctagaggttccactctg
ggattacaggtgtgagccatt
cctgcacccgtaaataggttc
tacacgaggctgaccatctc
cctacagaatatccgccatct
tgagaacgactgctctaggt
gggtccaataattcctgaaacc
aaaatcccagccacaagaggt
aacatagtgagacccgtcttc
tctgggaatttcccctaacc
ggtgacttgcaacaaactcatc
ggtgcctaaatcccagctga
ggtgacagtgagatcttgcatc
caatgagatgtgtccaagtgag
gagagctattaccaacgaacac
gctcactgaaacctccatct
cttaattctgccacagtagcac
ctagcacacctacattctcca
cctcagtcatgaccacacca
ccagaacctcagtcatgacc
aacgacttccggaagagttg
ctgggacattttgattgtcg
agttaccacacccagcctaa
acccctgtttgacaaataggaaag
cttcttcccacatccctctac
ggcgcagctcatctcttcac
ggcgcagctcatctcttcac
atgtgtgcttcacctctacac
cctgactacagagtggcagtt
cctttgagctagaactgcaaggt
caactgaagtcgtaattccc
gggttgctagaaaccatcac
ctatctagttcaggagctggcaa
gtccaacaaccacagaacag
agcactttgggagatgaagg
agggctgatactcaactggtag
gactcaaatggcgtttgtctac
agatgtggcagttgtcttgg
cacatgtactccctgaacct
aagatcgtgccactgtactcc
cccctagttttgaatcctttccag
tgagcctaggagttcaagac
tggtctcgaactcctgacct
gtgggtaaatgctgccatct
aacagggaactacaagctac
caaaatcccatctccaccaa
ccttacgtttctcttggctgtt
tcacaacacagggacatctc
gtggggtcacaaatcctaac
gagtgagactctgtaagacaca
gtggggtcacaaatcctaac
ttcagctcaacacgataaggg
gggcttgtaaactagtacaacctc
gggcttgtaaactagtacaacc
ccaaaggagccctctttcctca
ggatggtttgtcacttcagag
gcagtggatatttcagcctt
ctttccttctcacccatcctct
Primer R
(Reverse)
gtgattcctcttgaatggag
cgctcaaatttccactcactgct
ggtggaataaatcaggctaccag
ctgctgtttcagtctgaacac
tgtaccactgcactattgcc
ccacatagtttctcatcctcagtc
gccagggcaagtgtgtatgtgagtg
ttctggaggcagaagaatgg
tgtgtgagtgcctgcatgtc
ctcaggtgggcaagcactca
gtgatcatgggtacatctgtg
ccgggcaacatagacctttgtctc
aggccccagtttaggaactc
actggtgaaactgtgacttg
ggcatgttacctaacctctctg
cacacctacatgctatcaaccag
catcctgggcaacaagagtg
cctggtatgcgaaggttcca
cgaaagagaaatggagccaa
tggaagtggcttcattcctg
agactcagtcaagtcttaaccc
gtgggtgaattttgaggaaaggg
acctcctgaactcaagcaatc
caatactgcaccaccctact
gctgagtagtattccatggtgt
agcctcctgagtagctggaa
cttcttcaagtggggtttcagg
ccaaacacccaatatgcagt
ccgtggagatattcttaactgg
gtggaacatgaggtcaggaa
gagagtccctaaatgcaagga
gtcacttaaagcacgggtttc
cagagaacacagggagctca
ctgctgtcaaaatccacagag
aactcccacggaataaaggg
ttgggctagatcttggcatt
gtagtccttcagtgactgaacc
gcaaatcaacttcttagcaggtgt
gttttcctgggagaccagaa
cctccccagcatcttcaagac
gctgtacctccccagcatct
tcatttgtgaggctctgctt
tccagcctgggtaacaagag
gagacaggttttctccatgttggt
gtgctatctgaaagttgctg
ctcttctcccaagtactcct
ctgggtgacagagcaagacc
gcattatgtccatggtaatccc
tcacctgagtagctgggatt
tcagttgctgcaacgtcaag
tttcacaggcaacagcattc
tctctgccatagtgacctct
gtgaagaatgtgtgccgttt
gttgcccacaggattgacttg
ttccaattcctgagctcaggtt
tgagtagctgggattacagg
cagtaagttccctgtgatggct
gtttcaactcctgcgtctagtc
gagtctggtaagatacctactg
agctgggattataggcaagt
cttcctccctataagttcgtcttc
ttgtactctcctggaggctt
ggttagcctattttcctagcac
acagaccttcacaacgaact
ggttagcctattttcctagcac
tggtggagtgtttagggttt
ctgccattaacatgcctctgt
gccattaacatgcctctgtg
ttacctgcagctgagtccctt
tatattctccacgctgagcc
ctcattctttctccaccaca
acagagcatacctgtggctt
Product
(bp)
146
278
181
159
224
204
134
324
112
147
281
310
101
159
135
201
152
186
235
163
138
200
150
286
175
245
238
214
268
201
138
248
313
335
165
197
230
280
204
176
182
322
283
197
177
296
212
162
165
227
170
106
158
256
128
149
295
145
258
134
210
152
215
151
215
323
174
172
226
213
138
276
Polymorphism*
M
P(3)
P(2)
M
M
M
P(2)
P(2)
M
M
M
M
P(2)
M
P(3)
P(2)
P(4)
M
P(3)
P(2)
M
M
M
P(2)
M
M
M
P(3)
P(4)
M
P(3)
P(2)
M
P(3)
P(2)
P(3)
M
M
P(2)
P(3)
M
M
P(2)
M
P(2)
P(2)
P(2)
P(3)
M
P(3)
P(2)
P(5)
P(2)
M
M
M
P(2)
P(3)
M
M
M
P(3)
P(2)
P(3)
M
M
M
M
P(2)
M
M
P(2)
Am. J. Primatol.
916 / Katoh et al.
TABLE II. Continued.
Ham Markers
(NCBI AC Number)
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
Ham192
Ham131
Ham70
Ham76
Ham142
Ham148
Ham175
Ham173
Ham101
Ham5
Ham197
Ham127
Ham50
Ham130
Ham151
Ham152
Ham180
Ham75
Ham189
Ham128
Ham178
Ham195
Ham52
Ham111
Ham59
Ham119
Ham122
Ham61
Ham112
Ham62
Ham73
Ham85
Ham4
Ham136
Ham24
Ham32
Ham53
Ham36
Ham56
Ham83
Ham120
Ham82
Ham51
Ham93
Ham39
Ham187
Ham30
Ham77
Ham95
Ham92
Ham69
Ham84
Ham150
Ham42
Ham49
Ham104
Ham43
Ham81
Ham107
Ham68
Ham102
Ham97
Ham100
Ham48
Ham79
Ham26
Ham40
Ham166
Ham160
Ham124
(151375)
(150463)
(150615)
(150833)
(150011)
(150013)
(150215)
(150219)
(150226)
150226
(152849)
(151435)
(151435)
(150457)
(151020)
151382
(148194)
(151027)
151387
(152124)
(148264)
(148261)
(151433)
(151043)
(151384)
(151542)
(152017)
(151040
(151489)
(151489)
151545
(150223)
(150227)
(150460)
(150460)
(150465)
(151432)
(150606)
(150610)
(150821)
(150808)
(151018)
(151434)
(151434)
148631
(148640)
(150727)
(150823)
(151377)
(150826)
(150720)
(150290)
(150293)
(150603)
148626
(148961)
(150601)
(150604)
(150721)
(150721)
(151935)
(150378)
(150813)
(150813)
(151023)
(150451)
(150458)
(150008)
(150217)
(152016)
Am. J. Primatol.
Marmoset
Chromosome
Human chromosomes
(BLAST search result)
2q (NT_005120.15)
10q (NT_008583.16)
7p or 12q
10q (NT_030059.12)
7q or 18 or 19
1q (NT_004487.18)
1q (NT_034400.4)
7p (NT_007819.16)
7q (NT_079595.2)
7q (NT_007933.14)
7q (NT_079596.2)
8
7q (NT_007933.14)
9
12q (NT_029419.11)
12q (NT_009775.16)
10q
14q (NT_026437.11)
11p (NT_009237.17)
11
11q (NT_033903.7)
11q (NT_033899.7)
16p (NT_010393.15)
12p or 20
16p (NT_037887.4)
12q or 20
16q (NT_010498.15)
8p (NT_030737.9)
13p or 16
13q
8q (NT_008046.15)
18q (NT_010966.13)
18q (NT_025028.13)
Primer F
(Forward)
ctgaatatggtccacccgtatc
ctccagcctgagcaacagag
tgcttctacctgtatccagacac
agagaaaggcaaactgacac
atccaagctgaaggccacatc
tagcacatagcctacaatgtcc
ttgtggctgtaactgcttgt
cacagcataccagatcctatg
agaccaagcatcttcttggac
gctgtcccagtaattgtatgtctc
tgttctgcattgctctacctg
catggtcatgtcactgcact
gcccctactgaaagatctagtgg
agatcctcagtcttgctacac
gagcatcgacaactaggctaa
tcagtgagatggcagacaga
tggtcaaatccactgaaaggag
cctttggagaatggtacctc
gtgcttcccagtaaagtgtg
gtactacacttgcactcacag
atactgcagagaggctcaac
tactgtgcttccatgcacaa
cctacatattgtagggtggcaa
ctagagtaggatgaacccctaa
ctagagtaggatgaacccctaa
cagggatggaagtttatctcc
ggaattcagactgtgcaggtag
caaagatgcttggggatgga
accgatcaggatctgtgact
ttgtggaattgcgatacagg
gtgaaaacagcaagatgggt
ccagagcttatacagccatct
gcctctgtatatggtacaggagt
aatgtccccaacatctgtct
catagtaggatggagaactgg
gcccaaatcctgtttgacac
ccccatctctaccaaacactc
ccttcagtgaaacctgcatc
tatttcgtcactgcctaggac
ttgtacccttttgcttgcag
tcatcaggtgatgctccaac
ccgcctctctataatcaactgg
cgggaattcaaaggcgttct
ccagtttctcaaagggtacca
gctttccactgcaattcgtc
tggaagaactttctgccaaacc
cattgcatcactgtcaacagg
attccattctgggcagcaag
ctaggttttgacacccaacca
atacggtgaaaccctgtctc
gaaggttgttctgtcttccagt
tgatgccattaggctgagattgg
ctgaactcttcctccactga
taccaaatccctgctgcagt
ctctgccacacagccaagag
ggcacgacctctctactgtc
gagtcctaaaccgttgccttga
ttcccctctctttcagacaca
gtacatgtccagtgagcactt
agacaagatgagccaggaac
ccaagtggattgggtgagtg
gtgtgggcaactttgtaagg
gaccaactccaaagctagca
tgggtgacagagcaagacact
agcccaggactttgagacca
gcaaattcgtgaagcattcc
ggactttgttaggtgggaaa
aagttcctaggaccaatccc
cccttactatactgttgcct
aatggtgctctgaaaactgg
Primer R
(Reverse)
gagggaaggcaattctgtgt
tccagagacaaccctggaaac
aaatggttgtgccacttgct
ctctctggaggataaaagggaa
gctttgggcattatggccatt
cctcaagctctttatgtaagcc
ggtttgtgtgcatgtatgagtg
ctctttcagttctgctctagtc
cacctttaaactgctgtggttg
tgcattgctctacctgtcct
gctgtcccagtaattgtatgtctc
ggtatcagggtaatgctggtttc
tgccatgtgtcccttctcatc
gtcatgtgggatgaactcaag
tcacctggccttaaatctctg
cttgaggcagatcttagtgaacag
cattgctttccctctgtggt
cttgggtaatgtgctccttc
gcctacctgatatttgttagcc
tctactcagcatcaggtaagg
aagagagggagcttatggga
ctccaacagctgaaaatgtgg
tcttgagtagctgagaccaca
ctgctacaatatcctgatctcc
tgtttcttggcttctgctac
aaatcccaccaagagtgaag
gtctttgatggcagggatgt
aagatcttgcagggcgtaag
atgcttgtcttccctgcaac
acataactacccgtgctaga
gcccatgtctattcaatccag
cctgcctattggttttgagtg
tgcttctttgctggagatgtg
gaggtcccatttatagcgaatg
ctcatatgcctaaaccacac
ccacctagatcatcgagagtag
tcttggctcattgcaacctc
ctggataaaccccattggtc
gcaggctcctaaataactcca
ttccttcttttggggagtgt
gatgcttactgggccatctc
tccttcttttggggagtgtg
aggaggatttcgcatttggg
ccccaactgacattctaaggac
ttggggaaagacgtggttag
gcttgttcaggcagactgac
cagcttcagaaacgttgcaag
cctcccatactacagatgagga
gagtttaggcagaggtagttgag
tcactgcaacctcttccttc
atgtccagctgtttgctctt
gcttcagtcacaggtgcact
gtcagcaggagttatcacaac
atatgtgccaggcccagaag
tgtgaggacacagggaagagac
gtctcctttggagatcaaagcc
ttgatgaggagcgaatgcgt
cacctcctcttcaagtaaacacc
aattggtgcccctaaactctg
gaagctttgaccactggaag
cagcagggtctgaatgatgg
tgtctgctcagacatgagag
ggtaacatgctctcgacctt
caggcatgcttacagggacaa
gcctcaggcatttgccaaca
aacagttggatgagttccag
gactgattgacagtagaagctc
gtttcaggctggaactactc
gtgttatccgtctattggtg
tctgtgcttttgaggtcttg
Product
(bp)
Polymorphism*
119
239
220
104
249
218
105
240
282
134
139
189
253
138
167
189
179
191
163
139
130
194
272
132
167
273
109
260
286
279
247
239
197
229
141
170
156
235
172
124
213
219
104
129
301
210
297
216
250
157
190
183
166
219
172
127
307
168
284
146
169
240
229
210
135
166
271
211
138
273
P(2)
M
P(2)
P(2)
M
M
P(2)
M
P(3)
M
M
M
P(2)
P(2)
M
M
P(2)
M
M
P(2)
M
P(2)
P(2)
P(2)
P(2)
P(2)
M
P(2)
P(2)
M
P2
M
P(2)
M
M
P(3)
M
M
P(2)
P(3)
P(3)
M
P(3)
M
M
P(2)
P(3)
P(3)
M
M
M
M
P(2)
P(2)
M
M
P(2)
P(2)
P(3)
P(3)
P(3)
P(2)
P(3)
M
P(3)
P(3)
M
M
P(2)
M
Microsatellite DNA Marker for Common Marmoset / 917
TABLE II. Continued.
143
144
145
146
147
148
149
150
151
152
153
154
Ham Markers
(NCBI AC Number)
Ham198 (152848)
Ham110 (151849)
Ham28 (150454)
Ham179 (148736)
Ham11 (150294)
Ham38 (150294)
Ham47 (151471)
Ham103 (151041)
Ham199 (152847)
Ham88 (150817)
Ham80 (150818)
Ham183 (151032)
Marmoset
Chromosome
Human chromosomes
(BLAST search result)
15 or 17
3p (NT_022517.17)
3q (NT_029928.12)
21
21q (NT_011512.10)
22
19q (NT_011109.15)
X
Xq (NT_011726.13)
Primer F
(Forward)
aagtctggccagatcctttg
tgtcacatagagcaacttccag
gagaaagtcaggtgagctaga
cccttttctcttcctctgct
tcctcaagaatgtctacctg
tttagggagaactgacaccttg
tgcccaaataagtcactgcttg
ctgggtaacaagagtgaaactcc
ccactgtccttccctctgact
gttggtgggaatgtggagaa
aacctacccactgctctacac
gttggtgggaatgtggagaa
Primer R
(Reverse)
gtcatagacaggctgtaaggtg
gcctaccagttctgatattgagag
caactgtttggatccaacagg
agtggagctggaattcacac
ggtaatagatagatgacggatggg
cctgggcaatagagggaaac
ctcatagaaggaccatgtggatga
ccctttcctgctaattcacagaag
ggcagagacattggaagcga
agcagacagtggaatggtag
ggtagaagtcatccgtaaagcc
agcagacagtggaatggtag
Product
(bp)
195
165
235
199
166
273
286
125
212
279
120
279
Polymorphism*
M
M
P(2)
M
P(4)
P(3)
P(3)
P(3)
M
M
M
M
Bold lines divide marmoset chromosomes, solid lines divide chromosome arms (p and q) and dotted lines divide cytobands of human chromosomes.
a
M, monomorphic; P, polymorphic and the number of alleles in parentheses.
Μ
Skin DNA
Blood DNA
H485 H499 H502
H485 H499 H502
194
118
(bp)
Fig. 1. Genotyping of a microsatellite DNA marker using the
skin and blood DNA samples. Marmoset H502, which is a blood
chimera, showed one band in the skin DNA and two bands in the
blood DNA. Genotyping was performed three times and the
results were identical. M is the DNA size marker, FX174
digested with HaeIII.
We were able to map 110 microsatellite DNA
markers to a single human autosome and the X
chromosome, as given in Table II. The polymorphic
markers, which are useful for linkage analyses of
various genes and phenotypes, are mapped on marmoset chromosomes 1, 2, 3, 4, 5, 8, 9, 10, 11, 13, 21 and 22.
We expect that this map will be improved following the
development of additional microsatellite markers and
in combination with linkage analyses and in situ
hybridization techniques.
Blood chimeras are a well-known occurrence in
the common marmoset [Benirschke et al., 1962; Ford
& Evans, 1977; Haig, 1999; Ross et al., 2007; Soares,
2007]. The phenomenon typically occurs when two or
more marmosets share a placenta in the uterus.
Therefore, to demonstrate that blood samples are not
appropriate for DNA genotyping, we performed
genotyping of a microsatellite DNA marker that
was developed in this study. The PCR products
obtained using genomic DNA from a blood sample
revealed an extra band, which was not observed in
the sample of genomic DNA obtained from the skin.
Our results strongly suggest that blood is inappropriate as the template DNA source used for
genotyping in the common marmoset.
Breeding and colony management of the common marmoset are important for the prevention of
genetic depression owing to inbreeding [Arruda
et al., 2005; Nievergelt et al., 1998]. Using the
microsatellite DNA markers developed in this study,
we can perform genome-wide screening of the
population genetics of an entire colony. We may be
able to use the markers for genetic analyses of
complicated phenomena observed in breeding groups
[Bezerra et al., 2007].
Scheffrahn [1978] demonstrated genetic polymorphism of transferrin. Meireles et al. [1998]
reported the presence of isozymes in proteins and
enzymes such as glucose phosphate isomerase. However, in the absence of a chromosome or a linkage
map, it has not been possible to map the genes of these
products. The chromosome map and microsatellite
DNA markers that we have developed for the common
marmoset are a useful tool for the identification of
novel genes and for gene mapping in this species.
ACKNOWLEDGMENTS
The authors thank S. Suzuki, J. Itoh and
T. Hirooka for their technical assistance. This work
was supported in part by Grants-in-Aid for Scientific
Research (B) from the Ministry of Education,
Culture, Sports, Science and Technology of Japan,
Grants-in-Aid for Scientific Research (Priority Areas
‘‘Integrative Research Towards the Conquest of
Cancer’’) from the Ministry of Education, Culture,
Sports, Science and Technology of Japan and a Grant
from the Ministry of Health, Labor and Welfare,
Japan. The experimental protocol and design were
approved by the Animal Experimentation Committee
of Hamamatsu University School of Medicine and
performed according to the Guidelines for Animal
Experimentation.
Am. J. Primatol.
918 / Katoh et al.
REFERENCES
Antunes SG, de Groot NG, Brok H, Doxiadis G, Menezes AA,
Otting N, Bontrop RE. 1998. The common marmoset: a new
world primate species with limited Mhc class II variability.
Proc Natl Acad Sci USA 95:11745–11750.
Arruda MF, Araújo A, Sousa MB, Albuquerque FS,
Albuquerque AC, Yamamoto ME. 2005. Two breeding
females within free-living groups may not always indicate
polygyny: alternative subordinate female strategies in
common marmosets (Callithrix jacchus). Folia Primatol
(Basel) 76:10–20.
Benirschke K, Anderson JM, Brownhill LE. 1962. Marrow
chimerism in marmosets. Science 138:513–515.
Bezerra BM, Da Silva Souto A, Schiel N. 2007. Infanticide and
cannibalism in a free-ranging plurally breeding group of
common marmosets (Callithrix jacchus). Am J Primatol
69:945–952.
Bontrop RE. 2006. Comparative genetics of MHC polymorphisms in different primate species: duplications and deletions.
Hum Immunol 67:388–397.
Faulkes CG, Arruda MF, Monteiro Da Cruz MA. 2003.
Matrilineal genetic structure within and among populations
of the cooperatively breeding common marmoset, Callithrix
jacchus. Mol Ecol 12:1101–1108.
Ford CE, Evans EP. 1977. Cytogenetic observations on XX/XY
chimaeras and a reassessment of the evidence for germ cell
chimaerism in heterosexual twin cattle and marmosets.
J Reprod Fertil 49:25–33.
Haig D. 1999. What is a marmoset? Am J Primatol 49:285–296.
Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S,
Villablanca FX, Wilson AC. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci USA
86:6196–6200.
Meireles CM, Czelusniak J, Sampaio I, Schneider H,
Ferrari SF, Coimbra-Filho AF, Pissinatti A, Muniz JA,
Ferreira HS, Schneider MP. 1998. Electrophoretic
polymorphisms and their taxonomic implications in Callitrichini (Primates, Platyrrhini). Biochem Genet 36:229–244.
Middleton SA, Anzenberger G, Knapp LA. 2004. Immunogenetics. Identification of New World monkey MHC-DRB
alleles using PCR, DGGE and direct sequencing. Immunogenetics 55:785–790.
Nievergelt CM, Mundy NI, Woodruff DS. 1998. Microsatellite
primers for genotyping common marmosets (Callithrix
jacchus) and other callitrichids. Mol Ecol 7:1432–1434.
Am. J. Primatol.
Otting N, de Groot NG, Doxiadis GG, Bontrop RE. 2002.
Extensive Mhc-DQB variation in humans and non-human
primate species. Immunogenetics 54:230–239.
Otting N, de Vos-Rouweler AJ, Heijmans CM, de Groot NG,
Doxiadis GG, Bontrop RE. 2007. MHC class I A region
diversity and polymorphism in macaque species. Immunogenetics 59:367–375.
Prasad S, Humphreys I, Kireta S, Gilchrist RB, Bardy P,
Russ GR, Coates PT. 2006. MHC Class II DRB genotyping is
highly predictive of in-vitro alloreactivity in the common
marmoset. J Immunol Methods 314:153–163.
Raveendran M, Tardif S, Ross CN, Austad SN, Harris RA,
Milosavljevic A, Rogers J. 2008. Polymorphic microsatellite
loci for the common marmoset (Callithrix jacchus) designed
using a cost- and time-efficient method. Am J Primatol 70:
906–910.
Rölleke U, Flügge G, Plehm S, Schlumbohm C, Armstrong VW,
Dressel R, Uchanska-Ziegler B, Ziegler A, Fuchs E, Czéh B,
Walter L. 2006. Differential expression of major histocompatibility complex class I molecules in the brain of a New World
monkey, the common marmoset (Callithrix jacchus).
J Neuroimmunol 176:39–50.
Ross CN, French JA, Ortı́ G. 2007. Germ-line chimerism and
paternal care in marmosets (Callithrix kuhlii). Proc Natl
Acad Sci USA 104:6278–6282.
Scheffrahn W. 1978. Transferrin findings in Callithrix jacchus
Linné, 1758 (Primates, Platyrrhina). Anthropol Anz 36:
121–126.
Sherlock JK, Griffin DK, Delhanty JD, Parrington JM. 1996.
Homologies between human and marmoset (Callithrix
jacchus) chromosomes revealed by comparative chromosome painting. Genomics 33:214–219.
Signer EN, Jeffreys AJ. 1993. Application of human minisatellite probes to the development of informative DNA
fingerprints and the isolation of locus-specific markers in
animals. EXS 67:421–428.
Soares C. 2007. All in the family. Paternity shocker: marmoset
twins pass on each other’s genes. Sci Am 297:30.
Tagliaro CH, Schneider MP, Schneider H, Sampaio IC,
Stanhope MJ. 1997. Marmoset phylogenetics, conservation
perspectives, and evolution of the mtDNA control region.
Mol Biol Evol 14:674–684.
Wu MS, Tani K, Sugiyama H, Hibino H, Izawa K, Tanabe T,
Nakazaki Y, Ishii H, Ohashi J, Hohjoh H, Iseki T, Tojo A,
Nakamura Y, Tanioka Y, Tokunaga K, Asano S. 2000. MHC
(major histocompatibility complex)-DRB genes and polymorphisms in common marmoset. J Mol Evol 51:214–222.
Документ
Категория
Без категории
Просмотров
0
Размер файла
137 Кб
Теги
development, markers, common, dna, microsatellite, chromosome, assignments, marmoset
1/--страниц
Пожаловаться на содержимое документа