close

Вход

Забыли?

вход по аккаунту

?

DISC1 exon 11 rare variants found more commonly in schizoaffective spectrum cases than controls.

код для вставкиСкачать
RESEARCH ARTICLE
Neuropsychiatric Genetics
DISC1 Exon 11 Rare Variants Found More Commonly
in Schizoaffective Spectrum Cases Than Controls
E.K. Green,1* D. Grozeva,1 R. Sims,1 R. Raybould,1 L. Forty,1 K. Gordon-Smith,1,2 E. Russell,1
D. St. Clair,3 A.H. Young,4,5 I.N. Ferrier,4 G. Kirov,1 I. Jones,1 L Jones,2 M.J. Owen,1 M.C. O’Donovan,1
and N. Craddock1
1
MRC Centre for Neuropsychiatric Genetics and Genomics, Department of Psychological Medicine and Neurology, School of Medicine,
Cardiff University, Heath Park, Cardiff, United Kingdom
2
Department of Psychiatry, University of Birmingham, National Centre for Mental Health, Birmingham, United Kingdom
3
Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen, United Kingdom
School of Neurology, Neurobiology and Psychiatry, Royal Victoria Infirmary, Newcastle upon Tyne, United Kingdom
4
5
UBC Institute of Mental Health, Detwiller Pavilion Vancouver, British Columbia, Canada
Received 29 October 2010; Accepted 3 March 2011
We previously performed a linkage study using families identified through probands meeting criteria for DSM-IV schizoaffective disorder, bipolar type (SABP) and observed a genomewide significant signal (LOD ¼ 3.54) at chromosome 1q42 close
to DISC1. An initial sequencing study of DISC1 using 14 unrelated DSM-IV SABP samples from the linkage study identified 2
non-synonymous coding SNPs in exon 11 in 2 separate individuals. Here we provide evidence of additional rare coding
SNPs within exon 11. In sequencing exon 11 in 506 cases and
1,211 controls for variants that occurred only once, 4 additional
rare variants were found in cases (P-value ¼ 0.008, Fisher’s exact
trend test). Ó 2011 Wiley-Liss, Inc.
Key words: DISC1; schizoaffective spectrum; rare variants
INTRODUCTION
DISC1 was first identified as spanning the breakpoint on
chromosome 1 of a balanced translocation (1,11)(q42.1;q14.3) in
a large Scottish family which segregated with major mental illness
[St Clair et al., 1990; Blackwood et al., 2001]. We previously
performed a linkage study using families identified through
probands meeting criteria for DSM-IV schizoaffective disorder,
bipolar type (SABP) and observed a genome-wide significant signal
(LOD ¼ 3.54) at chromosome 1q42 close to DISC1 [Hamshere
et al., 2005]. Using 14 DSM-IV SABP samples from this linkage
study we performed a sequencing study, the complete findings
of which will be described in a separate report. Within exon 11 two
non-synonymous coding SNPs (defined from reference sequence
NM_018662) were identified in 2 different cases: 2251G > C
(E751Q) and 2252A > C (E751A). The former has also been
identified in other studies of DISC1 [Porteous and Millar, 2006;
Song et al., 2008, 2010]. Both variants were subsequently identified
in an affected sibling of the individuals originally detected in.
Ó 2011 Wiley-Liss, Inc.
How to Cite this Article:
Green EK, Grozeva D, Sims R, Raybould R,
Forty L, Gordon-Smith K, Russell E, St. Clair
D, Young AH, Ferrier IN, Kirov G, Jones I,
Jones L, Owen MJ, O’Donovan MC,
Craddock N. 2011. DISC1 Exon 11 Rare
Variants Found More Commonly in
Schizoaffective Spectrum Cases Than
Controls.
Am J Med Genet Part B 156:490–492.
Based on those findings, the aim of the current study was to test if
rare variants in exon 11 of the DISC1 gene are associated with
susceptibility to disease in individuals with features of both mania
and psychosis. Interestingly, the known non-synonymous polymorphism rs821616 (Ser704Cys) that has previously been associated with schizophrenia and major depression [Callicott et al., 2005;
Hashimoto et al., 2006] and implicated with human formation of
gray matter and function during memory encoding [Di Giorgio
et al., 2008] is also located in exon 11 of the DISC1 gene. Variation in
DISC1 at rs821616 potentially affects cognitive ageing especially
in women [Thomson et al., 2005]. In addition, a large number of
Additional Supporting Information may be found in the online version of
this article.
Grant sponsor: Wellcome Trust; Grant sponsor: Medical Research Council.
*Correspondence to:
Dr. E.K. Green, Department of Psychological Medicine, School of
Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, UK.
E-mail: greenek@cf.ac.uk
Published online 28 March 2011 in Wiley Online Library
(wileyonlinelibrary.com).
DOI 10.1002/ajmg.b.31187
490
GREEN ET AL.
491
potential DISC1 interactor proteins have been identified and
studies suggest that DISC1 is likely to be involved in many critical
brain functions such as neurogenesis and neuronal migration. Exon
11 encodes part of the protein region involved in interaction with
ATF4/5, LIS1, and GRB2, it has also been reported that the nonsynonymous polymorphism rs821616 within exon 11 may affect
binding of DISC1 to NUDEL [reviewed in Chubb et al., 2008].
MATERIALS AND METHODS
Samples
All of the subjects in these studies were white and of UK origin and
provided written informed consent to participate in genetic studies.
Protocols and procedure were approved by the relevant ethical
review panels where patients were recruited.
the British Blood Transfusion services [Green et al., 2005]; lastly,
109 were obtained from individuals attending a family practitioner
clinic for non-psychiatric reasons [Green et al., 2005].
Sequencing of DISC1 Exon 11
The coding region of Exon 11 of DISC1 was amplified using
Qiagen HotstarTaq DNA Polymerase and the following primers:
forward TGACCAGCTGACTTTTAGCC and reverse: AAGTTTATATGCTCAATGGGAAGC designed using primer 3 (http://frodo.
wi.mit.edu/primer3/). Post-PCR amplification of exon 11, each
product was screened for DNA variants by bi-directional (if
necessary) sequencing using Big-Dye (v3.1) terminator chemistry
and an ABI3100 sequencer according to the manufacturer’s
instructions (Applied Biosystems, California).
Statistical Analysis
Cases
Five hundred and six schizoaffective spectrum cases were sequenced.
We have previously described the concept of ‘‘schizoaffective
spectrum’’ which is a relatively broad group of cases with mixed
features of bipolar and schizophrenia [Craddock and Owen, 2007].
All cases were white UK individuals ascertained and assessed using
the same methodology as described in WTCCC [2007], O’Donovan
et al. [2008], and Raybould et al. [2005]. Cases included those with:
(i) schizophrenia who have had at least one episode of mania
during their lifetime,
(ii) bipolar I disorder with psychotic features and mood incongruence in at least half of all episodes,
(iii) meeting Research Diagnostic Criteria (RDC) for SABP
(including all DSM-IV SABP cases).
Controls
The controls included were sourced from: UK blood service controls for the WTCCC project [WTCCC, 2007]; of the 3,622 samples
recruited 767 were used in this study that had not been genotyped
within the original WTCCC study; a further 335 came from
To obtain an exact P-value for the Cochran–Armitage trend test we
used PROC FREQ in SAS by adding EXACT TREND statement into
the function.
RESULTS
In addition to the two original non-synonymous SNPs identified
above, we identified four further coding SNPs, two non-synonymous and two synonymous. Each of the new variants occurred only
once in the total set of 1,717 individuals sequenced (see Table I). In
addition no variant co-occurred in an individual with 2251G > C
(E751Q), nor was there a difference in frequency of rs821616
between cases and controls for those individuals carrying the
2251G > C (E751Q) variant. All 4 are novel, not reported in
either the SNP database at the National Centre for Biotechnology
Information (NCBI build 36.1), nor to date in the 1,000 genomes
study (www.1000genomes.org) (August 2009 release). Three of the
SNPs occurred in cases meeting RDC SABP criteria, and were
predicted to be benign by polyphen2 [Adzhubei et al., 2010]. The
remaining SNP, 2273 C > G (P758R), was present in an individual
with bipolar I disorder with psychotic symptoms in at least half of
all episodes, and was predicted to be possibly damaging by poly-
TABLE I. Sequence Variants Identified in Exon 11 of the DISC1 Gene
Sequence variant
2160 G > A (R720R)
2208 C > T (L736L)
2261 C > G (T754S)a
2273 C > G (P758R)
2251 G > C (E751Q)b
2252 A > C (E751A)
Control
Original
Case (n ¼ 506)
(n ¼ 1,211)
seq
Position_Mar 2006,
# Cases
Diagnosis
# Controls study*
Sequence
dbSNP130
aagatgagag[g/a]cagatggatg
230,211,271
1/506
RDC-SABP
0/1,211
No
cccccaggct[c/t]cactccgagga
230,211,319
1/506
RDC-SABP
0/1,211
No
agatggaaga[c/g]tcacctcatc
230,211,372
1/506 RDC-SABP and DSM-IV RDC
0/1,211
No
cacctcatcc[c/g]ctctctgcac
230,211,383
1/506
DSM-IV BPI (P > 50)
0/1,211
No
ggtattggaa[g/c]aatggaagac
230,211,362
11/506
—
23/1,211
Yes
gtattggaag[a/c]atggaagact
230,211,363
1/506 RDC-SABP and DSM-IV RDC
2/1,211
Yes
Original seq study*, identifies those sequence variants found in the original sequencing study examining 14 individual meeting DSM-IV criteria for schizoaffective disorder, bipolar type (SABP).
# Cases and # Controls, refers the total number of individuals in which the sequence variant was identified, along with the diagnosis of that individual case.
P > 50, an individual meeting DSM-IV criteria for bipolar I disorder with psychotic features in at least half of all episodes.a2261C > G (T754S) was identified in the same individual by Song et al. [2010].
b
Variant 2251G > C (E751Q) has been previously reported by Porteous and Millar [2006] and Song et al. [2008, 2010].
492
phen2 [Adzhubei et al., 2010]. A case versus control comparison of
DISC1 exon 11 rare variants showed a significant excess of variants
in cases (P-value ¼ 0.008 Fisher’s exact trend test). Interestingly, the
two heterozygous sequence variants previously identified within
exon 11, 2251 G > C (E751Q) [Porteous and Millar, 2006; Song
et al., 2008, 2010] and 2252 A > C (E751A), were each identified
in both case and control individuals in the total set of 1,717
individuals (Table I). The known non-synonymous polymorphism
rs821616 (Ser704Cys) was not significantly associated with
disease (trend P-value ¼ 0.77; MAF cases and controls ¼ 0.30) (see
upplementary Table I). The rs821616 genotype for each of the
four individuals in which a rare sequence variant was identified
is shown in Supplementary Table II.
DISCUSSION
Our findings are consistent with recent studies by Song et al. [2008
and 2010] where sequencing of the DISC1 exons revealed ultra rare
high-risk DISC1 gene missense variants that were associated with
both schizophrenia and bipolar spectrum disorder. It is worth
noting that there are 156 samples in common within this study
and the bipolar spectrum disorder study by Song et al. [2010]. The
sequencing results of the two studies are concordant with each
other, both identifying the rare variant in exon 11, 2261C > G,
T754S. The individuals harboring the remaining three exon 11
variants were not screened by Song et al. [2010].
Our study supports the hypothesis that ultra rare variants in
DISC1 influence risk of major mental disorder. It is important that
further sequencing analyses are undertaken to confirm the findings
in additional schizoaffective spectrum disorder samples. Sequencing exon 11 in large samples of bipolar disorder and schizophrenia
samples would indicate if the same distribution of rare variants were
present across various psychiatric disorders and explore the full
genetic diversity of this exon.
ACKNOWLEDGMENTS
We are indebted to all individuals who have participated in our
research. Funding for recruitment and phenotype assessment has
been provided by the Wellcome Trust and the Medical Research
Council.
REFERENCES
Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P,
Kondrashov AS, Sunyaev SR. 2010. A method and server for predicting
damaging missense mutations. Nat Methods 7:248–249.
Blackwood DH, Fordyce A, Walker MT, St Clair DM, Porteous DJ, Muir
WJ. 2001. Schizophrenia and affective disorders—Cosegregation with a
translocation at chromosome 1q42 that directly disrupts brain-expressed
genes: Clinical and P300 findings in a family. Am J Hum Genet 69:
428–433.
Callicott JH, Straub RE, Pezawas L, Egan MF, Mattay VS, Hariri AR,
Verchinski BA, Meyer-Lindenberg A, Balkissoon R, Kolachana B, Goldberg TE, Weinberger DR. 2005. Variation in DISC1 affects hippocampal
structure and function and increases risk for schizophrenia. Proc Natl
Acad Sci USA 1102:8627–8632.
Chubb JE, Bradshaw NJ, Soares DC, Porteous DJ, Millar JK. 2008. The
DISC locus in psychiatric illness. Mol Psychiatry 13:36–64.
AMERICAN JOURNAL OF MEDICAL GENETICS PART B
Craddock N, Owen MJ. 2007. Rethinking psychosis: The disadvantages
of a dichotomous classification now outweigh the advantages. World
Psychiatry 6:84–91.
Di Giorgio A, Blasi G, Sambataro F, Rampino A, Papazacharias A, Gambi F,
Romano R, Caforio G, Rizzo M, Latorre V, Popolizio T, Kolachana B,
Callicott JH, Nardini M, Weinberger DR, Bertolino A. 2008. Association
of the SerCys DISC1 polymorphism with human hippocampal formation
gray matter and function during memory encoding. Eur J Neurosci 28:
2129–2136.
Green EK, Raybould R, Macgregor S, Gordon-Smith K, Heron J, Hyde S,
Grozeva D, Hamshere M, Williams N, Owen MJ, O’Donovan MC, Jones
L, Jones I, Kirov G, Craddock N. 2005. Operation of the schizophrenia
susceptibility gene, neuregulin 1, across traditional diagnostic boundaries to increase risk for bipolar disorder. Arch Gen Psychiatry 62:
642–648.
Hamshere ML, Bennett P, Williams N, Segurado R, Cardno A, Norton N,
Lambert D, Williams H, Kirov G, Corvin A, Holmans P, Jones L, Jones I,
Gill M, O’Donovan MC, Owen MJ, Craddock N. 2005. Genomewide
linkage scan in schizoaffective disorder: Significant evidence for linkage at
1q42 close to DISC1, and suggestive evidence at 22q11 and 19p13.
Arch Gen Psychiatry 62:1081–1088.
Hashimoto R, Numakawa T, Ohnishi T, Kumamaru E, Yagasaki Y,
Ishimoto T, Mori T, Nemoto K, Adachi N, Izumi A, Chiba S, Noguchi
H, Suzuki T, Iwata N, Ozaki N, Taguchi T, Kamiya A, Kosuga A, Tatsumi
M, Kamijima K, Weinberger DR, Sawa A, Kunugi H. 2006. Impact of the
DISC1 Ser704Cys polymorphism on risk for major depression, brain
morphology and ERK signaling. Hum Mol Genet 15:3024–3033.
O’Donovan MC, Craddock N, Norton N, Williams H, Peirce T, Moskvina
V, Nikolov I, Hamshere M, Carroll L, Georgieva L, Dwyer S, Holmans P,
Marchini JL, Spencer CC, Howie B, Leung HT, Hartmann AM, M€
oller
HJ, Morris DW, Shi Y, Feng G, Hoffmann P, Propping P, Vasilescu C,
Maier W, Rietschel M, Zammit S, Schumacher J, Quinn EM, Schulze TG,
Williams NM, Giegling I, Iwata N, Ikeda M, Darvasi A, Shifman S, He L,
Duan J, Sanders AR, Levinson DF, Gejman PV, Cichon S, N€
othen MM,
Gill M, Corvin A, Rujescu D, Kirov G, Owen MJ, Buccola NG, Mowry BJ,
Freedman R, Amin F, Black DW, Silverman JM, Byerley WF, Cloninger
CR, Molecular Genetics of Schizophrenia Collaboration. 2008. Identification of loci associated with schizophrenia by genome-wide association
and follow-up. Nat Genet 40:1053–1055.
Porteous DJ, Millar JK. 2006. Disrupted in schizophrenia 1: Building brains
and memories. Trends Mol Med 12:255–261.
Raybould R, Green EK, MacGregor S, Gordon-Smith K, Heron J, Hyde S,
Caesar S, Nikolov I, Williams N, Jones L, O’Donovan MC, Owen MJ,
Jones I, Kirov G, Craddock N. 2005. Bipolar disorder and polymorphisms
in the dysbindin gene (DTNBP1). Biol Psychiatry 57:696–701.
Song W, Li W, Feng J, Heston LL, Scaringe WA, Sommer SS. 2008.
Identification of high risk DISC1 structural variants with a 2% attributable risk for schizophrenia. Biochem Biophys Res Commun 367:
700–706.
Song W, Li W, Feng J, Noltner K, Yan J, Green EK, Grozeva D, Jones IR,
Craddock N, Longmate J, Sommer SS. 2010. Identification of high risk
DISC1 protein structural variants in patients with bipolar spectrum
disorder. Neurosci Lett 486:136–140.
St Clair D, Blackwood D, Muir W, Carothers A, Walker M, Spowart G,
Gosden C, Evans HJ. 1990. Association within a family of a balanced
autosomal translocation with major mental illness. Lancet 336:13–16.
Thomson PA, Harris SE, Starr JM, Whalley LJ, Porteous DJ, Deary IJ. 2005.
Association between genotype at an exonic SNP in DISC1 and normal
cognitive aging. Neurosci Lett 389:41–45.
Wellcome Trust Case Control Consortium. 2007. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared
controls. Nature 447:661–678.
Документ
Категория
Без категории
Просмотров
0
Размер файла
81 Кб
Теги
exon, spectrum, found, variant, schizoaffective, case, disco, rare, control, commonly
1/--страниц
Пожаловаться на содержимое документа