close

Вход

Забыли?

вход по аккаунту

?

Distinct pH homeostatic features in lymphoblasts from Alzheimer's disease patients.

код для вставкиСкачать
Distinct pH Homeostatic Features in
Lymphoblasts from Alzheimer's
Disease Patients
Dolores Ibarreta, PhD, Elena Urcelay, PhD, Roberto Parrilla, MD, PhD, and Matilde S. Ayuso, PhD
Epstein-Bart-transformed lymphocytes from Alzheimer's disease patients showed the following distinct features in controlling the intracellular pH compared with cells from normal age-matched controls: (1) The aIgM-induced intracellular
acidification was more pronounced in Alzheimer's disease than control cells and this effect appears to be associated with
a loss of effectiveness of a Ca'+/calmodulin-dependent mechanism in controlling the activity of the Na+/H+ exchanger;
and (2) the intracellular H+-bu@eringcapacity and the rate of proton efflux in response to an acid load were both
decreased in Alzheimer's disease cells. It is concluded that the amplitude of the intracellular pH changes under acidloading conditions will always be greater in Alzheimer's disease than in control cells.
Ibarreta D, Urcelay E, Parrilla R, Ayuso MS. Distinct pH homeostatic features in lymphoblasts
from Alzheimer's disease patients. Ann Neurol 1998;44:216-222
One of the neuropathological hallmarks of Alzheimer's
disease (AD) is the formation of extracellular amyloid
plaques and intracellular neurofibrillary tangles. The
main component of the amyloid plaques is the
P-amyloid peptide.2 The most current hypothesis relates the neuronal damage that accompanies AD to an
elevated P-amyloid production caused by either an
overexpression of its protein precursor moiety (amyloid
precursor protein, APP) or by changes in its processing.
That P-amyloid has neurotoxic effects either in vitro3,*
or in transgenic mice overexpressing it5 has supported
the hypothesis.
The neurotoxic effects of the P-amyloid peptide
have been related to its capacity to perturb the cellular
calcium homeostasis with the result of increased steadystare levels of cytosolic free calcium levels."'
AII
altered Ca2+ homeostasis has been reported in extraneural cells from patients suffering Alzheimer's dementia. 10,11 In this regard, it should be noted that the
hypothesis of neuronal cell death as a result of elevated
intracellular free [Ca"'] 1 2 , 1 3 and intracellular acidification'* is perhaps the most widely accepted. A possible
role of intracellular pH in the neuronal death that accompanies AD is suggested by the observation that the
generation of amyloid fibrils in vitro is pH dependent.' Moreover, intracellular pH appears to disturb
the basolateral secretion of APP in transfected kidney
cells in the same way that one of the mutations asso-
ciated with AD.'6 O n these grounds, we considered it
of interest to investigate the possibility that a perturbation in the cellular pH homeostasis might be associated
with some forms of AD. We used Epstein-Barr virusimmortalized lymphocytes from AD patients as an experimental model. Previous investigations showed that
extraneural tissues have distinct characteristics associated with AD.'7-'' O n this basis, we assumed that AD
is a systemic disorder with more prominent neurological manifestations, and therefore, the use of lymphoblasts as an experimental model could provide valid information about the pathogenic mechanisms of the
d'isease.
Infection with the Epstein-Barr virus induces a lymphoblastic transformation preferentially, if not exclusively, of B lymphocytes.20~2'The lymphoblastoid cell
lines resulting from the viral transformation produce
IgM.22 The stimulation of B lymphocytes with antibodies against IgM (aIgM) triggers an intracellular signaling
pathway that leads to increased cytosolic free C ~ * + . " Z ~ ~
Because changes in the free cytosolic [Ca"'] are accompanied by parallel changes in intracellular pH:*
we
found it of interest to investigate whether the altered calcium responsiveness of AD cells on cellular activation
was also accompanied by intracellular pH changes. The
results of this study indicate that cells from AD patients
show distinct intracellular pH homeostatic features that
could be of pathogenic significance.
From the Department of Pathophysiology and Human Molecular
Genetics, Centro de Investigaciones Biol6gicas (CSIC), Madrid,
Spain.
Address correspondence to Dr Ayuso, Centro de Investigaciones
Biol6gicas (CSIC), Vel&quez 144, 28006 Madrid, Spain.
'
Received Aug 15, 1997, and in revised form Jan 12 and Feb 20,
1998. Accepted for publication Feb 23, 1998.
216
Copyright 0 1998 by the American Neurological Association
Subjects and Methods
Nineteen patients diagnosed in the Department of Neurology of the University Hospital Doce de Octubre (Madrid,
Spain) with probable AD, according to NINCDS-ADRDA
(National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer’s Disease and Related Disorders
Association) criteria,25 were used in this study. The degree of
dementia was assessed by the Mini-Mental Test,,‘ being the
mean value obtained of 11 ? 2 points, ranging from 7 to 14
points. The average age of onset of the disease was 74 2 2
years. A group of 17 healthy age-matched individuals (average age, 72
3 years), without any clinical symptom of
dementia, was used as control.
We isolated genomic DNA from peripheral blood specimens of all AD patients and age-matched controls used in
the present study. Exons 16 and 17 of the APP gene were
polymerase chain reaction-amplified, using the following
primers: exon 16, sense primer: S’GCGCCGCCCGCCC
*
CCGCCGCCCCGCCCGCGCCCGCGCCCCGTTGTCC
TGCACTTTAAT-3’, antisense primer: 5’GTGGGAAA
GAGGTAAATTATT-3’; and exon 17, sense primer: 5’GCG
CCGCCCGCCCCCGCCGCCCCGCCCGCGCCCGCGC
CCCAGTTGGGCACACAATATAC-3’, antisense primer:
5‘AAAGAACAACTGTAACCCAA-3’.
No mutations were
found in the APP gene of AD patients or age-matched controls by denaturing gradient gel electrophoresis analysis” of
polymerase chain reaction-amplified exon 16 or 17. We did
not search for mutations in the presenilin 1 and 2 genes,
because they are clearly associated with the early-onset form
of AD.,*
Screening of the distribution of the apolipoprotein E alleles was performed as previously reported.*’ The observed
frequency of the apolipoprotein E e4 allele, 3% in the control group versus 39% in the AD group, was similar to that
previously reported for the normal and AD population of
Spain” and consistent with the late-onset form of AD.
Lymphocytes were obtained by centrifugation of peripheral blood on Ficoll-Hypaque density gradient.31 The
Epstein-Barr virus transformation was achieved as previously
described.’, Cells were grown in suspension in T flasks in an
upright position, in approximately 15 ml of RPMI-1640
(GibcoBRL, Barcelona, Spain) medium that contained 2
mM L-glutamine, 100 pglml streptomycin, and 10% (vol/
vol) fetal calf serum. Fluid was routinely changed on day 3
by removing the medium above the settled cells and replacing it with an equal volume of fresh medium.
Intracellular p H was determined in cells preincubated for
30 min, at 37”C, with 5 M 2’,7’-biscarboxyethy1-5,6carboxyfluorescein (BCECF, Boehringer Mannheim, Barcelona, Spain) in 10 mM HEPES buffer, p H 7.4, containing
140 m M NaCI, 1 m M K,HP04, 1 mM CaCI,, and 5 m M
KCI. After centrifugation, the cells were rinsed twice with
this buffer. To determine intracellular pH, approximately 0.5
to 1 x lo6 cells were suspended in 2 ml and placed in the
thermostated cuvette holder of a Perkin-Elmer LS 50B spectrofluorometer (Beaconsfield, Buckinghamshire, UK), using
the Fast Filter program for recording the fluorescence at 510
nm when excited at 495 and 440 nm, alternately. Intracellular pH was calculated as described.33
Intracellular p H buffer capacity was calculated from the
p H change determined on addition of 20 m M propionic
acid as de~cribed.~,
The free cytosolic concentration of Ca2+ was determined
in cells preincubated for 30 min, at 3 T C , with 2 p M fura-2
acetoxymethyl ester in 10 m M HEPES buffer, pH 7.4, containing 145 m M NaCI, 1 mM Na,HP04, 1 mM CaCI,, 0.5
mM MgSO,, 5 m M glucose, and 5 m M KCI. After centrifugation, the cells were rinsed twice with this buffer. The determination of the free cytosolic Ca2+ concentration was
performed as described above for the determination of the
intracellular pH, but by using 340 and 380 nm wavelengths,
alternately. Cytosolic [Ca2+] was calculated as de~cribed.’~
Statistical analysis was performed with the StatView package for the Macintosh computer. Data are expressed as
mean 5 SEM values, and the statistical significance of the
differences was assessed by unpaired, two-tailed t test. When
the sets of data to be compared were obtained from different
aliquots of the same cell preparation, the comparison was
made by paired t test.
Results
Intracellular pH Response to Antibodies Anti-IgM
Figure 1 depicts the aIgM-induced intracellular pH
changes in lymphoblasts from control or AD patients
in the presence or in the absence of extracellular Ca2+.
Stimulation with aIgM elicits an intracellular acidification that is significantly higher in AD than in control
lymphoblasts. In the absence of extracellular Ca2+, the
aIgM-induced intracellular acidification was enhanced
and no significant difference was appreciated between
control and AD cells. Thus, the enhanced pH responsiveness of AD cells can be mimicked by control cells
in the absence of extracellular Ca2+.
Fig 1. Intracellular p H response to aIgM of lymphobhts )om
control or Alzheimer j disease (AD) patients. The experiment
was pe6ormed as described in Subjects and Methods, in the
presence of either normal (1.3 mM) or no extracellular
[Ca2’J. The intracellular p H response to aIgM (20 pghl)
was determined in 13 control and 14 A D lymphoblastic cell
lines. 9 = 0.001, A D us control; *”p = 0.01, 1.3 mM
Ca2+ us no Ca2+ added (unpaired, one-tail t test).
0.06
0.05
%
0,04
0,03
0.02
0,Ol
0
[Ca2+le:
1.3 m M
None
Ibarreta et al: Intracellular p H in AD
217
Activity o f the N a + / p Exchanger and Cellular K'
Bufer Capacity
Figure 1 and the cellular H+-buffering capacity of each
cell line. Table 1 also shows that extrapolation of the
rate of H+ efflux to that obtained at an extracellular
pH of 6 , supposedly the maximal velocity of H+ efflux, was similar in AD and control cells, implying that
the acid production in response to cellular stimulation
had to be similar in both types of cells, and thus indicating that the number of plasma membrane Na+/H+
exchangers cannot be significantly different.
Because intracellular pH is an indication of the steadystate levels of free [H+], the differential pH responses
in AD and control lymphoblasts may be the result of
altered rates of generation or disposal of H+ in AD
lymphoblasts. Thus, we investigated whether the acidextruding mechanisms were affected in the AD cells.
T o induce a cellular acid loading we used the propionic acid and nigericin methods.34236The recovery
from an acid load was completely inhibited by ethyl
isopropyl amiloride (EIPA, Research Biochemicals International, Natick, MA; Fig 2A and C), an N a f / H +
exchange blocker, indicative of the dependence of this
process on the exchanger activation. Regardless of the
method used, the rate of recovery of the intracellular
pH from an acid load was significantly higher in AD
than in control lymphoblasts (see Fig 2B and D).
The results obtained with the propionic acid method
(see Fig 2) allowed us to calculate the cellular intrinsic
H + buffer capacity, defined as the concentration of
H + needed to change the intracellular pH in one
unit.34 The calculated buffer capacity of AD lymphoblasts was found to be significantly lower than that of
control lymphoblasts (Fig 3, top). Calculation of the
intracellular change in [H+]
that follows aIgM stimulation, from data shown in Figure 1, considering the
values obtained for the [H+]-buffering capacity of each
cell line, shows no difference between AD and control
cells (see Fig 3 , bottom).
Table 1 shows that the rate of cellular Hf efflux is
significantly smaller in AD lymphoblasts than in control cells, when it was calculated considering data in
Relationship Between the CyIgM-Induced Changes in
Intracellular Ca2+ and pH in AD and Control Cells
We have recently reported a different Ca2+-buffering
capacity between AD and control lymphoblasts."
Thus, we investigated whether the distinct pH responsiveness to aIgM of AD lymphoblasts was related to
the different free cytosolic [Ca2'] responses attained in
both types of cells. We then studied the aIgM-induced
intracellular pH changes in lymphoblasts maintained in
Ca2+-free medium, to attain a partial cellular depletion
of this ion. Figure 1 shows that in these conditions, the
intracellular pH response is significantly enhanced
compared with that of cells incubated in normal
calcium-containing medium and that no differences
were appreciated between AD and control lymphoblasts. To determine whether the inflow of Ca2+ acted
through the activation of Ca2+/calmodulin-dependent
processes or simply by exchanging with H+ or other
ions across the plasma membrane, we studied the effect
of N-(6-aminohexyl)-5-chloro1-naphthalenesulfonamide
(W-7; Sigma, St Louis, MO), a calmodulin antagon i ~ t , ~on
' cells maintained in normal Ca2+-containing
medium. The intracellular [Ca2'] response to aIgM
*
A
propionic acid
cCNlR3
7.25
EIPA
PHi
(XNlROL
nigericin
AD
1 min
D
.....
.....
.....
.....
.....
.....
NaCl
6.75
(XNlROL
6.5
218
Annals of Neurology
Vol 44 No 2
August 1998
AD
Fig 2. Intracellular p H recovery rate j o m an acid load.
The experiment was performed as described in Subjects
and Methods. (A) Intracellular p H response to 50 mM
propionic acid in the absence or in the presence of IO
p M ethyl isopropyl amiloride (EIPA). (B) Mean values
of the initial rate (30 seconds) of intracellularp H recovey in 10 control and 9 Alzheimeri disease (AD)
lymphoblastics cell lines. (C) Intracellular pH response
to 5 p M nigericin. 2',7'
-Biscarboxyethyl-5,6carboxyflorescein (BCECfl-charged lymphoblasts were
prepared as described in Subjects and Methods, but the
final wash was performed with the same buffer in
which the same concentration of choline chloride was
substituted for Nai. When indicated, 5 m g h l albumin
was added to complex the nigericin and either 50 mM
NaCl alone or with I0 p M EIPA was added. ( 0 )
Mean values of the initial rate (30 seconds) of intracellular p H recovery in I 0 control and 9 A D lymphoblastic cell lines. Vertical bars are SEM values. 9 = 0.05;
"9= 0.003 (unpaired, one-tailed t test).
Table 1. Rate of H‘ Eflux in Response to an Acid Load
H+ Efflux (mMlmin)
T
L
. . .!.... 1
..........
...........
..........
...........
..........
..........
...........
...................
..........
..........
..........
..........
0.3
...........
..........
0,...........
..........
...........
..........
...........
Y 2z
..........
..........
..........
.........
8
..........
g
50...................
.........i
..........
..........
..........
...........
..........
..........
..........
...........
..........
...........
..........
..........
..........
...........
..........
0 _r,...................loo.@ E
Control
*
/..........
’
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
..........
.... .,....-47
AD
Initial rate
Maximal rate
Control
AD
122 1
9 2 0.6“
66 ? 5
67 3- 7
The experiment was described in Figure 3. The values of the initial
rate of H+ efflux were calculated from the data of p H recovery
obtained after propionic acid addition, taking into account the pHbuffering capacity of each sample, For the calculation of the maximal rate of H + efflux, the values of the initial rate of p H recovery,
obtained after acidification with propionic acid, were plotted against
the corresponding intracellular pH. The extrapolation of the data to
p H 6 was taken as the maximal rate of H+ efflux. Data are average
values of 14 control and 10 Alzheimer’s disease (AD) lymphoblastic
cell lines 5 SEM values.
“p = 0.05, by unpaired, one-tail t test.
cubated either in Ca2+-free medium or in the presence
of W-7 (see Fig 4, bottom), indicating that the H +
mobilization required to reach the intracellular pH was
smaller in AD than in control cells.
Discussion
[Ca*+le:
1.3 m~
None
K‘ eflux oflymphoblastic cell
lines. (Top) The intracellular p H buffer capacig was determined as described in Subjects and Methods. Data are mean
values of determinations peformed in triplicate in 17 control
and 13 Alzbeimerj disease (AD) lymphoblastic cell lines; vertical bars are SEM values. (Bottom) The [p]
response was
calculated fiom the intracellular pH response, considering the
[p]
buffer capacity of each cell line, determined as described
in Subjects and Methods. *p = 0.005; **p = 0.01, 1.3 mM
Ca2+ us no Ca2+ ackled (unpaired, one-tailed t test).
Fig 3. Buffer capacity and
was prevented by W-7 (Table 2), and in this condition
the aIgM-induced intracellular acidification was enhanced (Fig 4, top). Thus, regardless of whether the
aIgM-induced elevation of intracellular Ca2+ was impeded by removing extracellular Ca2+ or by inhibiting
calmodulin, in both cases the intracellular acidification
was enhanced.
The protein kinase inhibitor 1-(5-isoquinolinesulfonyl)2-methylpiperazine (H-7; Sigma), more specific for
protein kinase C,38 did not alter the aIgM-induced intracellular acidification or elevation of free cytosolic
[Ca”] (see Table 2), and no significant differences
were appreciated between the response of AD or control lymphoblasts (see Fig 4). Correction of the acidifying responses (see Fig 4, top) by the intracellular H+
buffer capacity revealed a smaller, yet statistically significant, [H+] response in AD than in control cells in-
Mechanisms Involved in the Dzfferential aIgM
Response of Control or AD Lymphoblasts
AD cells have higher pH responsiveness to aIgM than
control cells. This enhanced responsiveness is also observed in control cells when maintained in the absence
of extracellular Ca2+, suggesting that the signaling
pathway activated by aIgM involves the stimulation
of Ca2+ inflow. This Ca2+ inflow will occur most
probably through the activation of receptor-operated
channels and the subsequent activation of a Ca2+dependent process that limits the intensity of the intracellular acidifying response.
The intracellular [Ca2’] response to aIgM of control lymphoblasts is prevented by the inhibition of
Ca2+/calmodulin-dependent kinases induced by the
presence W-7 (see Table 2). In this condition the
aIgM-induced intracellular acidification was enhanced
(see Fig 4, top). Thus, regardless of whether the aIgMinduced elevation of intracellular Ca2+ is impeded by
Table 2. Cytosolic [Ca”]
Response to aIgM of Lymphoblasts
A Cytosolic [Ca2+] (nM)
Additions
aIgM
W-7 -t aIgM
H-7 + aIgM
4.1 2 0.4
0.1 5 0.01
4.0 -C 0.2
The experiment was performed as described in Subjects and Methods. Data are mean values of three experiments performed with control lymphoblasts ? SEM values.
W-7 = N-(6-aminohexyl)-5-chloro- t-naphthdenesulfonamide; H-7 =
1-(5-isoquinolinesulfonyl)-2-methylpiperazine.
Ibarreta et al: Intracellular pH in AD
219
El
aIgM
0
aIgM
+ W-7
activate both signaling pathways in B lymphocyte^,^^^^*
observations that provide the molecular basis for the
altered H' efflux shown in AD cells (see Fig 3 and
Table 1).
It appears plausible to conclude that the distinct intracellular pH responsiveness of AD and control cells is
the result of the combined action of different rates of
H+ efflux and a different buffering capacity in each
type of cell. Thus, the amplitude of the pH changes in
response to a perturbation of the acid-loading or acidextruding mechanisms will always be greater in AD
than in control cells
aIgM +H-7
O
'1
I
* *
C0r;tfol
AD
Fig 4. Effect of N-(G-aminohexyl)-5-chloro-l -naphthalenesulfonamide (W-7)
and 1-(5-isoquinolinesulfonyl)-2methy&iperazine (H-7) on the intracellular p H and fiee ytosolic [H+]response to aIgA4. The experiment was peformed
as described in Subjects and Methods. W-7(25 pM) and
H-7 (50 pA4) were added 5 minutes before aIgM (20 pg/
ml) addition. Data are mean values of results obtained in 8
control and 14 Alzheirner? disease lymphoblastic cell lines.
Vertical bars are SEA4 values. (Top) Change in pH values.
values calculated by taking into
(Bottom) Change in [p]
account the intracellular buffer capacity of each cell line.
9 = 0.03; *"p = 0.0009; **9= 0.04,W-7+ d g M US
aIgM alone (paired, one-tail t test).
removing extracellular Ca2+ or by inhibiting calmodulin, in both cases the intracellular acidification is enhanced. According to these observations, a Ca2+/
calmodulin-dependent process is involved in the
control of the dgM-induced intracellular acidification
and this mechanism appears to be impaired in AD cells.
Because the activity of the N a + / H + exchanger plays
a primary role in controlling intracellular p H in mammalian cells,39 the apparent inability of aIgM-activated
AD lymphoblasts to control the intracellular acidification could be due to either a deficient or a defective N a + / H + exchanger. Under basal conditions, the
N a + l H + antiporter is in a quiescent state and it can be
activated either by a decreased intracellular P H , ~ ' this
is, by an increased H' availability, or by a mechanism(s) dependent on protein kinase C andlor Ca2+/
calmodulin a ~ t i v a t i o n1-46
. ~ aIgM has been reported to
220
Annals of Neurology
Vol 44 N o 2
August 1998
Pathophysiological Sign&ance of the Altered K'
Buffer Capacig a n d Nai/i?
Exchange Activity
The present investigation revealed that AD lymphoblasts exhibit a lower H+-buffering capacity and a decreased rate of H+ removal in response to an acid load
than control cells. T o our knowledge, this is the first
report of an altered H + buffer capacity in any physiological or pathological condition.
Based on these two observations, it appears plausible
to conclude that a situation(s) leading to an acid load
should produce intracellular pH changes of higher amplitude in AD than in control cells. The lower Htbuffering capacity of AD lymphoblasts is accompanied
by a decreased Ca'+-buffering capacity.l o Thus, physiological or pathological challenges could lead to higher
amplitude changes in the free cytosolic concentration
of both Ht and Ca2+ in AD than in control cells.
These conditions are observed in cells undergoing apoptosis, a form of cell death associated with DNA fragmentation. A Ca2+/Mg2+-dependent endonuclease as
well as an endonuclease activated by intracellular acidification have been implicated in this p r o c e ~ s . * ~
O'n~ ~
the other hand, the possible implication of a P-amyloid
peptide-activated apoptotic pathway in the development of AD has been proposed.51 Moreover, transgenic mice overexpressing @-amyloid peptide undergo
neurodegeneration and a p o p t ~ s i s .The
~ ~ results obtained with immortalized lymphocytes may not be extrapolated directly to neurons. However, the possibility
should be considered that the herein reported impairment of H+-buffering capacity and H+ efflux under
acid-loading conditions in AD cells could exert a potentiating or cooperative action on the activation of a
neuronal death program mediated by, as yet, undetermined pathogenic agents.
~~~
Supported by grants from Direccih General de Investigacih Cientifica y TCcnica (PB93-0163 and PB94-1544) and Fondo de Investigaciones Sanitarias (9612014). Dolores Ibarreta was recipient of
a predoctoral fellowship from the Spanish Ministry of Education
and Science (FPV91).
References
1. Katzman R. Alzheimer’s disease. N Engl J Med 1986;314:964973
2. Glenner GG, Wong CW. Alzheimer‘s disease: initial report of
the purification and characterization of a novel cerebrovascular
amyloid protein. Biochem Biophys Res Commun 1984;120:
885-890
3. Yanknet BA, Dawes LR, Fisher S, er al. Neutotoxicity of a fragment of the amyloid precursor associated with Alzheimer’s disease. Science 1989;245:417-420
4. Yanknet BA, Duffy LK, Kirschner DA. Neurotrophic and neurotoxic effects of amyloid beta protein: reversal by tachykinin
neuropeptides. Science 1990;250:279-282
5. LaFerla FM, Tinkle BT, Bieberich CJ, et al. The Alzheimer’s
Ab peptide induces neurodegeneration and apoptotic cell death
in transgenic mice. Nat Genet 1995;9:21-30
6. Martson MP, Cheng B, Davis D, et al. Beta-amyloid peptides
destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J Neurosci 1992;12:376-389
7. Joseph R, Han E. Amyloid beta-protein fragment 25-35 causes
activation of cytoplasmic calcium in neurons. Biochem Biophys
Res Commun 1992;184:1441-1447
8. Hartmann H, Eckert A, Miiller WE. Beta-amyloid protein amplifies calcium signalling in central neurons from the adult
mouse. Biochem Biophys Res Commun 1993;194:1216-1220
9. Eckert A, Hartmann H, Miiller WE. Beta-amyloid protein enhances the mitogen-induced calcium response in circulating human lymphocytes FEBS Lett 1993;330:49-52
10. Ibarreta D, Parrilla R, Ayuso MS. Altered Ca2+ homeostasis in
lymphoblasts from late-onset Alzheimer’s disease patients. Alzheimer Dis Assoc Disord 1997;11:220-227
11. Grosmann A, Kukull WA, Jinneman JC, et al. Intracellular calcium response is reduced in CD4+ lymphocytes in Alzheimer’s
disease and in older persons with Down’s syndrome. Neurobiol
Aging 1993; 14: 177-185
12. Khachaturian ZS. Calcium regulations: final common pathway
for age associated neurodegenerative processes. Neurosci Res
Commun 1993;13:s3-s6
13. Siesjo BK. Cell damage in the brain: a speculative synthesis.
J Cereb Blood Flow Metab 1981;1:155-185
14. Barry MA, Eastman A. Endonuclease activation during
apoptosis: the role of cytosolic Ca2+ and pH. Biochem Biophys
Res Commun 1992;186:782-789
15. Otvos L Jr, Szendrei GI, Lee VM, Mantsch HH. Human and
rodent Alzheimer beta-amyloid peptides acquire distinct conformations in membrane-mimicking solvents. Eur J Biochem
199321 1:249-257
16. De Strooper B, Craessaerts K, Dewachter I, et al. Basolateral
secretion of amyloid precursor protein in Madin-Darby canine
kidney cells is disturbed by alterations of intracellular pH and
by introducing a mutation associated with familial Alzheimer’s
disease. J Biol Chem 1995;270:4058-4065
17. Etcheberrigaray R, Ito E, Kim CS, Alkon DL. Soluble betaamyloid induction of Alzheimer’s phenotype for human fibroblast Kf channels. Science 1994;264:276-279
18. Blass JP. Metabolic alterations common to neural and nonneural cells in Alzheimer’s disease. Hippocampus 1993;3:45-53
19. Scott RB. Extraneuronal manifestations of Alzheimer’s disease.
J Am Geriatr SOC1993;41:268-276
20. Aman P, Ehlin-Henriksson B, Klein G. Epstein-Barr virus susceptibility of normal human B lymphocyte populations. J Exp
Med 1984;159:208-220
21. Tosato G, Blaese RM, Yarchoan R. Relationship benveen immunoglobulin production and immortalization by Epstein Barr
virus. J Immunol 1985;135:959-964
22. Ounanian A, Guilbert B, Seigneurin J-M. Characteristics of
Epstein-Barr virus transformed B cell lines from patients with
Alzheimer’s disease and age-Latched controls. Mech “Ageing
Dev 1992;63:105-116
23. Cambier JC, Ransom JT. Molecular mechanisms of transmembrane signaling in B lymphocytes. Annu Rev Immunol 1987;5:
175- 199
24. Daugirdas JT, Arrieta J, Ye M, et al. Intracellular acidification
associated with changes in free cytosolic calcium. Evidence for
Ca2+/Ht exchange via a plasma membrane Ca2+-ATPase in
vascular smooth muscle cells. J Clin Invest 1995;95:1480-1489
25. McKhann G, Drachman D, Folstein M, et al. Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA
work group under the auspices of Department of Health and
Human Services task force on Alzheimer’s disease. Neurology
1984;34:939-944
26. Folstein MF, Folstein SE, McHugh PR. “Mini-mental state.” A
practical method for grading the cognitive state of patients for
the clinician. J Psychiatr Res 1975;12:189-198
27. Myers RM, Lumelsky N, Lerman LS, Maniatis T. Detection of
single base substitutions in total genomic DNA. Nature 1985;
3 13:495-498
28. Kim TW,Tanzi RE. Presenilins and Alzheimer’s disease. Curr
Opin Neurobiol 1997;7:683-688
29. Wenham PR, Price WH, Blundell G. Apolipoprotein E genotyping by one-stage PCR. Lancet 1991;337:1158-1159
30. Ibarreta D, G6mez-Isla T, Portera-Sinchez A, et al. Apolipoprotein E phenotype in patients of Alzheimer or Parkinson
disease from the Spanish population. J Neurol Sci 1995;134:
146-1 49
3 1. Boyum A. Isolation of mononuclear cells and granulocytes from
human blood. Isolation of mononuclear cells by one centrifugation, and of granulocytes by combining centrifugation and
sedimentation at 1 g. Scan J Clin Lab Invest 1968;21(Suppl
97):77-89
32. Walls EV, Crawford D H . Generation of human B lymphoblastoid cell lines using Epstein-Barr virus. In: Klaus GGB, ed.
Lymphocytes, a practical approach. Oxford: IRL Press, 1987:
149-1 62
33. Thomas ]A, Buuchsbaum F W , Zinniak A, Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing
spectroscopic probes generated in situ. Biochemistry 1979;18:
2210 -22 18
34. Gobel BO, Hoffmann G, Ruppert M, et al. The lymphocyte
Na+/H+ antiport: activation in primary hypertension and during chronic NaC1-loading. Eur J Clin Invest 1994;24:529-539
35. Grienkiewicz G, Poenie M, Tsien RY. A new generation of
Ca2+ indicators with greatly improved fluorescence properties.
J Biol Chem 1985;260:3440-3450
36. Grinstein S, Rotin D, Mason MJ. N a f / H f exchange and
growth factor-induced cytosolic pH changes. Role in cellular
proliferation. Biochim Biophys Acta 1989;988:73-97
37. Hidaka H, Sasaki Y, Tanaka T, et al. N-(6-Aminohexyl) 1-5chloro-1-naphthalenesulfonamide,a calmodulin antagonist, inhibits cell proliferation. Proc Natl Acad Sci 1981;78:43544357
38. Hidaka H , Inagaki M, Kawamoto S, Sasaki Y. Isoquinolinesulfonamides, novel and potent inhibitors of cyclic nucleoride dependent protein kinase and protein kinase C. Biochemistry
1984;23:5036-5041
39. Daugirdas JT, Arrieta J, Ye M, et al. Intracellular acidification
associated with changes in free cytosolic calcium. Evidence for
Ca2+/H+exchange via a plasma membrane Ca*+-ATPase in
vascular smooth muscle cells. J Clin Invest 1995;95:1480-1489
40. Aronson PS, Nee J, Suhm MA. Modifier role of internal H + in
activating the Na+/H+ exchanger in renal microvillus membrane vesicles. Nature 1982;299:161-163
41. Lesburg C, Li S, Cragoe EJ, Deth RC. Influence of arniloride
Ibarreta et al: Intracellular
pH in AD
221
42.
43.
44.
45.
46.
47.
derivatives on alpha-1 adrenergic receptor-induced contractions
of the rabbit aorta. J Pharmacol Exp Ther 1990;253:530-536
Grinstein S, Rothstein A. Mechanisms of regulation of the
Na+/H+ exchanger. J Membr Biol 1986;90:1-12
Moolenaar WH, Tertoolen LG, de Laat SW. Phorbol esrer and
diacylglycerol mimic growth factors in raising cytoplasmic pH.
Nature 1984;312:371-374
Ober SS, Pardee AB. Both protein kinase C and calcium mediate activation of the Na+/H+ antiporter in Chinese hamster
embryo fibroblasts. J Cell Physiol 1987;132:311-317
Bertrand B, Wakabayashi S, Ikeda T, et al. The Na+/H+ exchanger isoform 1 (NHE1) is a novel member of the
calmodulin-binding proteins. Identification and characterization
of calmodulin-binding sites. J Biol Chem 1994;269: 1370313709
Wakabayashi S, Bertrand B, Ikeda T, et al. Mutation of
calmodulin-binding site renders the Na+/H+ exchanger
(NHE1) highly H( +)-sensitive and Ca2’ regulation-defective.
J Biol Chem 1994;269:13710-13715
Mosialos G, Hanissian SH, Jawahar S, et al. A CaZ+/
calmodulin-dependent protein kinase, CaM kinase-Gr, ex-
222
Annals of Neurology
Vol 44 No 2
August 1998
48.
49.
50.
51.
52.
pressed after transformation of primary human B lymphocytes
by Epstein-Barr virus (EBV) is induced by the EBV oncogene
LMP1. J Virol 1994;68:1697-1705
Page DM, Gold M, Fahey KA, et al. Mutational analysis of
antigen receptor regulation of B lymphocyte growth evidence
for involvement of the phosphoinositide signaling pathway.
J Biol Chem 1991;266:5563-5574
Barry MA, Eastman A. Endonuclease activation during
apoptosis: the role of cytosolic Ca2+ and pH. Biochem Biophys
Res Commun 1992;186:782-789
Li J, Eastman A. Apoptosis in an interleukin-2-dependent cyrotoxic T lymphocyte cell line is associated with intracellular
acidification. Role of the N a + / H C antiport. J Biol Chem 1995;
270:3203-3211
Cotman CW, Anderson AJ. A potential role for apoptosis in
neurodegeneration and Alzheimer’s disease. Mol Neurobiol
1995;10:19-45
LaFerla FM, Tonkle BT, Bieberich CJ, et al. The Alzheimer’s
AP peptide induces neurodegeneration and apoptotic cell death
in transgenic mice. Nat Genet 1995;9:21-30
Документ
Категория
Без категории
Просмотров
1
Размер файла
930 Кб
Теги
features, patients, distinct, lymphoblastic, disease, homeostatic, alzheimers
1/--страниц
Пожаловаться на содержимое документа