close

Вход

Забыли?

вход по аккаунту

?

DMD pseudoexon mutations splicing efficiency phenotype and potential therapy.

код для вставкиСкачать
DMD Pseudoexon Mutations: Splicing
Efficiency, Phenotype, and Potential Therapy
Olga L. Gurvich, PhD,1 Therese M. Tuohy, PhD,1 Michael T. Howard, PhD,1 Richard S. Finkel, MD,2
Livija Medne, MS, CGC,2 Christine B. Anderson, BS,1 Robert B. Weiss, PhD,1 Steve D. Wilton, PhD,3
and Kevin M. Flanigan, MD1,4 – 6
Objective: The degenerative muscle diseases Duchenne (DMD) and Becker muscular dystrophy result from mutations in the
DMD gene, which encodes the dystrophin protein. Recent improvements in mutational analysis techniques have resulted in the
increasing identification of deep intronic point mutations, which alter splicing such that intronic sequences are included in the
messenger RNA as “pseudoexons.” We sought to test the hypothesis that the clinical phenotype correlates with splicing efficiency
of these mutations, and to test the feasibility of antisense oligonucleotide (AON)–mediated pseudoexon skipping.
Methods: We identified three pseudoexon insertion mutations in dystrophinopathy patients, two of whom had tissue available
for further analysis. For these two out-of-frame pseudoexon mutations (one associated with Becker muscular dystrophy and one
with DMD), mutation-induced splicing was tested by quantitative reverse transcription polymerase chain reaction; pseudoexon
skipping was tested using AONs composed of 2⬘-O-methyl–modified bases on a phosphorothioate backbone to treat cultured
primary myoblasts.
Results: Variable amounts of pseudoexon inclusion correlates with the severity of the dystrophinopathy phenotype in these two
patients. AON treatment directed at the pseudoexon results in the expression of full-length dystrophin in a DMD myoblast line.
Interpretation: Both DMD and Becker muscular dystrophy can result from out-of-frame pseudoexons, with the difference in
phenotype being due to variable efficiency of the newly generated splicing signal. AON-mediated pseudoexon skipping therapy
is a viable approach to these patients and would be predicted to result in increased expression of wild-type dystrophin protein.
Ann Neurol 2008;63:81– 89
Mutations in the DMD gene cause the dystrophinopathies, a collective term for Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and
the relatively rare X-linked dilated cardiomyopathy. In
approximately 90% of cases, the more severe DMD is
associated with mutations that interrupt the messenger
RNA (mRNA) open reading frame, either by frameshifting deletions or insertions, or by premature stop
codon mutations. In contrast, the less severe BMD is
typically associated with mutations resulting in an internally altered but partially functional dystrophin protein, with an intact C-terminal domain.1 This principle
forms the basis of a promising line of molecular therapy, now reaching clinical trials. Antisense oligonucleotide (AON)–mediated exon skipping therapy targets
motifs at intron-exon junctions or within exonic splice
enhancers (ESEs) of the pre-mRNA, resulting in the
exclusion of the targeted exon or exons and restoration
of an open reading frame (reviewed elsewhere2).
Mutation analysis of DMD was originally problematic due to the large size of the gene (2.4 million bases,
with 79 exons and 8 promoters). For many years, mutation analysis was limited to methods that detect deletions or duplications of one or more exons. The most
widely used was the multiplex polymerase chain reaction (PCR) method for deletion detection, which sampled a subset of commonly deleted exons.3 Only with
the recent implementation of high-throughput screening4 or direct sequencing methodologies5 has rapid diagnosis of point mutations within the gene become feasible on a routine basis. Similarly, improvements in
methods of dosage analysis have allowed the rapid
identification of deletions and duplications of all exons
across the entire gene.6,7 Combining these modern
methods of molecular analysis results in detection of
about 93 to 96% of mutations via genomic DNA derived from blood samples.8,9
The availability of detailed genomic mutation anal-
From the 1Department of Human Genetics, University of Utah
School of Medicine, Salt Lake City, UT; 2Department of Neurology, Children’s Hospital of Philadelphia, Philadelphia, PA; 3Centre
for Neuromuscular and Neurological Disorders, University of Western Australia, Perth, Australia; and Departments of 4Neurology,
5
Pathology, and 6Pediatrics, University of Utah School of Medicine,
Salt Lake City, UT.
This article includes supplementary materials available via the Internet at http://www.interscience.wiley.com/jpages/0364-5134/suppmat
Received Jun 18, 2007, and in revised form Sep 25. Accepted for
publication Sep 28, 2007.
Published online Dec 4, 2007, in Wiley InterScience
(www.interscience.wiley.com). DOI: 10.1002/ana.21290
Address correspondence to Dr Flanigan, Eccles Institute of Human
Genetics, Room 4420, 15 N. 2030 East, Salt Lake City, UT 84112.
E-mail: kevin.flanigan@genetics.utah.edu
© 2007 American Neurological Association
Published by Wiley-Liss, Inc., through Wiley Subscription Services
81
ysis has resulted in the increasingly frequent identification of individuals with DMD but no coding region
mutations in the DMD gene, and thus to the increasing recognition of a previously difficult to identify category of DMD mutations: intronic point mutations
that create novel splice sites, resulting in the inclusion
of intronic sequence as a “pseudoexon” within the
mRNA.10 –12 The large size of the DMD introns still
precludes direct intronic sequencing as a practical assay. Consequently, the presence of pseudoexons must
be determined from analysis of mRNA, generally obtained from muscle biopsies.
Here, we report three such intronic point mutations
resulting in pseudoexon insertion. One patient has an
in-frame pseudoexon insertion containing several inframe stop codons; his phenotype is consistent with
DMD responsive to steroid treatment. The two other
patients have mutations causing the inclusion of outof-frame pseudoexons, but they have different phenotypes: one patient has relatively mild BMD, whereas
the other has DMD. Using quantitative reverse transcription polymerase chain reaction (qRT-PCR), we
demonstrate the molecular basis of the phenotypic discrepancy between these two patients. Lastly, in primary
myoblast cultures from these two out-of-frame patients, we demonstrate AON-induced pseudoexon
skipping, resulting in the restoration of a full-length,
in-frame DMD transcript. As a therapy, pseudoexon
skipping is predicted to be most beneficial to patients
with this class of mutations, as the resultant rescued
dystrophin should be wild type. In contrast, applying
targeted exon skipping to the more common frameshifting rearrangements or nonsense mutations generates a BMD-like protein, which will be of variable
functional activity depending on the extent and nature
of the primary gene lesion.
Subjects and Methods
Patient Ascertainment
Patients were ascertained from among those enrolled in the
United Dystrophinopathy Project, an ongoing natural history and genotype-phenotype database consortium. All three
patients were diagnosed with dystrophinopathy utilizing criteria for enrollment in the United Dystrophinopathy Project,
having clinical features consistent with a dystrophinopathy
and any of the following characteristics: (1) an X-linked family history; (2) altered or absent dystrophin expression with
immunohistochemical, immunofluorescent, or immunoblot
analysis of muscle biopsy; or (3) clinical testing that demonstrated a mutation in the DMD gene.
Genetic Analysis
Under an institutional review board–approved protocol, and
following parental and/or patient consent, genomic blood
samples were obtained for DNA extraction and mutation
analysis. A sufficient quantity of archived muscle tissue was
available from all three patients to perform diagnostic
82
Annals of Neurology
Vol 63
No 1
January 2008
mRNA extraction and RT-PCR–based sequencing. Total
RNA was extracted using Trizol (Invitrogen, La Jolla, CA)
according to the manufacturer’s recommended protocol, and
complementary DNA (cDNA) was synthesized using random hexamers and SuperScript III reverse transcriptase (Invitrogen). PCR amplification was conducted using published
primer sets13 and using Expand High Fidelity Taq polymerase (Roche, Indianapolis, IN). Amplicons were sequenced using an internal set of sequencing primers and were electrophoresed on an ABI 3700 DNA analyzer (Applied
Biosystems, Foster City, CA) prepared with POP-5 capillary
gel matrix. The entire DMD cDNA was sequenced in each
patient. Sequence files were analyzed using Consed14,15 or
Sequencher (Gene Codes, Ann Arbor, MI) and compared
against the wild-type dystrophin cDNA sequence (GenBank
NM_004006.1). If the sequencing trace for a given fragment
appeared to contain multiple sequences, the PCR product for
that amplicon was TA cloned (Invitrogen), and individual
clones were sequenced and analyzed, allowing resolution of
all mutations.
For each pseudoexon detected, the sequence was run
through BLAST to identify the corresponding intronic fragment. Primers complementary to flanking intronic sequence
were designed for both PCR amplification and sequencing.
Quantitative Real-time Polymerase Chain Reaction
Real-time quantitative PCR of DMD wild-type and mutant
transcripts was performed in a RotorGene capillary thermocycler (Corbett Research, Mortlake, NSW, Australia), and
data analyzed using the RotorGene software package. For
each case, we designed forward amplification primers that
spanned either the wild-type exon junctions (exons 11/12 or
exons 45/46) or the mutant splice junctions (exon 11/
pseudoexon 11A and pseudoexon 45A/exon 46) (Fig 1). The
reverse primer was placed within exonic sequence in the distal exon (either exon 12 or 46).
Total muscle RNA was obtained from archived clinical
muscle biopsy specimens that had been snap-frozen in isopentane cooled in liquid nitrogen. cDNA synthesis from total muscle RNA was performed using random hexamer primers.
For each patient sample, wild-type DMD, pseudoexoncontaining DMD, and a control housekeeping gene (eukaryotic translation elongation factor 1, ␣-1 [EEF1A1]) were amplified in quadruplicate PCRs. In addition, within the same
thermocycler run, the same amplifications were performed
using normal control muscle template. Within each patient
sample, the amount of DMD message (wild type or pseudoexon) was normalized against EEF1A1; the resulting ratio
was compared with the ratio found in normal control muscle
tissue, which was normalized to a value of 1.
Splice-Site Strength Scoring Methods
The strength of the pseudoexon splice sites was analyzed using the following methods: (1) a neural network approach,
which uses machine-learning algorithms for recognition of
mammalian splice-site sequence patterns16,17 (http://www.
fruitfly.org/seq_tools/splice.html); (2) first-order Markov
model, which takes into account only dependencies between
adjacent positions within the splice-site sequence, and the
Fig 1. Graphic representation of the pseudoexon mutations.
(A) Patient 42273 (Becker muscular dystrophy [BMD]). (B)
Patient 43012 (Duchenne muscular dystrophy [DMD]). (C)
Patient DC0160 (DMD). Dystrophin exons are represented as
black boxes; pseudoexons are represented as gray boxes. Arrows indicate positions of the mutations relative to the pseudoexons. The positions of the antisense oligonucleotides (AONs)
used for exon-skipping studies are indicated as A11 and D11
(A) and as 45 and 45D (B).
Maximum Entropy Model, which takes into account dependencies between adjacent and nonadjacent positions18
(http://genes.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.
html); and (3) the Shapiro and Senapathy position-weight
matrix, which reflects the degree of conservation at each position of the consensus 5⬘ and 3⬘ splice motifs.19,20 For each
method, a higher score indicates a greater probability of the
corresponding sequence being used as a splice site, but does
not represent absolute predictive values. Upper limits are defined only for the Shapiro and Senapathy (upper limit ⫽
100) and neural network (upper limit ⫽ 1) predictive methods.
Pseudoexon Skipping
Two of the patients (43012 and 42273) agreed to undergo
muscle biopsy to establish myoblast cell lines. Under an institutional review board–approved protocol, and after parental and/or patient consent was obtained, a needle biopsy of
the quadriceps muscle was performed. Tissue was macerated,
enzymatically digested, and plated in SKGM (Clonetics, San
Diego, CA). Primary outgrowth was subcultured at 70%
confluence.
For pseudoexon skipping studies, myoblasts were cultured
in SKGM2 complete medium for skeletal muscle cells (Cam-
brex, East Rutherford, NJ) on poly-D-lysine/laminin–coated
plates (VWR International, West Chester, PA). When cells
were confluent, the media were switched to differentiating
media (Dulbecco’s minimum essential medium supplemented with glutamine, 2% fetal bovine serum, 1% glucose,
1X penicillin/streptomycin) to induce myogenesis. Myotubes
were transfected with AONs 7 to 10 days after switching to
differentiation media using ExGen500 (Fermentas, Glen
Burnie, MD), according to manufacturer’s protocol for 4
hours. For RNA studies, myotubes were harvested using
Trizol (Invitrogen) at the indicated time points. RT-PCR
was conducted using SuperScriptIII RT-PCR system (Invitrogen) with amplification primers in exons 11 and 12 for
Patient 42273 and exons 45 and 46 for Patient 43012 for
35 cycles of amplification. A second round of PCR (35
cycles of amplification) was performed with the nested
primers in the same exons using AccuPrime Taq (Invitrogen). Primer sequences are included in the Supplemental
Table, and conditions are available on request. For protein
studies, cells were further differentiated for 5 days after
transfection and lysed in Radioimmuno Precipitation Assay
(RIPA) buffer (150mM NaCl, 10mM tris[hydroxymethyl]aminomethane pH7.2, 0.1% sodium dodecyl sulfate,
1% Triton X-100 [Sigma, St Louis, MO], 1% deoxycholate, 5mM EDTA, complete protease inhibitors [Roche,
Indianapolis, IN]). Lysates were loaded directly on 3 to
8% tris[hydroxymethyl]aminomethane-acetate polyacrylamide
gels (Invitrogen). Expression of full-length dystrophin was
analyzed by Western blotting using Mandra I (Sigma) antibody to the C-terminal part of dystrophin protein. A commercial skeletal muscle cell line (Cambrex, East Rutherford,
NJ) was used as a wild-type control.
Antisense Oligonucleotide Synthesis
The AONs were prepared on an Expedite 8909 Nucleic Acid
Synthesizer using the 1␮mol thioate synthesis protocol with
2⬘-O-methyl cyanoethyl phosphoramidites and support columns supplied by Glen Research (Sterling, VA). The AONs
were deprotected and cleaved from the support column using
NH4OH and desalted in NAP-10 columns under sterile conditions. All bases carried a 2⬘-O-methyl ribose modification
on a phosphorothioate backbone. The nucleotide sequences
of the AONs are shown: 5⬘-3⬘ A11-ggg aca gag guu gca gug
agc uga gau; D11-cuc acg agg cug agg cag gag aau; 45-uug
uca gca auc cau ugc uug aag gc; and 45D-uac cac ugc cuu
gcu ucc guc ucc ca.
Results
All three probands had clinical features consistent with
a dystrophinopathy. Patient 42273 is currently 23
years old and remains tenuously ambulant. He first
noted symptoms of calf hypertrophy and leg weakness
at age 9 years, followed by the development of pelvic
girdle weakness. He has an X-linked family history of
similar symptoms, with ambulation into young adulthood, consistent with a clinical diagnosis of BMD.
Patient DC0160 is currently 15 years old and remains ambulant at home and in the classroom, although he uses a power scooter otherwise. He was seen
Gurvich et al: DMD Pseudoexon Mutations
83
Fig 2. Analysis of dystrophin expression in patient muscle samples. (A) Immunofluorescence analysis of Patients 42273 and
43012 with Mandra I antibody. (B) Western blot analysis of
Patients 42273 and 43012. Molecular weight marker is
MagicMark XP (Invitrogen). GAPDH antibody (AbCam,
Cambridge, MA) is present as a loading control. WT ⫽ wild
type.
by a neurologist at age 5 for an unusual gait, without a
diagnosis being made. At age 8, he was having difficulty climbing stairs. Serum creatine kinase concentration was reportedly greater than 20,000 IU/L, and a
muscle biopsy was performed that was reported to
demonstrate absence of dystrophin staining. Based on
this biopsy, he was diagnosed with DMD and has been
treated with daily prednisone since age 9.
Patient 43012, currently 11 years old and ambulant,
presented at age 20 months with delayed ambulation
and slow motor and language skills. At age 5, he was
diagnosed with DMD based on calf hypertrophy, proximal weakness, increased creatine kinase concentration,
and positive X-linked history consistent with DMD.
Muscle biopsy showed absent staining for dystrophin,
although some revertant fibers were seen. He has a
9-year-old brother who is similarly affected and has
had the same intronic point mutation confirmed from
a genomic blood sample. However, the brother has
never undergone a muscle biopsy.
Muscle biopsies from the DMD Patient 43012 demonstrated absent staining for dystrophin using antibodies directed to the C-terminal, N-terminal, and rod domain of the dystrophin protein (Fig 2A and data not
shown). Consistent with this, immunoblot demonstrated absent dystrophin (see Fig 2B). In contrast, im-
84
Annals of Neurology
Vol 63
No 1
January 2008
munofluorescent analysis of muscle from the BMD patient (Patient 42273) demonstrated a diffuse reduction
of staining at the muscle membrane with all three antibodies (see Fig 2A; also, additional data not shown),
indicating the presence of full-length dystrophin protein. This is corroborated by the results of his sample’s
immunoblot analysis, which shows the presence of low
amounts of an apparently full-length protein of
427kDa (see Fig 2B). Patient DC0160, with clinical
features suggesting BMD but consistent with steroidresponsive DMD, was reported to have absent staining
for dystrophin by immunohistochemistry, according to
his clinical report. A tiny remnant fragment was used
for generation of mRNA for cDNA sequencing (as discussed later); however, insufficient archived clinical tissue was available for immunofluorescent and immunoblot analysis for this patient, and he refused a research
muscle biopsy.
For each patient, analysis of genomic DNA using
both the single condition amplification/internal primer
(SCAIP) sequencing5 and either MLPA or MAPH
methods6,7 was negative for mutations affecting any of
the 79 exons of the DMD gene. cDNA sequencing
from muscle biopsy–derived mRNA resulted in the
identification of out-of-frame pseudoexon insertions in
all three patients (see Fig 1). The details of each mutation (including the position of each intronic fragment relative to the flanking exons) are listed in Table
1. In each case, sequencing of the appropriate intron
showed point mutations creating novel splice sites.
To evaluate the relative efficiency of the splice sites
created by the intronic point mutations, we undertook
qRT-PCR analysis of the relative levels of each
pseudoexon-containing transcript compared with wildtype DMD mRNA. Biopsies from one BMD (42273)
and one DMD (43012) patient yielded sufficient RNA
for this analysis. qRT-PCR values for the respective
pseudoexon inclusion (11A or 45A) and wild-type dystrophin transcripts were normalized against EEF1A1 as
a housekeeping standard. The wild-type DMD:
EEF1A1 ratio was normalized to a value of 1.0 in a
wild-type sample run at the same time. The results of
qRT-PCR are shown in Figure 3. Both the intron 11
BMD-associated mutation and the intron 45 DMDassociated mutation result in pseudoexon-containing
DMD message, present at levels of approximately 40%
of the amount of wild-type DMD transcript found in
normal control muscle. However, in the muscle from
the BMD patient, a significant level of wild-type transcript is also present (approximately 13% of that found
in control muscle), whereas in DMD muscle, no wildtype transcript is seen.
To investigate the feasibility of pseudoexon skipping
induced by AONs directed to the intronic sequence,
we established primary muscle cultures from needle biopsies of the BMD (42273) and DMD (43012) pa-
Table 1. Pseudoexon Insertion Mutations in Three Dystrophinopathy Patients
Patient
No.
Diagnosis
42273
BMD
43012
DMD
DC0160
DMD
Pseudoexon
Derivation/
Size
Intron 11;
79 nt
Intron 45;
137 nt
Intron 47;
72 nt
Mutation
DNA
RNA
c.1331⫹17770C⬎G r.[1331_1332ins1331⫹17691
_1331⫹17769]
c.6614⫹3310G⬎T r.[6614_6615ins6614⫹3172_6614
⫹3308]
c.6913⫺4037T⬎G r.[6912_6913ins6913⫺4036_6913
⫺396]
Protein
p.Asn444LysfsX2
p.Leu2006ArgfsX45
p.Ser2306LysfsX7
BMD ⫽ Becker muscular dystrophy; DMD ⫽ Duchenne muscular dystrophy.
tients. Two AONs were designed for each of the
pseudoexons: one was directed to a cluster of ESEs
within the pseudoexons, as predicted using ESEFinder2 (http://rulai.cshl.edu/tools/ESE2),21 and the
other was directed to the donor or 5⬘ splice-site junction created by the point mutation itself (see Fig 1).
First, patient myotubes were treated with increasing
amounts (from 10 –300nM) of AONs directed at what
was considered the major cluster of ESEs, the cryptic
5⬘ splice site, or both in combination. In the BMD
myoblasts containing the intron 11 pseudoexon (11A),
when used individually, the AON directed at the ESE
(A11) partially corrected splicing only at the greatest
concentration (300nM), and the AON directed to the
pseudoexon-intron junction partially corrected splicing
at a lower concentration (100nM) (Fig 4A). In contrast, in the DMD myoblasts containing the intron 45
pseudoexon (45A), AON treatment increased levels of
normal splicing even at the lowest concentration
(10nM), with a dose-dependent response at 30 and
100nM (although there was no obvious further increase of normal splicing at 300nM) (see Fig 4B). For
either pseudoexon mutation, a combination of both
AONs (each one at the concentration stated in Fig 4)
Fig 3. Quantitative reverse transcription polymerase chain
reaction (RT-PCR) analysis of pseudoexon and wild-type transcripts. BMD ⫽ Becker muscular dystrophy; DMD ⫽ Duchenne muscular dystrophy; mRNA ⫽ messenger RNA.
worked better than a single AON separately at the
same concentration. However, a greater concentration
of each single AON could apparently induce the same
level of correct splicing as could a lower concentration
of the primers used in combination.
Next, time-course experiments were undertaken to
determine the persistence of splicing correction. Cultures were treated with AONs for 4 hours at the optimal concentration for each AON as determined in the
first experiment. On day 7 after serum withdrawal (to
induce myoblast differentiation), myoblasts were
treated with AONs at the concentrations shown in Figure 5. RNA was extracted at 0, 1, 2, 3, and 5 days after
transfection. For both of the mutations, using either of
the AONs resulted in a detectable increase of correctly
spliced mRNA on the day of transfection. Corrected
splicing reached an apparent maximum on day 1 and
persisted at apparently the same level until day 5 (see
Fig 5). A longer time course was not tested because
each patient’s primary myotube cultures started to die
after 12 days of differentiation (5 days after transfection), regardless of transfection status.
The expression of dystrophin protein was assessed
only in the myotubes from Patient 43012. This DMD
patient has no convincing dystrophin expression by immunofluorescent analysis of muscle sections. However,
correlating with the RNA studies showing increased
wild-type mRNA, a significant amount of dystrophin
was present in cultured myotubes at 5 days after treatment, as detected by immunoblot analysis, which
shows expression of apparently full-length dystrophin
(Fig 6).
Discussion
The application of the most current molecular diagnostic techniques to the dystrophinopathies allows the
identification of the majority of DMD mutations via
blood sample analysis alone. However, the usage of
these techniques has also led to the increasing recognition of a novel class of mutations, consisting of deep
intronic mutations resulting in pseudoexon inclusion,
as causative of DMD and BMD. Here, we discuss in-
Gurvich et al: DMD Pseudoexon Mutations
85
Fig 4. Reverse transcription polymerase chain reaction (RT-PCR) analysis of titration of antisense oligonucleotide (AON) treatment.
(A) Myotube cultures from Patient 42273 (BMD) were treated with two AONs to pseudoexon 11a: A11 and D11 in combination
and separately at 10, 30, 100, and 300nM. (B) Myotube cultures from Patient 43012 (DMD) were treated with two AONs to
pseudoexon 45a (AONs 45 and 45D). These were used either separately at 10, 30, 100, and 300nM or in combination (eg,
300nM of each, dosed simultaneously). RNA was harvested 24 hours after transfection. WT ⫽ wild type.
tronic point mutations resulting in the creation of
novel splice sites (although both intronic deletions and
classical exonic deletions could also result in the cre-
ation of novel splice sites, with pseudoexon incorporation into mRNA). At a practical level, this class is not
currently readily detectable from genomic DNA be-
Fig 5. Reverse transcription polymerase chain reaction analysis of time course of induction of pseudoexon skipping. (A) Myotube cultures from Patient 42273 (Becker muscular dystrophy [BMD]) were treated with 300nM of either antisense oligonucleotide (AON)
A11 or D11 and assayed 0, 1, 2, 3, and 5 days later. (B) Myotube cultures from Patient 43012 (BMD) were treated with
100nM of either AON 45 or 45D and assayed 0, 1, 2, 3, and 5 days later. WT ⫽ wild type.
86
Annals of Neurology
Vol 63
No 1
January 2008
Fig 6. Expression of full-length dystrophin after antisense oligonucleotide (AON) 45 treatment of 43012 (Duchenne muscular dystrophy) myotubes. GAPDH was used as a control for
protein loading. WT ⫽ wild type.
cause of both the cost and effort required for direct
sequence analysis of the large introns in the DMD gene
and the need to establish definitively the RNA splicing
implications of putative splice-affecting mutations.
mRNA can be obtained from lymphocytes for performance of the protein truncation test22; however, because no significant dystrophin expression is thought to
occur in lymphocytes, abnormal results risk reflecting
nonpathogenic splice variation occurring in the setting
of nonphysiological transcription. Similarly, diagnosis
of splice variation can be made from primary fibroblast
cultures induced to differentiate into the myogenic
pathway via MyoD transfection,23 although this is
more time and labor intensive than analysis of musclederived mRNA. For these reasons, a role remains for
muscle biopsy in the diagnosis of pseudoexon mutations. The exact prevalence of these mutations is unknown, but they may account for many of the 4 to 7%
of mutations not detected by genomic mutation analysis methods.8,9
All three patients we describe carry mutations that
result in aberrant mRNA that would be predicted by
the reading-frame rule1 alone to cause DMD. Patient
DC0160 has an in-frame pseudoexon in which a premature stop signal is encoded. He is an informative
case regarding the difficulty presented to the clinician
in offering prognosis in the dystrophinopathies, particularly in the absence of a family history to guide prognostication. Based on serum creatine kinase levels, and
the absent dystrophin staining on a clinical biopsy, he
was given a clinical diagnosis of DMD. However, he
remains relatively strong and ambulant at 15 years old;
this pattern may be suggestive of BMD, but the consensus is that he has been responsive to steroid therapy.
(Notably, he has no family history from which the
phenotype in nonsteroid-treated relatives can be determined.) Although insufficient tissue was available from
the clinical biopsy for qRT-PCR studies, mRNA sequencing showed no evidence of significant amounts of
a second mRNA species, such as may be seen with stop
codon–encoding point mutations that induce exon
skipping via alteration of ESE elements.24 This raises
the possibility that the premature stop codon signal
may be subject to ribosomal readthrough, which is sequence context dependent.25 However, readthrough
does not appear to correlate well with phenotype in
DMD patients,26 and in only a single case has
readthrough been implicated in ameliorating a disease
phenotype.27
In the other two patients, with out-of-frame pseudoexons, we hypothesized that the difference in disease
severity between BMD and DMD would be explained
by a differential efficiency in the function of the
mutation-induced splice site, and hence a differential
amount of pseudoexon inclusion. qRT-PCR analysis of
the ratio of wild-type and mutant DMD splice products confirmed that the intronic splice mutations are,
in fact, disease-causing.
As expected, in the DMD Patient 43012, no dystrophin mRNA corresponding to the normal transcript
(splicing exon 45 to exon 46 was detected). The lack of
normally spliced dystrophin mRNA predicts the absence of dystrophin protein and correlates with the
DMD phenotype observed for this patient. The altered
splice product 45A-46 containing the 139 nt cryptic
exon was found at 40% the level of correctly spliced
dystrophin mRNA in unaffected skeletal muscle, indicating at least partial resistance to NMD and the potential expression of a severely C-terminally truncated
protein (although none was seen on immunoblot of biopsy tissue, suggesting that such a product may be subject to rapid degradation). In contrast, in the patient
with BMD, inefficient splicing at the intronic cryptic
splice site results in the presence of wild-type exon
11/12 splicing at 13% of the levels found in unaffected
control skeletal muscle. This residual amount of normally spliced dystrophin mRNA produces detectable
amounts of apparently full-length dystrophin. Even
this low level of expression is apparently sufficient to
maintain partial dystrophin function, as evidenced by
dystrophin membrane localization and amelioration of
the dystrophinopathy phenotype. The results demonstrate that our hypothesis was correct: dystrophin expression and a less severe BMD phenotype are due to
residual levels of wild-type dystrophin transcript produced by normal splicing and to relatively inefficient
altered splicing to include the pseudoexon.
The difference in splicing efficiency between these
Gurvich et al: DMD Pseudoexon Mutations
87
two patients is likely to be attributable to the strength
of the donor splice sites created by the point mutations. Alternatively, the primary determinant could be
the strength of the cryptic acceptor splice sites that are
present in the wild-type sequence and activated by the
point mutations. In addition, genetic backgrounds may
also play a substantial role, as suggested by the description of a family with variable severity arising from a
nonsense mutation in exon 29 that compromised recognition, and hence inclusion of that exon in the mature dystrophin mRNA.28 Our data favor the primary
importance of the mutation-created splice site. The
consensus sequence for 5⬘ splice donor sites (Table 2)
corresponds to perfect Watson–Crick base pairing of
the U1 small nuclear RNA 5⬘ terminus29; this base
pairing plays a critical role in 5⬘ splice-site selection
and spliceosome assembly. In Patients 42273 and
43012, the intronic point mutations create 5⬘ donor
splice sites. Notably, the 5⬘ splice donor created by the
mutation in Patient 43012 displays better complementarity to the U1 small nuclear RNA consensus sequence than does the 5⬘ splice donor created by the
mutation in Patient 42273; this may explain the higher
level of abnormal splicing found in Patient 43012
compared with Patient 42273. The strength of the
43012 splice donor site is also predicted to be greater
by several independent algorithms (see Table 2).
In contrast, and arguing against the importance of
the cryptic acceptor site, all algorithms predict the 3⬘
acceptor site in the DMD patient (43012) to be the
weakest of the three in our set. Potentially, the stronger
5⬘ splice site can activate splicing of the downstream
intron more efficiently.30,31 In addition, a complex interplay of other factors, such as branch point position
and strength, ESE and silencer positions, and intron
lengths,30,32 may play a role in the more efficient splicing of the pseudoexon in Patient 43012.
Significant rescue of the DMD phenotype by low
levels of wild-type splicing suggests that this class of
mutations may benefit from exon-skipping therapies
directed toward the pseudoexon splice junctions. When
tested in cultured cells, splicing correction was observed for both the BMD and DMD samples whether
treated with AON to the corresponding ESE or to the
5⬘ splice donor site. Interestingly, treatment with both
AONs to the pseudoexon 45A sequence corrected
splicing more efficiently than with the ones to the
pseudoexon 11A. Theoretically, one might predict the
pseudoexon 11A to be more responsive to the AON
treatment because it inherently has weaker splicing capabilities as shown by RT-PCR. Observation of the reverse effect suggests that both AONs directed toward
the pseudoexon 45Aa were better at inhibiting splicing
than those selected for exon 11A.
Pseudoexon skipping may, in fact, be less problematic than “constitutive” exon skipping, in which the patient’s mutated transcript is further altered by deletion
of one or more exons to restore an open reading frame.
In both exon and pseudoexon skipping, one of the theoretical problems is that the new exon junctions may
result in novel epitopes, which may be immunogenic.
However, low levels of exon skipping are common in
DMD patients33 (and in the mdx mouse34) where they
result in revertant fibers, which express dystrophin proteins with a restored open reading frame. Although we
detected no measurable levels of the wild-type mRNA
in our DMD patient sample, even exceedingly low levels of wild-type transcript may result in epitope tolerization to the wild-type protein. More importantly,
pseudoexon skipping resulting in wild-type protein can
reasonably be expected to have a more significant benefit than exon skipping resulting in a BMD-like internally deleted protein.
Development of pseudoexon-skipping therapies represents a type of personalized medicine, directed at individual patients with private mutations. In contrast,
exon-skipping therapies have entered trials for regions
of the gene likely to benefit a large number of patients.35 Nevertheless, our results suggest that pseudoexon mutations may be highly amenable to such ther-
Table 2. Pseudoexon 5ⴕ and 3ⴕ Splice Sites and Predicted Scores
Patient
No.
5ⴕ Splice-Site (Donor) Sequence and
Scores
Sequence
42273
43012
DC0160
Consensus
S&S NN
ME
MM
3ⴕ Splice-Site (Acceptor) Sequence and Scores
Sequence
S&S NN ME MM
CTC兩GTGAGT 76.8 0.79 8.41 7.42 AGTTTTGTTCTTTCACCCAG兩GCT 95 0.93 6.89 7.89
GTG兩GTAAGT 89.5 0.99 10.36 9.19 TTTCTTCTGGAGTATTCTAG兩GAG 70.9 0.43 3.06 1.88
TCA兩GTAAGT 78.0 0.45 9.14 7.13 AATTATGGTAATCCCCACAG兩GTC 85.8 0.87 8.03 8.45
MAG兩GTRAGT
(Y)nNYAG兩G
100% conserved nucleotides at the splice junctions are underlined. Nucleotides introduced by mutations are in boldface. Splice-site
strength scores (described in Subjects and Methods) are obtained using Shapiro and Senapathy (S&S) consensus splice-site weight
matrix, neural network prediction (NN), first-order Markov models (MM), and Maximum Entropy Model (ME). The higher score
indicates greater probability of corresponding sequence being used as a splice site. Consensus splice-site sequences are as Zhang30
defined.
88
Annals of Neurology
Vol 63
No 1
January 2008
apies and point out the continued utility of muscle
biopsy in the diagnosis of this novel class of mutations.
This work was supported by the NIH (National Institute of Neurologic Diseases and Stroke, R01 NS043264, K.M.F., M.T.H.,
R.B.W.; T32 NS07493, O.G.), the National Center for Research
Resources (M01-RR00064), and the Association Francaise Contre
les Myopathies (K.M.F.).
We acknowledge the study coordinator assistance of K. Hart, the
technical assistance of L. Zhao, and the University of Utah Core
Imaging Facility (C. Rodesch).
References
1. Monaco AP, Bertelson CJ, Liechti Gallati S, et al. An explanation for the phenotypic differences between patients bearing
partial deletions of the DMD locus. Genomics 1988;2:90 –95.
2. Wilton SD, Fletcher S. RNA splicing manipulation: strategies
to modify gene expression for a variety of therapeutic outcomes.
Curr Gene Ther 2005;5:467– 483.
3. Beggs AH, Koenig M, Boyce FM, Kunkel LM. Detection of
98% of DMD/BMD gene deletions by polymerase chain reaction. Hum Genet 1990;86:45– 48.
4. Bennett RR, Dunnen J, O’Brien KF, et al. Detection of mutations in the dystrophin gene via automated DHPLC screening
and direct sequencing. BMC Genet 2001;2:17.
5. Flanigan KM, von Niederhausern A, Dunn DM, et al. Rapid
direct sequence analysis of the dystrophin gene. Am J Hum
Genet 2003;72:931–939.
6. Schwartz M, Duno M. Improved molecular diagnosis of dystrophin gene mutations using the multiplex ligation-dependent
probe amplification method. Genet Test 2004;8:361–367.
7. Sellner LN, Taylor GR. MLPA and MAPH: new techniques for
detection of gene deletions. Hum Mutat 2004;23:413– 419.
8. Dent KM, Dunn DM, von Niederhausern AC, et al. Improved
molecular diagnosis of dystrophinopathies in an unselected clinical cohort. Am J Med Genet A 2005;134:295–298.
9. Yan J, Feng J, Buzin CH, et al. Three-tiered noninvasive diagnosis in 96% of patients with Duchenne muscular dystrophy
(DMD). Hum Mutat 2004;23:203–204.
10. Ikezawa M, Nishino I, Goto Y, et al. Newly recognized exons
induced by a splicing abnormality from an intronic mutation of
the dystrophin gene resulting in Duchenne muscular dystrophy.
Mutations in brief no. 213. Online. Hum Mutat 1999;13:170.
11. Beroud C, Carrie A, Beldjord C, et al. Dystrophinopathy
caused by mid-intronic substitutions activating cryptic exons in
the DMD gene. Neuromuscul Disord 2004;14:10 –18.
12. Tuffery-Giraud S, Saquet C, Chambert S, Claustres M. Pseudoexon activation in the DMD gene as a novel mechanism for
Becker muscular dystrophy. Hum Mutat 2003;21:608 – 614.
13. Roberts RG, Barby TF, Manners E, et al. Direct detection of
dystrophin gene rearrangements by analysis of dystrophin
mRNA in peripheral blood lymphocytes. Am J Hum Genet
1991;49:298 –310.
14. Gordon D, Desmarais C, Green P. Automated finishing with
autofinish. Genome Res 2001;11:614 – 625.
15. Gordon D, Abajian C, Green P. Consed: a graphical tool for
sequence finishing. Genome Res 1998;8:195–202.
16. Brunak S, Engelbrecht J, Knudsen S. Prediction of human
mRNA donor and acceptor sites from the DNA sequence. J
Mol Biol 1991;220:49 – 65.
17. Reese MG, Eeckman FH, Kulp D, Haussler D. Improved
splice site detection in Genie. J Comput Biol 1997;4:311–323.
18. Yeo G, Burge CB. Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals.
J Comput Biol 2004;11:377–394.
19. Shapiro MB, Senapathy P. RNA splice junctions of different
classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 1987;15:
7155–7174.
20. Senapathy P, Shapiro MB, Harris NL. Splice junctions, branch
point sites, and exons: sequence statistics, identification, and
applications to genome project. Methods Enzymol 1990;183:
252–278.
21. Cartegni L, Wang J, Zhu Z, et al. ESEfinder: a web resource to
identify exonic splicing enhancers. Nucleic Acids Res 2003;31:
3568 –3571.
22. Tuffery S, Bareil C, Demaille J, Claustres M. Four novel dystrophin point mutations: detection by protein truncation test
and transcript analysis in lymphocytes from Duchenne muscular dystrophy patients. Eur J Hum Genet 1996;4:143–152.
23. Fujii I, Matsukura M, Ikezawa M, et al. Adenoviral mediated
MyoD gene transfer into fibroblasts: myogenic disease diagnosis. Brain Dev 2006;28:420 – 425.
24. Tuffery-Giraud S, Saquet C, Thorel D, et al. Mutation spectrum leading to an attenuated phenotype in dystrophinopathies.
Eur J Hum Genet 2005;13:1254 –1260.
25. Howard MT, Shirts BH, Petros LM, et al. Sequence specificity
of aminoglycoside-induced stop codon readthrough: potential
implications for treatment of Duchenne muscular dystrophy.
Ann Neurol 2000;48:164 –169.
26. Howard MT, Anderson CB, Fass U, et al. Readthrough of dystrophin stop codon mutations induced by aminoglycosides.
Ann Neurol 2004;55:422– 426.
27. Fearon K, McClendon V, Bonetti B, Bedwell DM. Premature
translation termination mutations are efficiently suppressed in a
highly conserved region of yeast Ste6p, a member of the ATPbinding cassette (ABC) transporter family. J Biol Chem 1994;
269:17802–17808.
28. Ginjaar IB, Kneppers AL, v d Meulen JD, et al. Dystrophin
nonsense mutation induces different levels of exon 29 skipping
and leads to variable phenotypes within one BMD family. Eur
J Hum Genet 2000;8:793–796.
29. Horowitz DS, Krainer AR. Mechanisms for selecting 5⬘ splice
sites in mammalian pre-mRNA splicing. Trends Genet 1994;
10:100 –106.
30. Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet 1998;7:919 –932.
31. Hwang DY, Cohen JB. Base pairing at the 5⬘ splice site with
U1 small nuclear RNA promotes splicing of the upstream intron but may be dispensable for slicing of the downstream intron. Mol Cell Biol 1996;16:3012–3022.
32. Zheng ZM. Regulation of alternative RNA splicing by exon
definition and exon sequences in viral and mammalian gene
expression. J Biomed Sci 2004;11:278 –294.
33. Sherratt TG, Vulliamy T, Dubowitz V, et al. Exon skipping
and translation in patients with frameshift deletions in the dystrophin gene. Am J Hum Genet 1993;53:1007–1015.
34. Lu QL, Morris GE, Wilton SD, et al. Massive idiosyncratic
exon skipping corrects the nonsense mutation in dystrophic
mouse muscle and produces functional revertant fibers by
clonal expansion. J Cell Biol 2000;148:985–996.
35. Aartsma-Rus A, Bremmer-Bout M, Janson AA, et al. Targeted
exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul Disord 2002;12(suppl
1):S71–S77.
Gurvich et al: DMD Pseudoexon Mutations
89
Документ
Категория
Без категории
Просмотров
7
Размер файла
316 Кб
Теги
potential, efficiency, mutation, splicing, phenotypic, pseudoexon, dmd, therapy
1/--страниц
Пожаловаться на содержимое документа