close

Вход

Забыли?

вход по аккаунту

?

Episodic ataxia and myokymia syndrome A new mutation of potassium channel gene Kv1.1

код для вставкиСкачать
10.
11.
12.
13.
14.
15.
16.
17.
18.
13.
20.
idiopathic torsion dystonia in the United Kingdom. Brain
1990;l 13~379-395
Kramer PL, de Leon D, Ozelius L, et al. Dystonia gene in the
Ashkenazi Jewish population is located on chromosome 9q3234. Ann Neurol 1990;27:114-120
Warner TT, Fletcher NA, Davis MB, et al. Linkage analysis
in British and French families with idiopathic torsion dystonia.
Brain 1993;1163739-744
Kramer PL, Heiman G , Gasser T, et al. The DYTl gene on
3q34 is responsible for most cases of early-onset idioparhic torsion dystonia in non-Jews. Am J Hum Genet 1994;55:468475
Bressman SB, de Leon D, Kramer PL, et al. Dystonia in Ashkenazi Jews: clinical characterization of a founder mutation.
Ann Neurol 1994;36:771-777
Bressman SB, Hunt AL,Heiman GA, et al. Exclusion of the
DYTl locus in a non-Jewish family with early-onset dystonia.
Mov Disord 1994;9:626-632
Bressman SB, Heiman GA, Nygaard TG, et al. A study of
idiopathic torsion dystonia in a non-Jewish family: evidence
for genetic heterogeneity. Neurology 1994;44:283-287
Holmgren G, Ozelius L, Forsgren L, et al. Adult onset idiopathic torsion dystonia is excluded from the DYTl region
(9q34) in a Swedish family. J Neurol Neurosurg Psychiatry
1995;59:178-181
Kwiatkowski DJ, Henske EP, Weimer K, et al. Construction
of a GT polymorphism map of human 99. Genomics 1992;
12:229-240
h s c h NJ, de Leon D,Ozelius L, et al. Genetic analysis of
idioparhic torsion dystonia i n Ashkenazi Jews and their recent
descent from a small founder population. Nature Genet 1335;
9:152-159
O’Connell JR, Weeks DE. The VITESSE algorithm for rapid
exact multilocus linkage analysis via genotype set-recoding and
fuzzy inherirance. Nature Genet 1995;11:402-408
Ahmad F, Davis MB, Waddy HM, et a]. Evidence for locus
heterogeneity in autosomal dominant torsion dystonia. Genomics 1993;15:9-12
Episodic Ataxia and
Myokymia Syndrome:
A New Mutation of
Potassium Channel Gene
Kvl. 1
Sinan Comu, MD,*? Michael Giuliani, MD,t
and Vinodh Narayanm, M D * t
Episodic ataxia and myokymia syndrome is an autosomal
dominant disorder characterized by persistent myokymia
and attacks of unsteadiness, slurred speech, and tremulousness. This disease has been associated with point mutations in the potassium channel gene Kvl.1 (KCNAl),
located at chromosome 1 2 ~ 1 3Here,
.
we describe a novel
mutation within this gene in a newly diagnosed family.
Comu S, Giuliani M, Narayanan V. Episodic
ataxia and myokymia syndrome: a new
mutation of potassium channel gene Kvl.1.
Ann Neurol 1996;40:684-687
Episodic ataxia and myokymia syndrome (EAM) is a
rare autosomal dominant disorder that manifests in
childhood with attacks of truncal ataxia, tremulousness,
and slurred speech. Sudden movements or excitement
can trigger the attacks, which last for several minutes
to hours. Myokymia of the distal musculature is a persistent feature. Browne and colleagues [ 1, 21 associated
EAM with missense point mutations in a potassium
channel gene, Kvl.1. We examined the same gene in
a new family with EAM.
Patients and Methods
The proband, a 6-year-old boy, presented with attacks of
“shaking and light-headedness” triggered by exercise or startle. The duration of the attacks ranged from several minutes
to an hour, during which he had unsteadiness of gait and
slurred speech without any headache, change in consciousness, nausea, or vertigo. The shaking was described as
“trembling” along with a sensation of warmth.
Five other members of the proband’s family (Fig 1) suffered from similar attacks with prominent tremulousness,
dysarthria, and ataxia. Their initial feeling was also lightheadedness or dizziness without vertigo or sensation of presyncope. The slurring of speech was not associated with any
change in comprehension or responsiveness. There was also
From the Departments of *Pediatrics and ?Neurology, University
of Pittsburgh, Pittsburgh, PA.
Received Mar 5 , 1996, and in revised form Apr 29. Accepted for
publication Apr 30, 1936.
Address correspondence to D r Gomu, PK 81, Levent, Istanbul
8062 1, Turkey.
684
Copyright 0 1996 by the American Neurological Association
n
I11
2L
Fig 1. Pedigree of this fdmily with episodic ataxia and myokymia syndrome. Blackened symbols repesent affected individuals. Genetic analysis was performed on individuah marked
by dots. The proband is indicated by an arrow. Individuals
II-I, 11-5, and III- I (newborn) were unavaihble.
blurred vision without diplopia. The attacks lasted a few
minutes, but sometimes milder symptoms continued for
hours. Food intake ameliorated the symptoms. At times, a
headache followed the attacks in older family members. The
frequency varied widely and improved with age. They
avoided exercise, stressful situations, and sudden movements
that could trigger the attacks. All of them had attacks early
in childhood, which could even be recognized during infancy
with sudden slowing in activity, scared appearance, and diffuse tremulousness. Hand stiffening occurred intermittently
during the attacks of the proband's grandmother. Fine rippling movements of the face and hand muscles were frequently observed in all members; however, these were not
associated with the attacks. Several family members were
treated with phenobarbital and phenytoin for presumed seizure disorder without effect. A trial of acetazolamide relieved
the symptoms in the proband, but this effect was not sustained. Other family members either did not try this treatment or had only minor benefit.
The affected members (except 11-1) were examined. Physical findings were limited to myokymia in the periorbital
muscles. In particular, there was no tremor, nystagmus, dysmetria, or sensory deficit. After strenuous exercise, a mild
attack was induced in the proband's mother, which consisted
of slightly slurred speech and gait imbalance without nystagmus, dysmetria, or abnormal movements. The tremulousness
was only subjectively present.
The electromyograms (EMGs) in four adult members revealed typical myokymia in the selected hand and periorbital
muscles (Fig 2). This finding was difficult to demonstrate
and required extensive searching.
Genetic Analysis
Genomic DNA was extracted from the blood samples of 5
affected and 2 unaffected family members. The Kvl.l gene
contains a single 1,488-bp exon. Almost the entire gene (between base pairs 2 and 1,485) was amplified with polymerase
chain reaction (PCR) from genomic DNA (primers: TGAC
GGTGATGTCTGGGGAG and AATAAGAGCAAGCTA
CTGACCGA ). The amplification product was sequenced
eirher directly or after cloning into the pT7Blue vector (Novagen). The initial PCR primers and two additional internal
oligonucleotides (CGGACTTCTTCAAAAACATCA and
GATGGCCACAATGTCTATGAA, 5' ends at base 740
and 786, respectively) were utilized to sequence the whole
segment in all affected members (Cycle Sequencing Kit,
GibcoBRL).
Allele-specific oligonucleotide hybridization analysis
(ASOH) was performed to determine the presence of a mutation in general population. Kvl.1 gene was PCR amplified
from 100 normal individuals. Duplicate dot blots were prepared, each containing 100 control and 5 patient samples.
The blots were separately hybridized at 37°C with one of
the two '*P-labeled oligonucleotide probes. These were 19mers differing only at the 10th nucleotide (TCGTGGAA
A[TIC]GCTGTGCAT), specific for either the murated or
normal allele. The blots were washed with tetramethylammonium chloride wash solution at 55°C [3] before autoradiography.
Results
The direct sequencing of the PCR-amplified Kvl.1
gene revealed two bands (T and C) at nucleotide 677
in the affected, and a single band (C) in the normal
family members (Fig 3). The presence of two bands
indicates two Kvl.1 alleles in the affected members
that were amplified together by our PCR strategy. The
cloning step enabled us to separate these mutated and
normal alleles, with each clone containing only one of
them. In the affected individuals, approximately 50%
of the clones had this C"'T mutation as expected in
the heterozygotes. ASOH analysis detected this mutation in 5 affected individuals but not in 100 normal
controls. This finding indicates that the C"'T mutation is not a polymorphism but a mutation specific to
EAM phenotype. This mutation changes the amino
acid 226, replacing threonine with methionine.
Discussion
EAM was first described by Van Dyke and associates
[4]in 1975. Common features of the attacks are tremulousness, truncal ataxia, and slurred speech. Sensation
of stiffness or limpness [5],jerking movements [4),titubation, and carpopedal spasms [GI are also reported.
Most features are subjective or subtle, complicating the
diagnosis. A factitious disorder was considered in our
family initially. However, stereotypical description of
the attacks in different generations and careful observation for myokymia led to the correct diagnosis. Hanging
the hand in the prone position while the arm is rested on
a stationary surface may show the fine finger movements
from myokymia [ 51. The myokymia may also be brought
out by ischemia [7]. EMG investigation needs to be
diligent with a careful search in several muscles, as myokymia may only involve small muscles of the hand and
face. Episodic ataxia occurs in several recessive metabolic
disorders and two autosomal dominant syndromes,
EAM and recurrent vestibulocerebellarataxia. The latter,
mapped to chromosome 19p [S], differs from EAM by
Brief Communication: Comu et al: Episodic Ataxia and Myokymia
685
~
~~~
~
~
Fig 2. Needle examination, periorbitul muscle; vnyokymic poteztiuh wcorded uve7 I , GOO msec.
presence of vertigo, nausea, and nystagmus during the
attacks. Linkage analysis has localized EAM to chromosome 1 2 ~ 1 3near a group of potassium channel genes
[9]. Analysis of the potassium channel gene Kvl .1 revealed 6 different missense point mutations in 7 investigated families [ 1, 21.
The potassium channels are a growing family of proteins (voltage gated, inward rectifier, minK', Ca, ATP,
Na activated channels). Kvl .1 is related to the Shakertype voltage-gated potassium channels with 6 transmembrane domains (S 1-6). The mutation Thr226Met
is on the S2 transmembrane portion and does nor cause
a significant change in the hydrophobicity profile.
However, mutations in the S2 segment have been
shown to alter the gating characteristics [lo]. The
T h P M e t mutation replaces an amino acid invariably
conserved from Drosophila to humans, suggesting a
68G
Annals of Neurology
Vol 40
No 4 October 1996
crucial role for this residue. The actual potassium channels are formed as homotetramers or heterotetramers
with other potassium channel peptides. The rather mild
symptoms despite a missense mutation in this highly
conserved site may be due to heterotetramer formation
or heterozygocity. The rat Kvl.1 homologue is expressed in both the cerebellum and the peripheral
nerves, which may explain the concomitant involvement of the central and peripheral nervous system (ie,
ataxia and myokymia) [ I , 111. The persistence of the
myokymia and episodic nature of the ataxia may be
due to the different heterotetramers formed in different
tissues. Expression of some mutated Kvl.1 genes in
Xenopus oocytes suggested that efficient repolarization
of the affected neurons could be impaired [12]. O u r
report of a Kvl.1 missense mutation in this family is
in concordance with the findings of Browne and associ-
2.
3.
4.
5.
Fig 3. Sequencing gel fiom 3 afected @rst three columns)
and I normal family member (last column). Arrows point to
the nucleotide 677, which has double bands (C and r ) in
the affected and a single band (C) in the normal individual.
For each column, the order of the nucleotide lanes is C, A,
T, and G.
6.
7.
8.
ates [l, 21. E M , the first human potassium channelopathy, is similar to other channelopathies in its episodic
nature. The clinical diagnosis can be complicated by
the subtlety of the symptoms. However, the genetic
diagnosis is simple as the single exon of the Kv1.l gene
can easily be analyzed.
This study was supported in part by a grant from the United Cerebral Palsy Foundation (R-607-94) to Vinodh Narayanan.
9.
10.
11.
12.
References
1. Browne DL, Gancher ST, Nutt JG, et al. Episodic ataxia/myokymia syndrome is associated with point mutations in the hu-
man potassium channel gene, KCNA-1. Nature Genet 1994;
8: 136-1 40
Browne DL, Brunt EFU', Griggs RC, et al. Identification of
two new KCNAl mutations in episodic ataxidmyokymia families. Hum Mol Genet 1995;4:1671-1672
Wood WI, Gitschier J, Lasky LA, Lawn RM. Base composition-independent hybridization in tetramethylammonium chloride: a method for oligonucleotide screening of highly complex gene libraries. Proc Natl Acad Sci USA 1985;82:15851588
Van Dyke D H , Griggs RC, Murphy MJ, Goldstein MN. Hereditary rnyokymia and periodic ataxia. J Neurol Sci 1975;25:
109-1 18
Brunt ERP, Van Weerden TW.Familial paroxysmal kinesigenic ataxia and continuous myokymia. Brain 1990;113:13611382
Hanson PA, Martinez LB, Cassidy R. Contractures, continuous
muscle discharges, and titubation. Ann Neurol 1977;1: 120124
Lubbers WJ, Brunt ERP, Scheffer H, et al. Hereditary myokymia and paroxysmal ataxia linked to chromosome 12 is responsive to acetazolamide. J Neurol Neurosurg Psychiatry
1995;59:400-405
Vahedi K, Joutel A, Van Bogaert P, et al. A gene for hereditary
paroxysmal ataxia maps to chromosome 19p. Ann Neurol
1995;37:289-293
Litt M, Kramer P, Browne D, et al. A gene for episodic ataxia/
J Hum Genet
myokymia maps to chromosome 1 2 ~ 1 3Am
.
1994;55:702-709
Planells-Cases R, Ferrer-Montiel AV, Patten CD, Montal M.
Mutarion of conserved negatively charged residues in the S2
and S3 transmembrane segments of a mammalian K' channel
selectively modulates channel gating. Proc Natl Acad Sci USA
1995;92:9422-9426
BecMi S, Pongs 0. Members of the RCK potassium channel
family are differentially expressed in the rat nervous system.
EMBO J 1990;9:777-782
Adelman JP, Bond CT, Pessia M, Maylie J. Episodic ataxia
results from voltage-dependent potassium channels with altered
functions. Neuron 1995;15:1449-1454
Brief Communication: Comu et al: Episodic Ataxia and Myokymia
687
Документ
Категория
Без категории
Просмотров
1
Размер файла
338 Кб
Теги
channel, ataxia, potassium, mutation, kv1, syndrome, myokymia, genes, episodic, new
1/--страниц
Пожаловаться на содержимое документа