close

Вход

Забыли?

вход по аккаунту

?

Further evidence of MAO-A gene variants associated with bipolar disorder.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 144B:37 –40 (2007)
Further Evidence of MAO-A Gene
Variants Associated With Bipolar Disorder
Daniel J. Müller,1,3 Alessandro Serretti,2* Tricia Sicard,3 Subi Tharmalingam,3 Nicole King,3
Paola Artioli,4 Laura Mandelli,2 Cristina Lorenzi,4 and James L. Kennedy3**
1
Department of Psychiatry, Charite´ University Medicine Berlin, PUK der Charite´ im SHK, Charite´ Campus Mitte, Berlin, Germany
Institute of Psychiatry, University of Bologna, Bologna, Italy
3
Neurogenetics Section, Centre for Addiction and Mental Health, Department of Psychiatry, University of Toronto, Toronto, ON, Canada
4
Department of Psychiatry, San Raffaele Scientific Institute, Milan, Italy
2
The aim of this study was to investigate MAOA
gene variants in bipolar disorder by using a
family-based association approach. The first sample included 331 nuclear families from Western
and Central Canada with at least 1 offspring
affected with bipolar disorder comprising a total
of 1,044 individuals. All subjects were genotyped
for MAOA–941T > G and uVNTR gene variants
using PCR techniques. Haplotype TDT was statistically significant (LRS ¼ 12.17; df ¼ 3; P ¼ 0.0068;
permutation global significance ¼ 0.00098), with
the T-4 haplotype significantly associated with
bipolar disorder (OR ¼ 1.63, 95% CI ¼ 1.11–2.37).
Single marker analysis evidenced a borderline
association for MAOA–941T > G (P ¼ 0.04), but not
for the uVNTR. Pooling the Canadian sample with
a second previously reported Italian sample
genotyped for the uVNTR variant, negative
results were obtained as well. No different results
were detected when analyzing female subjects
separately. In conclusion, our family-based association study gives mild but further support of
the involvement of MAOA variants in bipolar
disorder. ß 2006 Wiley-Liss, Inc.
KEY WORDS:
bipolar disorder; affective disorder; MAO-A; genetics
Please cite this article as follows: Müller DJ, Serretti A,
Sicard T, Tharmalingam S, King N, Artioli P, Mandelli L,
Lorenzi C, Kennedy JL. 2007. Further Evidence of MAOA Gene Variants Associated With Bipolar Disorder. Am
J Med Genet Part B 144:37–40.
Grant sponsor: Canadian Institutes of Health Research (CIHR);
Grant sponsor: CIHR postdoctoral fellowship award.
*Correspondence to: Alessandro Serretti, M.D., Institute of
Psychiatry, University of Bologna, Viale Carlo Pepoli 5, 40123
Bologna, Italy. E-mail: alessandro.serretti@unibo.it
**Correspondence to: James L. Kennedy, M.D., Neurogenetics
Section, Centre for Addiction and Mental Health, Department of
Psychiatry, University of Toronto, 250 College Street R30,
Toronto, ON, M5T 1R8, Canada.
E-mail: James_Kennedy@camh.net
Received 21 March 2006; Accepted 23 May 2006
DOI 10.1002/ajmg.b.30380
ß 2006 Wiley-Liss, Inc.
INTRODUCTION
The gene coding for the monoamine oxidase A, the principal
enzyme for the degradation of biogenic amines, is of particular
interest for mood disorders [Preisig et al., 2005]. Pharmacological and genetic observations suggest that variations in either
the structural or in the regulatory sequences of the MAOA gene
could be associated with behavioral or physiological variability
in humans [Shih et al., 1999; Shih, 2004]. MAOA-deficient mice
have elevated brain levels of serotonin (5-HT), norepinephrine
(NE), and dopamine (DA), which are MAO-preferred substrates, and manifest aggressive behavior [Cases et al., 1995;
Shih and Chen, 1999]. The MAOA gene is located on the short
arm of the X chromosome (Xp11.23) [Sabol et al., 1998] and
several different polymorphisms in the MAOA gene have been
reported. Two of them gained interest for their functional
relevance. First, a G to T substitution at position 941 has been
reported [Hotamisligil and Breakefield, 1991], with the 941 T
allele associated with lower MAOA activity in human male
fibroblast lines. Second, a polymorphism located 1.2 kb
upstream of the MAOA coding sequence that affects the
transcriptional activity of the MAOA gene promoter has been
described [Sabol et al., 1998]. This gene polymorphism consists
of 30 bp repeated sequence present in 3, 3.5, 4, or 5 copies. In
luciferase reporter gene assays, allele copies 3.5 and 4 proved to
be 2–10 times more active than the shorter one (3), while
opposite findings were reported for the rarer allele copy 5
[Sabol et al., 1998; Deckert et al., 1999].
Previous reports of MAOA studies in bipolar disorder were
mixed but with some evidence of association. Despite negative
findings [Sasaki et al., 1998], meta analyses reported mild but
significant associations for the 941 T variant [Rubinsztein
et al., 1996; Furlong et al., 1999] in bipolar disorder. As for the
uVNTR variant, evidence was less unequivocal with negative
findings [Rubinsztein et al., 1996; Furlong et al., 1999; Kirov
et al., 1999; Kunugi et al., 1999; Syagailo et al., 2001; Serretti
et al., 2002], though significant sex-specific effects were
observed [Deckert et al., 1999; Lin et al., 2000; Preisig et al.,
2000; Schulze et al., 2000; Gutierrez et al., 2004]. The aim of
this study was to investigate the possible association of the two
MAOA gene variants with bipolar disorder in a large sample of
nuclear families recruited in the Toronto area and Central
Canada. The Canadian sample has subsequently been pooled
with an Italian sample where results for the VNTR polymorphism were previously reported yielding no significant
results to detect possible false negative findings due to the
sample size [Serretti et al., 2002].
MATERIALS AND METHODS
Sample
The Canadian sample was composed of 336 patients
(212 females and 124 males), affected with bipolar disorder
38
Müller et al.
(n ¼ 319) and schizoaffective disorder, bipolar type (n ¼ 17),
from 331 nuclear families recruited in the Toronto area and
Central Canada. Patients mean age was 35.36 10.37 years
with a mean age at the onset of 20.00 7.58 years.
Diagnostic assessment procedures for this sample have been
published in detail elsewhere [Carter et al., 2003]. Briefly, a
semi-structured clinical interview (SCID-I) [First et al., 1995]
was performed to assign best estimate consensus DSM-IV
diagnoses.
A second sample was composed by Italian patients,
with probands affected by Bipolar disorder (n ¼ 309), from
99 nuclear families recruited in the area of Milan (Northern
Italy). The sample was composed of 154 females (49.8%) and
155 males (50.2%), a mean age of 31.80 7.70 years and a mean
age at the onset of 23.13 5.41 years. Findings on the uVNTR
polymorphism of this sample were reported in the context of a
previous study [Serretti et al., 2002]. Lifetime diagnoses were
assigned according to DSM-IV criteria on the basis of the
Structured Clinical Interview for DSM-IV, axis I disorders
(SCID-I) and all available sources of information. Informed
consent was obtained from all subjects after the aim of the
study had been fully explained.
DNA ANALYSIS
Genomic DNA was obtained from peripheral leukocytes,
using high salt extraction methods [Lahiri and Nurnberger,
1991]. Genotypes of the MAOA-VNTR polymorphism was
determined by Polymerase Chain Reaction (PCR). PCR was
performed with primers: 50 -GGACCTGGGCAGTTGTGC-30 ,
and 50 -CCCAGGCTGCTCCAGAAA-30 . Two and a half microliters of 20 ng/ml stock genomic DNA was used in a 20 ml
reaction volume in the Canadian sample while 100 ng DNA
was diluted to 5 ml in the Italian sample. Amplification was
performed with an annealing temperature of 598C (Canadian
sample) and 618C (Italian sample). PCR products were
resolved using 3.0% high resolution plus agarose gel for
2.5 hr at 100 volts [Sabol et al., 1998]. The MAOA941T > G
polymorphism was analyzed by Applied Biosystems (ABI)
Taqman assay only in the Canadian sample [Hotamisligil and
Breakefield, 1991]. An ABI Taqman assay was specially
designed (Assay-by-design) using the following primers; forward ¼ CTTCCAGCAGAGAGAAACCAGTTAA and reverse ¼
GGCCTCCTTGTAATACATCATGCA. The assay was analyzed on the ABI7000 sequence detection instrument (Applied
Biosystems, Inc., Foster City, CA). For each 10 ml reaction, we
used 1 ml of 20 ng/ml DNA, 5.0 ml of Taqman reaction mix, 0.25 ml
of ABI assay, and 3.75 ml of water.
Statistical Analysis
The transmission disequilibrium test (TDT) was applied for
single marker and haplotype family-based association analysis
[Spielman et al., 1993].
ETDT22 (extended TDT analysis) [Sham and Curtis, 1995]
was used for single allele significance in single marker analysis
and applied for X-linked analyses. Haplotype analyses were
performed with the program TDTPHASE 2.403 [Dudbridge,
2003] that also includes an option for X-linked analyses.
Haplotypes-analyses were performed with the COCAPHASE
2.35 program [Dudbridge, 2003]. Using a standard unconditional logistic regression, this program performs likelihood
ratio tests (LRT) under a log-linear model of the probability
that an haplotype belongs to the case rather than the control
group; the expectation–maximization (EM) algorithm is used
to resolve uncertain haplotypes and provides maximumlikelihood estimates of frequencies. Permutation analyses
were used to determine empiric P levels, by using 10,000
replications.
TABLE I. Haplotype Frequencies for MAOA 941T > G and
VNTR Polymorphisms, in the 331 Families of Bipolar Patients
(Canadian Sample)
MAOA 941T > G
MAOA VNTR
Haplotype frequency
T-4
T-3
G-4
G-3
T-5
T-3.5
G-5
G-3.5
T-2
G-2
0.4802
0.2403
0.1708
0.0856
0.0080
0.0067
0.0030
0.0024
0.0022
0.0008
We calculated the power of our sample (Canadian) to detect
transmission differences for TDT analysis with an alpha level
of 0.05. We had a sufficient power (0.80) to detect a genotypic
relative risk of 1.81 (Aa) and 3.08 (AA) with a minimum
detectable difference of frequency of 0.17 between the two
groups (considering a frequency of the disease allele of 0.4,
a disease prevalence of 0.01, a phenocopy rate of 0.1, a
penetrance of 0.8, a codominant transmission model, and a
strong LD (D-prime ¼ 0.9) between disease and marker)
[Purcell and Sham, 2001; Purcell et al., 2003].
RESULTS
In the Canadian sample, MAOA–941T > G and VNTR
were in strong linkage disequilibrium (Chi-sq ¼ 863.85 df ¼ 4
P ¼ 0.0001; D0 ¼ 0.84), with high frequency rate of the T-4
haplotype in the sample of 331 nuclear families (Table I).
Single marker TDT, performed with ETDT22, showed a
positive, though marginal, association between the T allele
of the 941T > G polymorphism and bipolar disorder (Chisquared for allele-wise TDT ¼ 4.11; df ¼ 1; P ¼ 0.04), while no
association was detected for the VNTR polymorphism (Chisquared for allele-wise TDT ¼ 1.70; df ¼ 2; P ¼ 0.43) (Table II).
Similar results were obtained using COCHAPHASE single
marker analysis (941T > G: LRS ¼ 4.58; df ¼ 1; P ¼ 0.032;
VNTR: LRS ¼ 2.21; df ¼ 3; P ¼ 0.53) (see Table II).
Considering males and females separately, neither the
VNTR nor the 941T > G polymorphism were associated to
bipolar disorder (in males, respectively: P > 0.11, in females,
respectively: P > 0.14), probably because of decrease in sample
sizes.
By the haplotype TDT analysis, the T-4 haplotype was found
significantly associated with bipolar disorder (LRS ¼ 14.94;
TABLE II. Individual Transmissions for MAOA 941T > G
(P ¼ 0.04) and VNTR Alleles (P ¼ 0.43) in the Canadian Sample
MAOA markers
Ta
f(T)
NTb
F(NT)
941T > G
T
G
59
54
0.52
0.48
39
75
0.34
0.66
(Chi-sq, P)
(4.11, 0.04)
VNTR
2
3
3.5
4
5
0
51
0
66
2
—
0.43
—
0.55
0.02
0
65
0
52
2
0.55
0.44
0.02
(1.70, 0.43)
a
b
Transmitted allele count.
Untrasmitted allele count.
Bipolar Disorder and MAO-A
39
TABLE III. Transmissions of the 941T > G and VNTR Haplotype in Bipolar Patients
(P ¼ 0.021) in the Canadian Sample
MAOA markers
941T > G
a
b
VNTR
T-4
G-3
T-3
G-4
T-5
T-3.5
G-5
Ta
f(T)
NTb
F(NT)
Chi-sq
P
165
44
22
2
1
1
0
0.702
0.187
0.094
0.009
0.004
0.004
—
139
58
24
12
0
1
1
0.591
0.247
0.102
0.051
—
0.004
0.004
6.32
2.46
0.10
8.14
1.39
0.00
1.39
0.012
0.117
0.756
0.004
0.239
1.000
0.240
Transmitted haplotype count.
Untrasmitted haplotype count.
df ¼ 6; P ¼ 0.021; permutation analysis ¼ 0.02) (Table III). We
repeated the calculations dropping rare haplotypes (frequency
<0.01) and the result was even more significant (LRS ¼ 12.17;
df ¼ 3; P ¼ 0.0068; permutation analysis ¼ 0.00098). Carriers
of the T-4 haplotype had a significant risk effect (OR ¼ 1.63;
95%CI ¼ 1.11–2.37). Considering exclusively females did not
change the observed haplotype frequencies.
The Italian sample was only genotyped for the VNTR
polymorphism. According to the data found in the Canadian
sample, single marker TDT did not reveal a significant
association between the VNTR polymorphism and bipolar
disorder (Chi-squared for allele-wise TDT ¼ 1.31 df ¼ 1
P ¼ 0.29; LRS 1.09 df ¼ 1 P ¼ 0.30, permutation analysis ¼ 0.21). Finally, merging the Italian sample with the
Canadian one, no significant TDT was still observed for the
VNTR polymorphism (Chi-squared for allele-wise TDT ¼ 0.43
df ¼ 2 P ¼ 0.80; LRS ¼ 0.82 df ¼ 3 P ¼ 0.84, permutation analysis ¼ 0.85) (data not shown).
DISCUSSION
In the present sample, we observed a marginal association
between the MAOA gene and bipolar disorder with one single
nucleotide polymorphism (941T > G) and with haplotype
analyses using a family-based association strategy. The use of
those strategies has the purpose of circumvent biases linked to
the traditional case-control association studies, for example
population stratification (or admixture) due to ethnic variation
[Falk and Rubinstein, 1987; Spielman et al., 1993].
Consistent with functional analyses [Hotamisligil and
Breakefield, 1991], our data suggest an association of increased
bipolar affective disorder risk in particular with the MAOA 941
T which would be expected to correlate with relatively low
levels of MAOA activity. This finding is in line and in the same
direction of the one observed in previous reports in Caucasians
[Rubinsztein et al., 1996; Furlong et al., 1999; Preisig et al.,
2000]. Interestingly, the other polymorphism we investigated,
the MAOA VNTR, presented a moderate overtransmission of
the allele 4 which was more present also in panic disorder
subjects [Deckert et al., 1999]. However, a number of negative
articles were also reported, as stated in the introduction
section as well as discrepancies in the risk haplotype. The two
markers used in the present study could be considered quite
informative of the MAOA gene, firstly because it has been
reported that all the 90 kb length of the MAOA gene can be
represented by a single block with strong LD within it [Jansson
et al., 2005], then because the two polymorphism we analyzed
are in strong LD and they located at approximately 70 kb from
each other spanning a large part of the gene (Regarding
haplotype structure, the reader is referred to www.hapmap.
org or http://www.ncbi.nlm.nih.gov/SNP/GeneGt.cgi?geneID¼
4128 in order to retrieve the latest version of haplotype
interpretation of the MAOA gene).
Our sample size allowed us to observe effect sizes in the
medium range and this means that smaller differences were
not observable. In detail, we could reliably observe a difference
of about 0.17 between the two groups; therefore, the observed
value of 0.11 (OR ¼ 1.63) should be considered with caution.
However, single gene variants are not expected to have much
smaller effects than this on complex traits; therefore, the risk of
having an underpowered sample should not be considered high
[Kendler, 2005].
A possible explanation of our borderline findings is that
genetic influence is limited to other features that are
independent from both diagnoses and symptomatology factors
[Kendler, 2005]. This view is recently gaining interest following, as example, some reports of associations with antidepressant response (for a review see Serretti et al., 2005), or with
neuropsychology traits [Egan et al., 2001]. Such strategies try
to circumvent the complexities of psychiatric disturbances
following more linear hypotheses of functional polymorphisms
associated with simple traits. A more comprehensive analysis
of those features should, therefore, complement future studies.
Finally, family-based association studies are not free from
biases. In most instances case-control studies are more powerful compared to them. For instance, if we consider that for a
TDT analysis one needs to recruit not only cases but also both
parents, the samples appear generally undersized. Moreover, a
bias toward a selection of younger probands is implicit in the
method [Khoury and Yang, 1998; Schulze et al., 2001].
In conclusion, our family-based association study gives mild
but further support of the involvement of MAOA variants in
mood disorders.
ACKNOWLEDGMENTS
This work was supported by a Canadian Institutes of Health
Research (CIHR) operating grant to J.L.K. and a CIHR
postdoctoral fellowship award to D.J.M.
REFERENCES
Carter TD, Mundo E, Parikh SV, Kennedy JL. 2003. Early age at onset as
a risk factor for poor outcome of bipolar disorder. J Psychiatr Res 37:
297–303.
Cases O, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Muller U, Aguet M,
Babinet C, Shih JC, et al. 1995. Aggressive behavior and altered
amounts of brain serotonin and norepinephrine in mice lacking MAOA.
Science 268:1763–1766.
Deckert J, Catalano M, Syagailo YV, Bosi M, Okladnova O, Di Bella D,
Nothen MM, Maffei P, Franke P, Fritze J, Maier W, Propping P,
Beckmann H, Bellodi L, Lesch KP. 1999. Excess of high activity
monoamine oxidase A gene promoter alleles in female patients with
panic disorder. Hum Mol Genet 8:621–624.
40
Müller et al.
Dudbridge F. 2003. Pedigree disequilibrium tests for multilocus haplotypes.
Genet Epidemiol 25:115–121.
Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub
RE, Goldman D, Weinberger DR. 2001. Effect of COMT Val108/158 Met
genotype on frontal lobe function and risk for schizophrenia. Proc Natl
Acad Sci USA 98:6917–6922.
Falk CT, Rubinstein P. 1987. Haplotype relative risks: An easy reliable way
to construct a proper control sample for risk calculations. Ann Hum
Genet 51:227–233.
First MB, Spitzer RL, Gibbon M, Williams JB. 1995. Structured Clinical
Interview for DSM-IV Axis I Disorders- Patient Edition (SCID- I/P,
Version 2.0). New York: Biometrics Research Department, New York
State Psychiatric Institute.
Furlong RA, Ho L, Rubinsztein JS, Walsh C, Paykel ES, Rubinsztein DC.
1999. Analysis of the monoamine oxidase A (MAOA) gene in bipolar
affective disorder by association studies, meta-analyses, and sequencing
of the promotor. Am J Med Genet 88:398–406.
Gutierrez B, Arias B, Gasto C, Catalan R, Papiol S, Pintor L, Fananas L.
2004. Association analysis between a functional polymorphism in the
monoamine oxidase A gene promoter and severe mood disorders.
Psychiatr Genet 14:203–208.
Hotamisligil GS, Breakefield XO. 1991. Human monoamine oxidase A gene
determines levels of enzyme activity. Am J Hum Genet 49:383–392.
Jansson M, McCarthy S, Sullivan P, Dickman P, Andersson B, Oreland L,
Schalling M, Pedersen N. 2005. MAOA haplotypes associated with
thrombocyte-MAO activity. BMC Genet 6:46.
Kendler KS. 2005. ‘‘A gene for. . .’’: The nature of gene action in psychiatric
disorders. Am J Psychiatry 162:1243–1252.
Preisig M, Ferrero F, Malafosse A. 2005. Monoamine oxidase a and
tryptophan hydroxylase gene polymorphisms: Are they associated with
bipolar disorder? Am J Pharmacogenomics 5:45–52.
Purcell S, Sham P. 2001. Genetic Power Calculator. London: Social, Genetic
& Developmental Research Centre.
Purcell S, Cherny SS, Sham P. 2003. Genetic Power Calculator: Design of
linkage and association genetic mapping studies of complex traits.
Bioinformatics 19:149–150.
Rubinsztein DC, Leggo J, Goodburn S, Walsh C, Jain S, Paykel ES. 1996.
Genetic association between monoamine oxidase A microsatellite and
RFLP alleles and bipolar affective disorder: Analysis and meta-analysis.
Hum Mol Genet 5:779–782.
Sabol SZ, Hu S, Hamer D. 1998. A functional polymorphism in the
monoamine oxidase A gene promoter. Hum Genet 103:273–279.
Sasaki T, Hattori M, Sakai T, Kato T, Kunugi H, Hirose T, Nanko S. 1998.
The monoamine oxidase-A gene and major psychosis in Japanese
subjects. Biol Psychiatry 44:922–924.
Schulze T, Muller DJ, Krauss H, Scherk H, Ohlraun S, Syagailo YV,
Windemuth C, Neidt H, Grassle M, Papassotiropoulos A, Heun R,
Nothen MM, Maier W, Lesch KP, Rietschel M. 2000. Association
between a functional polymorphism in the monoamine oxidase A gene
promoter and Major Depressive Disorder. Am J Med Genet 96:801–803.
Schulze TG, Muller DJ, Krauss H, Gross M, Bauer I, Fangerau-Lefevre H,
Illes F, Ohlraun S, Fimmers R, Cichon S, Held T, Propping P, Nothen
MM, Maier W, Rietschel M. 2001. Caught in the trio trap? Potential
selection bias inherent to association studies usings parent-offspring
trios. Am J Med Genet 105:351–353.
Khoury MJ, Yang Q. 1998. The future of genetic studies of complex human
diseases: An epidemiologic perspective. Epidemiology 9:350–354.
Serretti A, Cristina S, Lilli R, Cusin C, Lattuada E, Lorenzi C, Corradi B,
Grieco G, Costa A, Santorelli F, Barale F, Nappi G, Smeraldi E. 2002.
Family-based association study of 5-HTTLPR, TPH, MAO-A, and DRD4
polymorphisms in mood disorders. Am J Med Genet 114:361–369.
Kirov G, Norton N, Jones I, McCandless F, Craddock N, Owen MJ. 1999. A
functional polymorphism in the promoter of monoamine oxidase A gene
and bipolar affective disorder. Int J Neuropsychopharmcol 2:293–298.
Serretti A, Artioli P, Quartesan R. 2005. Pharmacogenetics in the treatment
of depression: Pharmacodynamic studies. Pharmacogenet Genomics
15:61–67.
Kunugi H, Ishida S, Kato T, Tatsumi M, Sakai T, Hattori M, Hirose T, Nanko
S. 1999. A functional polymorphism in the promoter region of
monoamine oxidase—A gene and mood disorders. Mol Psychiatry 4:
393–395.
Sham PC, Curtis D. 1995. An extended transmission/disequilibrium test
(TDT) for multi-allele marker loci. Ann Hum Genet 59:323–336.
Lahiri DK, Nurnberger JIJ. 1991. A rapid non-enzimatic method for the
preparation of HMW DNA from blood for RFLP studies. Nucleic Acid Res
19:5444.
Lin SC, Jiang SD, Wu XD, Qian YP, Wang DX, Tang GM, Gu NF. 2000.
Association analysis between mood disorder and monoamine oxidase
gene. Am J Med Genet 96:12–14.
Preisig M, Bellivier F, Fenton BT, Baud P, Berney A, Courtet P, Hardy P,
Golaz J, Leboyer M, Mallet J, Matthey ML, Mouthon D, Neidhart E,
Nosten-Bertrand M, Stadelmann-Dubuis E, Guimon J, Ferrero F,
Buresi C, Malafosse A. 2000. Association between bipolar disorder and
monoamine oxidase A gene polymorphisms: Results of a multicenter
study. Am J Psychiatry 157:948–955.
Shih JC. 2004. Cloning, after cloning, knock-out mice, and physiological
functions of MAO A and B. Neurotoxicology 25:21–30.
Shih JC, Chen K. 1999. MAO-A and -B gene knock-out mice exhibit
distinctly different behavior. Neurobiology (Bp) 7:235–246.
Shih JC, Chen K, Ridd MJ. 1999. Role of MAO A and B in neurotransmitter
metabolism and behavior. Pol J Pharmacol 51:25–29.
Spielman RS, McGinnis RE, Ewens WJ. 1993. Transmission test for linkage
disequilibrium: the insulin gene region and insulin-dependent diabetes
mellitus (IDDM). Am J Hum Genet 52:506–516.
Syagailo YV, Stober G, Grassle M, Reimer E, Knapp M, Jungkunz G,
Okladnova O, Meyer J, Lesch KP. 2001. Association analysis of the
functional monoamine oxidase A gene promoter polymorphism in
psychiatric disorders. Am J Med Genet 105:168–171.
Документ
Категория
Без категории
Просмотров
2
Размер файла
66 Кб
Теги
associates, evidence, disorder, variant, genes, mao, bipolar
1/--страниц
Пожаловаться на содержимое документа