close

Вход

Забыли?

вход по аккаунту

?

Genetic association between schizophrenia and the DISC1 gene in the Scottish population.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 141B:155 –159 (2006)
Genetic Association Between Schizophrenia and
the DISC1 Gene in the Scottish Population
Feng Zhang,2 Jane Sarginson,1,2 Caroline Crombie,2 Nick Walker,3 David St. Clair,2 and Duncan Shaw1*
1
School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Aberdeen, Scotland, UK
Department of Mental Health, Institute of Medical Sciences, University of Aberdeen, Aberdeen, Scotland, UK
3
Ravenscraig Hospital, Greenock, Scotland, UK
2
Several lines of evidence support the involvement
of the disrupted in schizophrenia 1 (DISC1) gene
in schizophrenia susceptibility, including its original identification in a schizophrenia family with
a chromosome translocation, several genetic association studies, and functional characterization
of the gene product. In the present study, we have
genotyped multiple SNP and microsatellite markers in a large Scottish case-control sample. We
identified two SNPs and one microsatellite that
show significant association with schizophrenia.
The strongest association is with a haplotype of
SNPs rs751229 and rs3738401, located at the 50 end
of the gene; the C-A haplotype of these SNPs is
associated with a relative risk of schizophrenia of
5 in our population. We also observe association
with a microsatellite in intron 7, but no association with markers toward the 30 end of the gene.
The results are in broad agreement with those of
other genetic studies, but there are differences in
terms of the precise patterns of association. This
analysis further strengthens the candidacy of
DISC1 as a risk factor for schizophrenia in the
general population, and suggests that more intensive searching for causative variants is justified.
ß 2006 Wiley-Liss, Inc.
KEY WORDS:
Schizophrenia; DISC1; association; haplotype; Scotland
INTRODUCTION
There is little doubt that schizophrenia has a significant
genetic component. However, it has been difficult to identify
the predisposing genes. The approaches taken have included
family-based linkage, case-control and family-based association, cytogenetic abnormality studies, genome-wide scans, and
candidate gene studies. These have recently led to the
identification of plausible candidate genes including neuregulin [Stefansson et al., 2002, 2003], G72 and D-amino acid
oxidase [Chumakov et al., 2002], and dysbindin [Straub et al.,
Jane Sarginson and Feng Zhang made equal contributions to
this study.
Grant sponsor: University of Aberdeen.
*Correspondence to: Prof. Duncan Shaw, School of Medical
Sciences, Institute of Medical Sciences, University of Aberdeen,
Aberdeen AB25 2ZD, UK. E-mail: d.shaw@abdn.ac.uk
Received 22 July 2005; Accepted 10 November 2005
DOI 10.1002/ajmg.b.30274
ß 2006 Wiley-Liss, Inc.
2002]. For a recent review of schizophrenia genetics, see Owen
et al. [2005].
A Scottish family in which the balanced translocation
t(1;11)(q42;q14.3) cosegregates with major mental disorders
with maximum LOD ¼ 6.0 [St. Clair et al., 1990; Blackwood
et al., 2001], was the starting point for the identification of the
disrupted in schizophrenia 1 (DISC1) gene at 1q42.1 [Millar
et al., 2000a]. It encodes a protein of 854 amino acids, with no
obvious homology to other proteins of known function [Millar
et al., 2001]. The DISC1 locus is transcriptionally complex,
with a small, apparently non-translated gene DISC2 that
overlaps one of the exons of DISC1, and the TSNAX (TRAX, or
translin-associated factor X) gene that is involved in intergenic
splicing with DISC1 [Millar et al., 2000b].
Linkage and association studies with DISC1 have since then
been carried out worldwide. Linkage analysis in Finnish
families indicated 1q42 as a possible locus for schizophrenia
and the strongest linkage signal was obtained from marker
D1S2709, which is located within the DISC1 gene [Ekelund
et al., 2001, 2004]. Haplotype transmission analysis also
yielded positive evidence, but showed sex differences [Hennah
et al., 2003]. Positive associations have also been found in
North American studies [Hodgkinson et al., 2004; Callicott
et al., 2005]. Furthermore, Sachs et al. [2005] reported a
frameshift mutation at the extreme 30 end of exon 12 of DISC1
in a familial case of schizophrenia.
As well as the evidence from genetics, recent functional
studies of the cell biology of DISC1 also add to our understanding of how it may be involved in schizophrenia. Morris
et al. [2003] and Brandon et al. [2004] showed that it interacts
with several proteins of the cytoskeletal system and centrosome, including Nudel. The interaction with Nudel is through
the DISC1–Nudel–LIS1 complex, which is disrupted in the
form of DISC1 truncated by the translocation. The DISC1–
Nudel–LIS1 complex is also involved in the Reelin-related
signaling pathway [Assadi et al., 2003]. All of these phenomena
may be directly or indirectly associated with schizophrenia
or other cortical developmental disorders [Impagnatiello et al.,
1998; Guidotti et al., 2000; Hong et al., 2000; Eastwood
and Harrison, 2003]. Mutant DISC1 is proposed to contribute
to schizophrenia susceptibility by disrupting intracellular
transport, neurite modeling, and neuronal migration [Morris
et al., 2003; Ozeki et al., 2003]. These functional studies further strengthen the candidacy of this gene as a genetic risk
factor.
In the present study, we have analyzed a series of markers
along the length of the DISC1 gene for association with
schizophrenia in a Scottish case-control sample set. We
selected four SNPs, in intron 1, exon 2, intron 9, and exon 11,
and three microsatellites, in introns 7, 9, and 10, for genotyping
for association with schizophrenia. We analyzed the markers
individually and as haplotypes. The results provide further evidence of the involvement of the DISC1 gene in
schizophrenia.
156
Zhang et al.
MATERIALS AND METHODS
Patients and Controls
Unrelated schizophrenics (n ¼ 677; mean age 37, range 17–
66) of apparent European ancestry were recruited from the
Scottish population, all meeting the DSM IV criteria for
schizophrenia or schizoaffective disorder, and reassessed
using the OPCRIT system. Diagnosis was based on psychiatric
case note inspection and, when appropriate, through the
use of the lifetime version of the Schizophrenia and Affective
Disorders Schedule. Diagnosis was confirmed by consensus
of two senior psychiatrists. Control individuals (n ¼ 648;
mean age 36, range 18–58) of Scottish origin were obtained
from the Aberdeen blood Transfusion Service (ABTS).
The ABTS controls were not specifically screened for the
presence of schizophrenia but individuals on long-term medication do not donate blood, which excludes major psychiatric
illness.
The study was approved by Grampian Regional Ethics
Committee (LREC) and Multi-Regional Ethics Committee
(MREC), Scotland.
Genetic Markers
SNPs were obtained from public databases, and were genotyped as follows.
Marker rs821616 (exon 11) was genotyped by using dynamic
allele-specific hybridization [DASH; Prince and Brookes,
2001]. The primers were GAAGCTTGTCGATTGCTTATC and
TTATCCAGAGCCTACAG. The DASH probes were TTATCCAGTGCCTACAG (T allele) and TTATCCAGAGCCTACAG
(A allele).
Markers rs751229 (intron 1) and rs1984895 (intron 9) were genotyped by K-Biosciences (Cambridge, UK) using AmplifluorTM
chemistries. For rs751229, the allele-specific forward primers
were GAAGGTCGGAGTCAACGGATTAGGCATGAGCCACTGCGCCT and GAAGGTGACCAAGTTCATGCTGCATGAGCCACTGCGCCC, and the reverse primer was TTGAGCTATGATGGCTCTT.
For rs1984895, the allele-specific forward primers were
GAAGGTGACCAAGTTCATGCTTTTCATAGGGTGATAACCTATAGAACC and GAAGGTCGGAGTCAACGGATTGTTTCATAGGGTGATAACCTATAGAACT, and the reverse primer
was CTGCCATGTTGCTATAGCAGATGGATAA.
Marker rs3738401 (exon 2) was genotyped by restriction
digestion with enzyme DbeI. The forward primer was GGTCCCCCCAACCCCTCC, and the reverse primer CATCCCCGGAGCCGCTGC. The PCR reaction produces a 386 bp product
containing two DbeI restriction sites, one of which is constant,
and the other is cut when allele A is present, but uncut with
allele G. The results were scored by electrophoresis using a 4%
agarose gel.
Microsatellite markers were identified by inspection of the
genomic DNA sequence, and were given names reflecting the
nature of the repeat, and the position in the sequence relative
to an arbitrary origin (e.g., CA95066 is a (CA)n dinucleotide
repeat at position 95066). Their absolute positions on chromosome 1 in the UCSC Genome Browser (genome.cse.ucsc.edu;
May 2004 data release) and the PCR primers used were as
follows.
CA95066: position 228240406-228240690 (intron 7); primers TGCACAGACACGAATGTG and TAATGAGTGCAAGGAAGG.
AT157017: position 228395133-228395320 (intron 9); primers TGAAATCACCTTGGCCTATTG and ATTGCAAAGACCAGCCATCA.
CA212755: position 228444954-228445242 (intron 10); primers CGAGATGTCTTTCTGTGGGTG and CATGCCTCCCCCTCTCTAGTC.
These markers were genotyped by using fluorescently
labeled PCR primers and analysis on an ABI automated DNA
sequencer with appropriate size markers.
Statistical Analysis
For SNPs, association between disease and allele or haplotype frequencies was tested by Chi-square test. Haplotype
frequencies were estimated from genotype data using the
software Phase [Stephens et al., 2001], kindly made available
by the authors (www.stat.washington.edu/stephens/software.
html).
For microsatellites, the significance of allele distribution
differences between cases and controls was assessed using the
Clump Monte Carlo simulation method [Sham and Curtis,
1995].
RESULTS
Microsatellite Analysis
In a preliminary study using pooled DNA samples from
200 patients and controls, nine microsatellites distributed
among introns 4–12 of the DISC1 gene were tested for
association with schizophrenia (J. Sarginson, PhD thesis,
University of Aberdeen, 2003). Those showing evidence of
association were then tested by individual genotyping. The
marker CA95066 in intron 7 showed a significantly different
allele distribution between cases and controls (P < 0.01;
n ¼ 200 each). Markers AT157017 in intron 9, and CA212755
in intron 10, showed no significant association (P ¼ 0.211,
n ¼ 600; P ¼ 0.518, n ¼ 200, respectively).
Individual SNP Marker Genotyping
Four SNPs in the DISC1 gene were genotyped in this study:
rs751229, a C/T change in intron 1; rs3738401, a G/A change in
exon 2 causing a Arg/Gln substitution; rs1984895, a G/A
change in intron 9; and rs821616, an A/T change in exon 11
causing a Ser/Cys substitution.
The results of the analysis for genetic association with
schizophrenia are shown in Table I. Two of the polymorphisms
(rs751229 and rs3738401) showed statistically significant
association (P < 0.05) with schizophrenia, when analyzed by
genotype or by allele frequency. The remaining SNPs,
rs1984895 and rs821616, showed no significant association.
None of the genotype frequencies showed significant deviations from the Hardy–Weinberg expectation, but there was a
non-significant excess of heterozygotes for rs751229 among the
patient group.
Haplotype Analysis
The two SNPs that showed association with schizophrenia
(rs751229 and rs3738401) were found to be in linkage
disequilibrium with each other, in the patients (D ¼ 0.124;
r2 ¼ 0.277; P < 0.0001) and controls (D ¼ 0.06; r2 ¼ 0.079;
P < 0.0001). These two SNPs were used for haplotype estimation in both the case and control populations. The results are
shown in Table II. For the 2-marker haplotypes of rs751229
and rs3738401, there is an excess of C-A, and a deficit of T-A, in
the cases relative to the controls. For the haplotypes of the
three SNPs rs751229, rs3738401, and rs821616, those most
over-represented in the cases are C-A-G and C-A-A. For both 2and 3-marker haplotypes including rs751229 and rs3738401,
the overall association with disease was highly significant
(P < 1050). The addition of the third SNP to the haplotype
partitions the numbers in accordance with its allele frequencies; no new associations are revealed, and the relative risks
are little changed by the addition of the third SNP. The same
Association Between Schizophrenia and DISC1 Gene
TABLE I. Genotype and Allele Numbers and Frequencies for
Four SNPs in DISC1 in Schizophrenia Cases and Controls, and
P Values for Association With Disease
rs751229
TT
CT
CC
T
C
rs3738401
GG
GA
AA
G
A
rs1984895
GG
GA
AA
G
A
rs821616
AA
AT
TT
A
T
P
Cases
Controls
153 (0.32)
250 (0.52)
76 (0.16)
556 (0.58)
402 (0.42)
134 (0.40)
162 (0.49)
38 (0.11)
430 (0.64)
238 (0.36)
0.029
252 (0.43)
260 (0.45)
72 (0.12)
764 (0.65)
404 (0.35)
302 (0.53)
230 (0.40)
41 (0.07)
834 (0.73)
312 (0.27)
0.0006
337 (0.59)
204 (0.36)
30 (0.05)
878 (0.77)
264 (0.23)
344 (0.63)
177 (0.32)
27 (0.05)
865 (0.79)
231 (0.21)
0.434
317 (0.52)
241 (0.40)
48 (0.08)
875 (0.72)
337 (0.28)
294 (0.51)
223 (0.39)
61 (0.10)
811 (0.70)
345 (0.30)
0.293
0.010
0.0001
0.245
0.273
was found when the fourth SNP was added to the haplotype
(data not shown).
Two-marker haplotype frequencies were also estimated for
the pair rs1984895 and rs821616. These showed no significant
differences between the disease and control populations
(P ¼ 0.317).
DISCUSSION
Millar et al. [2000a] first reported that DISC1 was disrupted
by a chromosome translocation in a family with numerous
cases of schizophrenia and other mental illnesses. Linkage of
schizophrenia in Finnish families to D1S2709, which is located
within DISC1, was reported by Ekelund et al. [2001]. More
recently, Thomson et al. [2005] showed that SNPs in DISC1 are
associated with both schizophrenia and bipolar disorder in a
157
Scottish population. Thus, the role of DISC1 in schizophrenia is
supported by several lines of evidence. The main conclusions
from this study are that we find further evidence for the
involvement of DISC1 in genetic susceptibility to schizophrenia, that the important variants are most likely in the 50 region
of the gene, but that we have not established that any
particular variant is directly responsible. We also found
association with a microsatellite in intron 7, in the middle of
the gene, but no association with markers at the 30 end.
A Finnish study [Hennah et al., 2003] showed undertransmission of haplotypes containing the T allele of
rs751229 and the A allele of rs3734801 to affected individuals
in families. Hodgkinson et al. [2004], using a North American
patient cohort of white European origin, also reported undertransmission of a DISC1 haplotype including the A allele of
rs3738401. Using a case-control study design, we have found
that the T-A haplotype is less than half as frequent in
schizophrenics as it is in controls, which is in broad agreement
with the Finnish and American findings. Only one of these
SNPs, rs3738401, causes an amino-acid substitution (Gln/Arg
in exon 2). Rs751229 is in a non-conserved region of intron 1
and is unlikely to be functional. The relative risks of
schizophrenia associated with haplotypes of these two SNPs
are: C-A fivefold higher; T-A threefold lower; C-G and T-G,
little change. The effect of rs751229 is therefore dependent on
the presence of the A allele of rs3734801. There seems to be no
simple explanation for the effects of these SNPs. Presumably
they are acting as markers for other, nearby variants that are
causative. The only common non-synonymous SNP in the
database in this region of the gene is in exon 1 (rs3738400, ValGly). It is possible that this SNP, promoter variants, or other
undiscovered mutations are functionally involved in the
susceptibility to schizophrenia. The HapMap database for
linkage disequilibrium in the human genome (www.hapmap.
org) does not help to distinguish between these possibilities,
because different SNPs have been used. However, HapMap
does indicate that the 50 end of the gene, including the region 50
to exon 1, exon 1 itself, and part of intron 1 are within the same
LD block. Regions of the gene 30 to these markers are in
separate LD blocks.
Callicott et al. [2005] reported a significant over-transmission of the A allele at rs821616 close to the 30 end of the gene,
and a modest (non-significant) over-transmission of the C allele
of rs751229, to schizophrenics in a North American familybased study. Our study found no association with rs821616.
Thomson et al. [2005] analyzed a large number of SNPs from
DISC1 for association with schizophrenia and bipolar disorder,
TABLE II. Two- and Three-Marker Haplotype Estimated Frequencies and Relative Risks in Schizophrenia Cases and Controls for
Haplotypes Involving SNPs in DISC1 that Individually Show Association With Disease
SNPs
rs751229-rs3738401-rs1984895
rs751229-rs3738401
Haplotype
C-A-G
C-A-A
C-G-G
C-G-A
T-A-G
T-A-A
T-G-G
T-G-A
C-A
C-G
T-A
T-G
Frequency
in cases
0.208
0.065
0.106
0.036
0.064
0.010
0.391
0.119
0.269
0.151
0.079
0.501
Frequency
in controls
0.044
0.012
0.133
0.032
0.152
0.045
0.460
0.121
0.068
0.201
0.204
0.527
P value
19
6.3 10
8.3 107
0.136
0.764
2.2 107
0.00012
0.011
0.959
2.4 1022
0.017
4.5 1011
0.352
Relative risk
5.71
5.72
0.77
1.13
0.38
0.21
0.75
0.98
5.04
0.71
0.33
0.90
P values for the Chi-square test for overall association of haplotypes with disease are 3 1056 for the 3-marker haplotypes, and 2 1052 for the 2-marker
haplotypes.
158
Zhang et al.
including rs751229, rs3738401, and rs821616. In their study,
none of these three SNPs was associated with schizophrenia,
but they instead found association with SNPs in intron 4, exon
6, and intron 6, closer to the central part of the gene. These
discrepancies may be the result of different haplotype
structures and/or heterogeneity of causative alleles in different
populations. Sachs et al. [2005] have found a frameshift
mutation in DISC1 in an American schizophrenia family; further screening studies on a large scale might reveal more such
novel mutations.
The biochemical interactions of DISC1 have been studied by
Morris et al. [2003]. The C- and N-terminal regions of the
protein interact with different protein partners in the cell. In
the truncated DISC1 protein predicted to occur in patients
with the translocation [Millar et al., 2000a], the C-terminal
portion of the protein, which interacts with ATF5 and NUDEL,
would be lost. However, in the present study, the association is
with markers in the 50 region of the gene, corresponding to the
N-terminal portion. This part of DISC1 interacts with MAP1A,
the light chain of the MAP microtubule-associated protein. The
latter is involved in microtubule networks in mature neurons,
influencing cell shape and intracellular transport. If there are
variants in DISC1 that alter the N-terminal domain of the
protein’s structure or function, in LD with the markers
rs751229 or rs3738401, it could be that the effect on schizophrenia is mediated via the interaction of DISC1 and MAP1A.
Alternatively (or additionally), variants in the promoter region
might adversely affect gene expression, leading to the increase
in susceptibility to schizophrenia. Kockelkorn et al. [2004]
reported promoter polymorphisms in DISC1 that initially
showed association with schizophrenia in a Japanese population, but that this association failed to be replicated in a second
sample. Further genetic and cell-biological studies are needed
to address these possibilities.
Sherbatich T, Riazanskaia N, Rogaev E, Raeymaekers P, Aerssens
J, Konings F, Luyten W, Macciardi F, Sham PC, Straub RE, Weinberger
DR, Cohen N, Cohen D. 2002. Genetic and physiological data implicating
the new human gene G72 and the gene for D-amino acid oxidase in
schizophrenia. Proc Natl Acad Sci USA 99:13675–13680.
Eastwood SL, Harrison PJ. 2003. Interstitial white matter neurons express
less reelin and are abnormally distributed in schizophrenia: Towards an
integration of molecular and morphologic aspects of the neurodevelopmental hypothesis. Mol Psychiatry 8:821–831.
Ekelund J, Hovatta I, Parker A, Paunio T, Varilo T, Martin R, Suhonen J,
Ellonen P, Chan G, Sinsheimer JS, Sobel E, Juvonen H, Arajarvi R,
Partonen T, Suvisaari J, Lonnqvist J, Meyer J, Peltonen L. 2001.
Chromosome 1 loci in Finnish schizophrenia families. Hum Mol Genet
10:1611–1617.
Ekelund J, Hennah W, Hiekkalinna T, Parker A, Meyer J, Lonnqvist J,
Peltonen L. 2004. Replication of 1q42 linkage in Finnish schizophrenia
pedigrees. Mol Psychiatry 9:1037–1041.
Guidotti A, Auta J, Davis JM, Di-Giorgi-Gerevini V, Dwivedi Y, Grayson DR,
Impagnatiello F, Pandey G, Pesold C, Sharma R, Uzunov D, Costa E.
2000. Decrease in reelin and glutamic acid decarboxylase67 (GAD67)
expression in schizophrenia and bipolar disorder: A postmortem brain
study. Arch Gen Psychiatry 57:1061–1069.
Hennah W, Varilo T, Kestila M, Paunio T, Arajarvi R, Haukka J, Parker A,
Martin R, Levitzky S, Partonen T, Meyer J, Lonnqvist J, Peltonen L,
Ekelund J. 2003. Haplotype transmission analysis provides evidence of
association for DISC1 to schizophrenia and suggests sex-dependent
effects. Hum Mol Genet 12:3151–3159.
Hodgkinson CA, Goldman D, Jaeger J, Persaud S, Kane JM, Lipsky RH,
Malhotra AK. 2004. Disrupted in schizophrenia 1 (DISC1): Association
with schizophrenia, schizoaffective disorder, and bipolar disorder. Am J
Hum Genet 75:862–872.
Hong SE, Shugart YY, Huang DT, Shahwan SA, Grant PE, Hourihane JO,
Martin ND, Walsh CA. 2000. Autosomal recessive lissencephaly with
cerebellar hypoplasia is associated with human RELN mutations. Nat
Genet 26:93–96.
ACKNOWLEDGMENTS
Impagnatiello F, Guidotti AR, Pesold C, Dwivedi Y, Caruncho H, Pisu MG,
Uzunov DP, Smalheiser NR, Davis JM, Pandey GN, Pappas GD, Tueting
P, Sharma RP, Costa E. 1998. A decrease of reelin expression as a
putative vulnerability factor in schizophrenia. Proc Natl Acad Sci USA
95:15718–15723.
We thank the University of Aberdeen for Ph.D. studentship
support to J.S. Thanks are also due to all those who contributed
blood samples for DNA analysis, and to clinical colleagues for
help with ascertainment and diagnosis.
Kockelkorn TT, Arai M, Matsumoto H, Fukuda N, Yamada K, Minabe
Y, Toyota T, Ujike H, Sora I, Mori N, Yoshikawa T, Itokawa M.
2004. Association study of polymorphisms in the 50 upstream region
of human DISC1 gene with schizophrenia. Neurosci Lett 368:41–
45.
REFERENCES
Millar JK, Wilson-Annan JC, Anderson S, Christie S, Taylor MS, Semple
CA, Devon RS, Clair DM, Muir WJ, Blackwood DH, Porteous DJ. 2000a.
Disruption of two novel genes by a translocation co-segregating with
schizophrenia. Hum Mol Genet 9:1415–1423.
Assadi AH, Zhang G, Beffert U, McNeil RS, Renfro AL, Niu S, Quattrocchi
CC, Antalffy BA, Sheldon M, Armstrong DD, Wynshaw-Boris A, Herz J,
D’Arcangelo G, Clark GD. 2003. Interaction of reelin signaling and Lis1
in brain development. Nat Genet 35:270–276.
Blackwood DH, Fordyce A, Walker MT, St Clair DM, Porteous DJ, Muir WJ.
2001. Schizophrenia and affective disorders-cosegregation with a
translocation at chromosome 1q42 that directly disrupts brainexpressed genes: Clinical and P300 findings in a family. Am J Hum
Genet 69:428–433.
Brandon NJ, Handford EJ, Schurov I, Rain JC, Pelling M, Duran-Jimeniz B,
Camargo LM, Oliver KR, Beher D, Shearman MS, Whiting PJ. 2004.
Disrupted in Schizophrenia 1 and Nudel form a neurodevelopmentally
regulated protein complex: Implications for schizophrenia and other
major neurological disorders. Mol Cell Neurosci 25:42–55.
Callicott JH, Straub RE, Pezawas L, Egan MF, Mattay VS, Hariri AR,
Verchinski BA, Meyer-Lindenberg A, Balkissoon R, Kolachana B,
Goldberg TE, Weinberger DR. 2005. Variation in DISC1 affects
hippocampal structure and function and increases risk for schizophrenia. Proc Natl Acad Sci USA 102:8627–8632.
Chumakov I, Blumenfeld M, Guerassimenko O, Cavarec L, Palicio M,
Abderrahim H, Bougueleret L, Barry C, Tanaka H, La Rosa P, Puech A,
Tahri N, Cohen-Akenine A, Delabrosse S, Lissarrague S, Picard FP,
Maurice K, Essioux L, Millasseau P, Grel P, Debailleul V, Simon AM,
Caterina D, Dufaure I, Malekzadeh K, Belova M, Luan JJ, Bouillot M,
Sambucy JL, Primas G, Saumier M, Boubkiri N, Martin-Saumier S,
Nasroune M, Peixoto H, Delaye A, Pinchot V, Bastucci M, Guillou S,
Chevillon M, Sainz-Fuertes R, Meguenni S, Aurich-Costa J, Cherif D,
Gimalac A, Van Duijn C, Gauvreau D, Ouellette G, Fortier I, Raelson J,
Millar JK, Christie S, Semple CA, Porteous DJ. 2000b. Chromosomal
location and genomic structure of the human translin-associated factor
X gene (TRAX; TSNAX) revealed by intergenic splicing to DISC1, a gene
disrupted by a translocation segregating with schizophrenia. Genomics
67:69–77.
Millar JK, Christie S, Anderson S, Lawson D, Hsiao-Wei Loh D, Devon RS,
Arveiler B, Muir WJ, Blackwood DH, Porteous DJ. 2001. Genomic
structure and localisation within a linkage hotspot of Disrupted In
Schizophrenia 1, a gene disrupted by a translocation segregating with
schizophrenia. Mol Psychiatry 6:173–178.
Morris JA, Kandpal G, Ma L, Austin CP. 2003. DISC1 (Disrupted-InSchizophrenia 1) is a centrosome-associated protein that interacts with
MAP1A, MIPT3, ATF4/5 and NUDEL: Regulation and loss of interaction
with mutation. Hum Mol Genet 12:1591–1608.
Owen MJ, Craddock N, O’Donovan MC. 2005. Schizophrenia: Genes at last?
Trends Genet 21:518–525.
Ozeki Y, Tomoda T, Kleiderlein J, Kamiya A, Bord L, Fujii K, Okawa M,
Yamada N, Hatten ME, Snyder SH, Ross CA, Sawa A. 2003. Disruptedin-Schizophrenia-1 (DISC-1): Mutant truncation prevents binding to
NudE-like (NUDEL) and inhibits neurite outgrowth. Proc Natl Acad Sci
USA 100:289–294.
Prince JA, Brookes AJ. 2001. Towards high-throughput genotyping of SNPs
by dynamic allele-specific hybridization. Expert Rev Mol Diagn 1:352–
358.
Sachs NA, Sawa A, Holmes SE, Ross CA, Delisi LE, Margolis RL. 2005. A
frameshift mutation in Disrupted in Schizophrenia 1 in an American
Association Between Schizophrenia and DISC1 Gene
family with schizophrenia and schizoaffective disorder. Mol Psychiatry
10:758–764.
Sham PC, Curtis D. 1995. Monte Carlo tests for associations between disease
and alleles at highly polymorphic loci. Ann Hum Genet 59:97–105.
St. Clair D, Blackwood D, Muir W, Carothers A, Walker M, Spowart
G, Gosden C, Evans HJ. 1990. Association within a family of a balanced
autosomal translocation with major mental illness. Lancet 336:13–
16.
Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, Brynjolfsson J, Gunnarsdottir S, Ivarsson O, Chou TT,
Hjaltason O, Birgisdottir B, Jonsson H, Gudnadottir VG, Gudmundsdottir E, Bjornsson A, Ingvarsson B, Ingason A, Sigfusson S, Hardardottir H, Harvey RP, Lai D, Zhou M, Brunner D, Mutel V, Gonzalo A,
Lemke G, Sainz J, Johannesson G, Andresson T, Gudbjartsson D,
Manolescu A, Frigge ML, Gurney ME, Kong A, Gulcher JR, Petursson H,
Stefansson K. 2002. Neuregulin 1 and susceptibility to schizophrenia.
Am J Hum Genet 71:877–892.
159
Stefansson H, Sarginson J, Kong A, Yates P, Steinthorsdottir V, Gudfinnsson E, Gunnarsdottir S, Walker N, Petursson H, Crombie C, Ingason A,
Gulcher JR, Stefansson K, St Clair D. 2003. Association of neuregulin 1
with schizophrenia confirmed in a Scottish population. Am J Hum Genet
72:83–87.
Stephens M, Smith N, Donnelly P. 2001. A new statistical method for
haplotype reconstruction from population data. Am J Hum Genet
68:978–989.
Straub RE, Jiang Y, MacLean CJ, Ma Y, Webb BT, Myakishev MV, HarrisKerr C, Wormley B, Sadek H, Kadambi B, Cesare AJ, Gibberman A,
Wang X, O’Neill FA, Walsh D, Kendler KS. 2002. Genetic variation in the
6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene,
is associated with schizophrenia. Am J Hum Genet 71:337–348.
Thomson PA, Wray NR, Millar JK, Evans KL, Hellard SL, Condie A, Muir
WJ, Blackwood DH, Porteous DJ. 2005. Association between the TRAX/
DISC locus and both bipolar disorder and schizophrenia in the Scottish
population. Mol Psychiatry 10:657–668.
Документ
Категория
Без категории
Просмотров
4
Размер файла
65 Кб
Теги
population, associations, disco, genes, genetics, schizophrenia, scottish
1/--страниц
Пожаловаться на содержимое документа