close

Вход

Забыли?

вход по аккаунту

?

Mitochondrial DNA diversity in 17thЦ18th century remains from Tenerife (Canary Islands).

код для вставкиСкачать
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 127:418–426 (2005)
Mitochondrial DNA Diversity in 17th–18th Century
Remains From Tenerife (Canary Islands)
Nicole Maca-Meyer,1 Vicente M. Cabrera,1 Matilde Arnay,2 Carlos Flores,3 Rosa Fregel,1
Ana M. González,1 and José M. Larruga1*
1
Departamento de Genética, Universidad de La Laguna, 38271 La Laguna, Tenerife, Spain
Departamento de Prehistoria e Historia Antigua, Universidad de La Laguna, 38271 La Laguna, Tenerife, Spain
3
Unidad de Investigación, Hospital Universitario Nuestra Sen̄ora de Candelaria, 38010 Tenerife, Spain
2
KEY WORDS
Canary Islands; aDNA; mtDNA; haplotypes; admixture
ABSTRACT
Mitochondrial DNA sequences and restriction fragment length polymorphisms were retrieved
(with >80% efficiency) from a 17th–18th century sample
of 213 teeth from Tenerife. The genetic composition of
this population reveals an important ethnic heterogeneity. Although the majority of detected haplotypes are
of European origin, the high frequency of sub-Saharan
African haplotypes (15.63%), compared to that of the
present-day population (6.6%), confirms the importance
of the Canary Islands in the black slave trade of that
epoch. The aboriginal substrate, inferred from the U6b1
haplotypes (8.59%), has also decreased due to European
input. Finally, the presence of Amerindian lineages
(1.5%) reveals that the Canary Islands have also received
genetic flow from America. Am J Phys Anthropol 127:
418–426, 2005. ' 2005 Wiley-Liss, Inc.
Due to their geographic position off the northwest
African coast (latitudes 278370 and 298240 ), the Canary Islands played a crucial role in the discovery and
colonization of the Americas, as they were the last
harbor before the transoceanic voyages (Fig 1).
Moreover, a large number of Canarians were forced
to embark, contributing to the settlement of the New
World. At that time, these Canary Islanders were a
very heterogeneous ethnic population, formed by
Europeans from very different countries, Berber and
sub-Saharan African slaves, and aborigines, all of
them contributing in different degrees (Flores et al.,
2001). Today, the presence of specific sub-Saharan
and North African mitochondrial DNA (mtDNA) and
Y-chromosome haplotypes attest to the impact of
these African contributions in the Islands (Rando et
al., 1999; Flores et al., 2001, 2003). Furthermore, the
detection of some Canarian-specific mtDNA haplotypes, belonging to the U6 sub-haplogroup, in Cuban
samples demonstrate that the Canarian migrations
to the Americas were genetically influential (Torroni
et al., 1999).
The need for architectonic repairs in Concepción
Church, located in Santa Cruz, the harbor and
actual capital of the Tenerife Island, enabled us to
obtain human remains of the population of this
locality of the 17th–18th centuries. At this time,
the European colonization of the New World was
at its peak, and Santa Cruz was the most significant harbor linking the Canary Islands to the
Americas. The knowledge of the genetic composition of this historic population and its comparison
with the present-day population could shed light
on the degree of European and African impact on
the indigenous inhabitants of the islands, and
could unravel past undetected influences with the
Americas. Besides immigration, the aboriginal population suffered important changes, such as drastic
diminution in size due to epidemics and emigrations forced by imposition or famine.
In order to determine the genetic composition of
this historic population at a molecular level, the
remains were analyzed using mtDNA sequences
from the first segment of the hypervariable region
(HVRI) and diagnostic restriction-fragment length
polymorphisms (RFLP). Since the excavated graves
are from under a sacred floor, there is the possibility
of obtaining a biased estimate of the real population.
However, it is well-documented that, in contrast to
other places, all deceased people in Santa Cruz of
that period, including slaves, were buried in the
Concepción Church (Sanz de Magallanes, 2001).
#
2005 WILEY-LISS, INC.
MATERIALS AND METHODS
Samples
Two hundred and eight teeth, belonging to 33
grave plots, were sampled from Concepción Church
Grant sponsor: Ministerio de Ciencia y Tecnologia; Grant number:
BMC2001-3511; Grant sponsor: Gobierno de Canarias; Grant number:
COF2002-015.
*Correspondence to: José M. Larruga, Departamento de Genética,
Facultad de Biologı́a, Universidad de La Laguna, 38271 Tenerife,
Spain. E-mail: jlarruga@ull.es
Received 31 January 2003; accepted 15 June 2004.
DOI 10.1002/ajpa.20148
Published online 3 February 2005 in Wiley InterScience (www.
interscience.wiley.com).
17TH–18TH CENTURY MTDNA IN TENERIFE
419
Fig. 1. Geographic distribution of Canarian Archipelago,
indicating sampled localities. C, Concepción Church; SB, Ermita
de San Blas. Arrows indicate Moorish and black slave trade
routes.
Fig. 2. Distribution of grave plots analyzed in this study.
(Fig. 2), and five additional teeth were from the
Ermita de San Blas in Candelaria (approximately
15 km from Santa Cruz). Both samples are dated
to the 17th–18th centuries, and were therefore considered a sole population. Care was taken to choose
teeth that did not show fractures. Furthermore, in
order to avoid sampling repetitions, whenever possible, only one type of tooth was chosen by grave,
preferentially upper or lower left canines, depending on the availability in each grave. When diverse
types of teeth had to be used per grave, differences
in sex and sequence of the samples were established, in order to make use of the maximum number of them. Jaw fragments were available in 15
cases, so that independent extractions from single
individuals were prepared in separate areas and
by different researchers in consecutive years.
Extraction
Prior to extraction, the surface of the tooth was
thoroughly washed with 15% HCl, rinsed with
ultraviolet (UV)-treated ddH2O, and dried under a
UV lamp for 5 min on each side. Each tooth was
then placed between two sterilized metal plates
and crushed with a hammer, and the pieces were
introduced into sterile 15-ml tubes (Costar). DNA
was extracted according to a modified silica-based
protocol (Höss and Pääbo, 1993). Briefly, 1–2 ml of
a commercial guanidine thiocyanate solution
(DNAzol1; Chomczynski et al., 1997) were added
to each tube and incubated, at room temperature,
for 3–4 days. After this incubation, the supernatant was passed through commercial silica columns
(QIAquick1, Qiagen; Yang et al., 1998), according
to the manufacturer’s recommendations.
Amplification
For mtDNA HVRI analyses, seven primer pairs
were designed in order to amplify overlapping fragments, with sizes ranging from 82–124 bp (Table
1). HVRI fragments were PCR-amplified in 50-ml
reactions using 7–9 ml of DNA extract in 1 PCR
buffer (16.6 mM (NH4)SO4, and 67 mM Tris-HCl,
pH 8.8), 2.5–4 mM MgCl2, 0.2 mM dNTPs, 5 pmol
of each primer, and 1.75 U of Taq DNA polymerase
(Ecogen/Bioline). Reactions were submitted to 35
amplification cycles with each one consisting of
10-sec steps, with denaturation at 948C, annealing
at the corresponding temperature (Table 1), and
extension at 728C. Three negative controls were
included in each amplification in order to increase
the probability of detecting contamination. PCR
products were separated in 6% polyacrylamide gels
(PAGE) and visualized with ethidium bromide
staining. Positive amplifications were purified
using ammonium acetate (Maniatis et al., 1982).
Four additional primer pairs were designed to
enable restriction fragment length analysis (RFLP) of
the four most common African (Chen et al., 1995) and
European (Torroni et al., 1996) haplogroupspecific sites (Table 1). RFLP fragments were
PCR-amplified in 10-ml reactions using 2 ml of DNA
extract. Reactions were submitted to 35 amplification
cycles with each one consisting of 10-sec steps, with
denaturation at 948C, annealing at the corresponding
temperature (Table 1), and extension at 728C. Amplifications were directly digested in 15-ml reaction
volumes with the restriction enzyme according to the
manufacturer’s recommendations. These digestions
were completely loaded in 6% PAGE, stained with
ethidium bromide, and visualized under UV.
For sex determination, primers were designed to
amplify a small region in intron 1 of the amelogenin gene, giving products of 60 and 66 bp for the
X and Y chromosomes, respectively (Table 1). PCR
was carried out in 10-ml reactions using 6 ml DNA
extract. Reactions were submitted to 40 amplification cycles with each one consisting of 10-sec steps,
with denaturation at 948C, annealing at 458C, and
extension at 728C. PCR products were completely
loaded in 8% PAGE, stained with ethidium bromide, and visualized under UV.
420
N. MACA-MEYER ET AL.
TABLE 1. List of primers used in this study, annealing temperature, and product size
Primer sequence (50 ?30 )
HVRI
L1F CTCCACCATTAGCACCCAAAGC
H1R AGCGGTTGTTGATGGGTGAGTC
L2F GGAAGCAGATTTGGGTACCAC
H2R TGGTGGCTGGCAGTAATGTACG
L3F CACCCATCAACAACCGCTAT
H3R TGATGTGGATTGGGTTTTTATGTA
L4FN GGTACCATAAATACTTGACCACCTG
H4RN TTTGGAGTTGCAGTTGATGTG
L5F CAAGCAAGTACAGCAATCAACC
H5R CTGTTAAGGGTGGGTAGGTTTG
L6FN CTCCAAAGCCACCCCTCAC
H6RN GGGACGAGAAGGGATTTGAC
L7F AGCCATTTACCGTACATAGCACA
H7R TGATTTCACGGAGGATGGTG
RFLP
L3557 GCTCTCACCATCGCTCTTCT
H3623 GGCTAGGCTAGAGGTGGCTA
L42101 CCACTCACCTAGCATTACTTA
H42271 ATGCTGGAGATTGTAATGGGT
L6977 GGCCTGACTGGCATTGTATTA
H7052 TGATGGCAAATACAGCTCCT
L12253 ATGCCCCCATGTCTAACAAC
T92 ATTACTTTTATTTGGAGTTGCACCAAGATT
Amelogenin
Amel-A3 CCCTGGGCTCTGTAAAGAATAGTG
Amel-C AATRYGGACCACTTGAGAAAC
R ¼ A/G; Y ¼ C/T
1
2
3
Temperature (8C)
Product size (bp)
50
112
50
82
46
112
50
117
46
103
50
108
46
103
45
105 (57 þ 48)
52
59 (31 þ 28)
45
115 (100 þ 1570 þ 30 þ 15)
48
105 (75 þ 30)
45
60/66
Maca-Meyer et al., 2001.
Torroni et al., 1996.
Sullivan et al., 1993.
Cloning and sequencing
PCR products were ligated into pGEM-T vectors
(Promega). Colonies were plated on selective IPTG/
X-gal agar plates, and white colonies were selected.
Several clones (at least three) were sequenced for
each fragment until an unambiguous sequence was
obtained. PCR fragments were directly sequenced
using the same primer pairs as for the amplification, and clones were sequenced using M13 universal primers. All primers were labeled with g32-ATP,
and the fmol1 DNA Cycle Sequencing System
(Promega) was used for sequencing.
Prevention of contamination
All DNA extractions and PCR setups were performed in a dedicated laboratory physically separated from the main Department of Genetics. This
laboratory was constantly irradiated with UV
lamps and frequently cleaned with bleach. All sample manipulations were performed in a laminar
flow cabinet, with dedicated pipettes and sterile filter tips (Tip One, Star Lab). Solutions were commercially acquired when possible; otherwise, they
were autoclaved twice and UV-treated. Laboratory
coats, face shields, hats, and sterile gloves were
used at all times. All metallic material was sterilized in an oven at 2008C for at least 2 hr.
In the first stages of the study, the effectiveness
of the decontamination process before the DNA
extraction was verified in the following way: a
tooth was immersed in a solution containing
chicken DNA and then submitted to the decontamination protocol. Another tooth was processed in
the same way but without decontaminating the
surface. Both cases were submitted to PCR amplifications, using specific primers that amplify chicken
mtDNA cyt b. In the first case, no amplification
products were obtained, while in the second, a
400-bp product was observed after the amplification. To monitor contamination during the extraction process, an extraction blank was processed
together with each tooth. PCR contamination was
monitored by means of three negative controls in
each reaction.
Statistical analysis
Sequences were sorted into haplogroups according to Richards et al. (2000). Haplotype diversity
was calculated as k/n, where k is the number of
haplotypes and n the sample size. Population differentiation tests (Raymond and Rousset, 1995)
were computed by means of the Arlequin 2000
computer program (Schneider et al., 2000). Admixture estimates were calculated with four different
estimators. ADMIX.PAS (kindly provided by
Dr. Long) was used to estimate mL (Long, 1991).
ADMIX 2.0 (Dupanloup and Bertorelle, 2001), was
used to calculate mY (Bertorelle and Excoffier,
1998). Both mL and mY were based on haplogroup
frequencies, considering each haplogroup as an
17TH–18TH CENTURY MTDNA IN TENERIFE
allele of the same locus. The third estimate is
based on the geographic origin (G.O.) of haplogroups. We considered the lineages belonging to
haplogroups L1, L2, and L3 as containing subSaharan African influence, U6 lineages as containing North African influence, and the rest as being
of European origin. A derivative of this method
would include the founder haplotypes, those supposedly present in the aboriginal population (Rando
et al., 1999), as a North African influence. The last
estimator is based on the analysis of shared
lineages (L.S.) between populations. To accomplish
this, the Concepción sequences were compared
with published and unpublished sequences from
the Iberian Peninsula, North Africa, and subSaharan Africa as the most probable parental
populations. Due to the large Iberian sample size,
the number of shared sequences was divided by
the number of different sequences present in each
parental population.
RESULTS AND DISCUSSION
From a total of 213 extractions, 169 sequences
and/or RFLPs were obtained from 147 individuals,
corresponding to an extraction efficiency of 80%. Of
these, 19 were discarded due to the low number of
amplified fragments, which made them impossible
to classify into haplogroups. Six individuals were
able to be classified into haplogroups because of
RFLP information, but were not taken into account
for haplotype studies. Contamination in the extraction blank was only detected in one case, and this
extraction was discarded. In total, 122 individuals
were able to be used for haplotype analysis. There
were no inconsistencies in the 15 replicates, as all
extractions gave the same sex, HVRI sequence,
and RFLP pattern. The sexual proportion was
estimated as 53.3% males and 46.7% females,
based on a sample of 60 teeth. PCR contamination
was sporadic and could be overridden by repeating
the amplifications using new aliquots of PCR solutions.
Haplotype classification and distribution
Seventy-one different haplotypes (Table 2) were
found in the 122 individuals analyzed in this historical sample, which accounts for a haplotype
diversity of 58%. Of these, 13 (18.3%) were considered unique to the historical sample, though some
of these motifs are found, with some variants, in
other populations. Most of these unique sequences
belong to the African sub-haplogroup L1c, which
could reflect an insufficient number of African
populations in the comparative database. The most
abundant haplogroup was H, encompassing 37% of
the sample (Table 3). Two sequences (1.56%) were
unequivocally of American origin, belonging to
haplogroups A and C, corroborating the important
nexus that the Canary Islands have had in the
colonization of the Americas. Lineages belonging to
421
African haplogroups L1, L2, and L3 comprised
15.63% of the sample, a much higher frequency
than currently found in the Islands (Rando et al.,
1999). Subgroup U6a, of North African assignation,
was found at a frequency of 1.56%, while U6b1,
the specific Canarian subgroup, made up a total of
8.59%.
Thirty-eight percent of the lineages found in our
sample (Table 2) are present in the contemporary
populations of Tenerife and/or the Canary Islands
(Rando et al., 1999). Another 18% of matches are
specifically European, and are absent in the Canaries and North Africa. Of these, approximately
10% are found in the Iberian Peninsula, and the
rest of the matches are located in other areas of
the continent, predominantly on the Atlantic coast.
Regarding haplotypes belonging to macro-haplogroup L, only three (4.2%) are limited to the subSaharan African region, two of them located in the
Gulf of Guinea (J.M. Larruga, personal communication) and the third in Mozambique (Pereira et al.,
2001), the rest are distributed along different
North African and European populations. The U6
lineages, considered a North African influence,
account for 5.6% of the haplotypes. However, half
of them belong to the Canarian-specific subgroup
U6b1, which has still not been detected in Africa
(Rando et al., 1998). The reciprocal influence
between the Archipelago and the Americas can
also be observed with haplotype matches. Two
Amerindian haplotypes were found in the historical sample, one of which is still present in the
Islands. In a similar vein, Canarian-specific U6b1
haplotypes were detected in Cuba (Torroni et al.,
1999). U6a lineages were observed in Brazil
(Alves-Silva et al., 2000), but they do not match
those found in North Africa, Portugal, Spain, or
the Canary Islands. Matches of European haplotypes between the historical sample and American
populations are restricted to the basal motifs of the
most abundant haplogroups. With respect to subSaharan African lineages, an L2a sequence (223
278 294 309 390) was found in Brazil (Alves-Silva
et al., 2000), and an L3b sequence (124 223 278
362) in Mexico (Green et al., 2000), that match
with the historical sample. This corroborates the important role that the Canarian Archipelago played in
the route of the African slave trade to the Americas.
Haplogroup frequencies
Haplogroup frequencies of the historical sample
and present-day populations of Tenerife and the
Canary Islands are shown in Table 3. Overall, the
historical sample shows high frequencies for haplogroups H and J*, and African macro-haplogroup
L, compared to those found in present populations.
Similarly, low frequencies are found for haplogroups V, T1, T2, U5b, and K. However, an exact
test of differentiation (Raymond and Rousset,
422
N. MACA-MEYER ET AL.
TABLE 2. HVRI sequences and RFLP status of individuals analyzed in this study, together with populations
in which these lineages were detected
Haplogroup/haplotype1
N2
H
CRS
126
129
145
153
168
189
248
260
290
292
311
316
362
093 311
273 311
304 311
311 357
093 263 311
Total H
V*
298 335
Total V*
19
2
2
1
1
3
2
1
1
1
1
2
1
2
1
1
1
1
1
44
1
1
HVR
CRS
129
311
183C 189
Total HVR*
6
1
3
2
12
RFLP3
7025AluI ()
13
1
1
1
3
2
1
1
1
1
1
2
TF
CAN
NAf
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
1
1
1
SSA
*
*
EU
NE
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
AM
*
*
*
*
7025AluI (þ)
1
*
7025AluI (þ)
12308Hinf I ()
4216NlaIII ()
6
1
3
1
*
*
*
*
*
*
*
A
183C 189 223 290 319 362
Total A
1
1
*
C
223 298 325 327
Total C
J*
069 126
069 126 311
069 126 318C
069? 126 153 285T 290
J1
069? 126 163 261
Total J
T*
126 286 295 296 311
T2
126 294 296 304
T3
126 292 294
T5
126 153 292 294
Total T
1
1
5
2
1
1
1
10
4216NlaIII (þ)
3
1
1
1
4216NlaIII (þ)
1
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
1
2
2
1
6
4216NlaIII (þ)
1
4216NlaIII (þ)
1
W
223 292
223 292 295
223 292 362
Total W
1
1
1
3
X
093 189 223 278
1
183C 189 223 278?
1
7025AluI (þ)
3592HpaI ()
7025AluI (þ)
12308Hinf I ()
3592HpaI ()
4216NlaIII ()
*
(continued)
423
17TH–18TH CENTURY MTDNA IN TENERIFE
TABLE 2. (Continued)
1
Haplogroup/haplotype
093 189 223 274 278 356
Total X
2
RFLP3
1
3
12308HinfI ()
N
TF
CAN
NAf
SSA
EU
NE
*
*
AM
I
129? 223? 391
Total I
U3
189 343? 390
U5a*
192 270 294 334
U5a1
114A 192? 270 294?
129 192 256? 270
U5b
189 270
189 270 362
U6a
172 219 278?
092 172? 219? 278
U6b1
163 172 219 311
092 163 172 219 311
Total U
1
1
1
*
1
*
1
1
*
1
1
1
1
10
1
19
*
12308Hinf I (þ)
1
1
12308Hinf l (þ)
6
1
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
K
093 224 311
Total K
L1b
126 187 188A 189 223 264?
270? 278? 311?
093 126 187 189 223 264
270 278 293? 311?
L1c
129? 187 189 223 251 294 311
129 189 223 231 274 278 311
129 187 189 223 278 286A 292
294 311 360?
129 187 189 265C 278 286A 292
294 311 360?
017 129 163 187? 189 223 278
293 294 301 311 360
L2a
223 278 294 309 390
L2b
129 213 278 390
213 223 278 390
L2c
223 278 390
L3
223
223 311
L3b
124 166 223 309
124 223 278 362
223 278 311 362?
124 223 278 311 362
L3ela
185 223 311 327
Total L
1
1
1
3592HpaI (þ)
1
1
*
1
*
3592HpaI (þ)
1
1
1
1
1
1
1
1
1
1
1
1
3592HpaI (þ)
1
3592HpaI (þ)
1
1
*
*
*
*
*
*
*
2
2
*
*
*
*
*
1
20
*
*
*
*
*
*
1
1
1
1
1
*
3592HpaI ()
1
1
*
*
1
*
*
*
Mutations were designated as their position according to Anderson et al. (1981) minus 16000.
Absolute frequency.
3
Number of individuals per haplotype that share specified RFLP status. This number may differ from absolute frequency, since limited amount of DNA did not always allow RFLP typing. CRS, Cambridge Reference Sequence (Anderson et al., 1981); TF, Tenerife
(Rando et al., 1999); CAN, Canary Islands (Rando et al., 1999); NAf North Africa (Rando et al., 1998; Thomas et al., 2002; Larruga,
personal communication); SSA, sub-Saharan Africa (Mateu et al., 1997; Monsalve and Hagelberg, 1997; Watson et al., 1997; Rando
et al., 1998; Pereira et al., 2001); EU, Europe (Crespillo et al., 2000; Richards et al., 2000; Larruga et al., 2001; Gonzátez et al.,
2003); NE, Near East (Richards et al., 2000; Thomas et al., 2002); AM, America (Torroni et al., 1999; Alves-Silva et al., 2000). In
bold, mutations corresponding to the basal motif. In italics, mutations not detected by sequencing, but that were added because they
belong to a similar haplotype detected in neighboring populations.
* Matches between historical sample and current populations from broad geographical regions.
2
424
N. MACA-MEYER ET AL.
TABLE 3. Haplogroup frequencies for historical population
compared with those of present-day population of Tenerife
and Canary Islands (Rando et al., 1999)
Haplogroup
CRS
H (-CRS)
HVR
V*
A
C
J*
J1
J1a
J2
T*
T1
T2
T3
T5
W
X
I
U*
U2
U3
U4
U5*
U5a*
U5a1
U5a1a
U5b
U6a
U6b
K
M1
L1b
L1c
L2
L3
Total
Historic
19
29
12
1
1
1
9
1
(14.85%)
(22.68%)
(9.38%)
(0.78%)
(0.78%)
(0.78%)
(7.03%)
(0.78%)
Tenerife
Canary Islands
14 (19.17%)
8 (10.96%)
10 (13.70%)
3 (4.11)
44 (14.67%)
21 (7.00%)
48 (16.00%)
7 (2.33%)
1 (0.33%)
1 (0.33%)
15 (5.00%)
2 (0.67%)
3 (1.00%)
1 (0.33%)
2 (0.67%)
10 (3.33%)
11 (3.67%)
13 (4.33%)
1 (0.33%)
3 (1.00%)
8 (2.67%)
3 (1.00%)
8 (2.67%)
2 (0.67%)
1 (1.37%)
1 (1.37%)
2 (2.74%)
1 (1.37%)
1 (0.78%)
2
2
1
3
3
1
2
(1.56%)
(1.56%)
(0.78%)
(2.34%)
(2.34%)
(0.78%)
(1.56%)
3 (4.11%)
3 (4.11%)
3 (4.11%)
2 (2.74%)
1 (1.37)
1 (1.37%)
1 (0.78%)
1 (1.37%)
1 (0.78%)
2 (1.56%)
2
2
11
1
(1.56%)
(1.56%)
(8.59%)
(0.78%)
2
5
4
9
(1.56%)
(3.91%)
(3.13%)
(7.03%)
128
2 (2.74%)
1 (1.37%)
3 (4.11%)
4 (5.48%)
4 (5.48%)
1
2
6
3
2
7
3
39
12
1
6
(0.33%)
(0.67%)
(2.00%)
(1.00%)
(0.67%)
(2.33%)
(1.00%)
(13.00%)
(4.00%)
(0.33%)
(2.00%)
2 (2.74%)
3 (4.11%)
4 (1.33%)
10 (3.33%)
73
300
1995) revealed that these differences are not statistically significant (P = 0.112 0.024).
In synthesis, the historical sample presents
lineages that account for the major influences
recorded in the peopling and colonization of the
Islands. In this way, the U6b1 North African
lineages would represent the initial aborigine
substrate, as it has not been detected in presentday North African populations. U6a lineages, wellrepresented in African populations, could have
reached the Islands as a consequence of the Moorish slave trade after the European Conquest. The
large number of European lineages reflect the
impact of the colonization of the Islands, mainly by
Spaniards and Portuguese. Finally, the high number of sub-Saharan African lineages present in the
sample reveals the importance of the black slave
trade in the Islands.
Admixture estimates
The above-mentioned continental influences
detected in the historical Canarian population can
be quantified by means of admixture algorithms.
TABLE 4. Admixture estimates (%) in historical population
of Tenerife, and present-day populations of Tenerife
and Canary Islands1
Iberian
Peninsula
mY
Historic
Tenerife
Canary Islands
Canary Islands2
Mean
mL
Historic
Tenerife
Canary Islands
Canary Islands3
Mean
L.S.
Historic
Tenerife
Canary Islands
Canary Islands3
Mean
Mean
North
Africa
Sub-Saharan
Africa
22.7
29.6
16.8
34.0
6.9
14.0 8.0
3.5 3.0
50.9 19.0
82.9 12.8
58.1 21.7
36.4
57.1 8.4
45.5 23.4
17.1 12.8
39.1 21.2
45.2
36.7 5.8
3.6 8.1
2.8 3.7
18.4
6.2 3.6
13.5
28.1
25.6
34.8
25.5 3.9
39.8 7.5
62.4
59.5
60.7
41.3
56.0 4.3
50.8 5.8
24.1
12.4
13.7
23.9
18.5 2.7
9.4 3.8
56.3
50.8
22.9
17.0
36.7
22.7
29.6
16.8
35.0
8.5
43.7
49.2
77.1
69.0
59.8
negative contribution. Calculations were redone using two parental populations: Iberian Peninsula and North Africa.
2
Dupanloup and Bertorelle, 2001.
3
Pinto et al., 1996.
1
The problem of estimating these proportions is that
the parental populations, namely the Iberian
Peninsula, North Africans, and sub-Saharan Africans, show a considerable amount of gene flow
between themselves. For this reason, we used several methods for calculating these proportions:
those based on haplogroup frequencies, and those
based on the geographical assignation of lineages
(Table 4). The mY and mL estimators yield a major
European contribution, followed by North African
and sub-Saharan African contributions. However,
the L.S. estimator gives a major North African
contribution (62.4%), followed by the sub-Saharan
African (24.1%) and the European contribution
(13.5%). Finally, the G.O. estimator gives a minimum estimate of the North African contribution
(21%), as only U6 lineages (and founder haplotypes) were taken into account. Naturally, other
sequences would have accompanied these lineages,
but as these are shared with other populations,
they were not considered of specific North African
influence. For this reason, the G.O. estimator was
eliminated from subsequent calculations.
The demographic evolution of this population
can be assessed by comparison with the admixture
values obtained for the present-day population of
Tenerife (Rando et al., 1999). Whereas the mY estimator does not show marked differences, mL and
L.S. clearly show an important decrease of the subSaharan and North African maternal lineages in
the present population, in favor of the European
ones (Table 4). Proportions obtained for the whole
Canary Islands sample (Rando et al., 1999) are
also different, depending on the estimator used.
17TH–18TH CENTURY MTDNA IN TENERIFE
Whereas mY emphasizes the North African component, mL shows a major European input, and L.S.
stresses the minor sub-Saharan African flow. Other
mtDNA admixture results of the Canary Islands
were published (Pinto et al., 1996; Dupanloup and
Bertorelle, 2001), but they were based on notably
smaller sample sizes than those used in this work
(Table 4). If we take all these data as independent
estimations of the maternal contributions to the
Canarian population, we obtain coarse means giving values of 50% North African, 40% European,
and 10% sub-Saharan (Table 4).
In conclusion, from the mtDNA point of view, the
historical population of Tenerife does not show
significant differences from the present-day population, the majority of lineages being of European
origin, reflecting the impact of this contingent in the
colonization of the Islands. The Canarian-specific
subgroup U6b1, most probably of aboriginal origin,
was also detected in a considerable proportion of the
sample. Likewise, the presence of U6a lineages could
reflect a minor Moorish slave influence on the Canary Islands. African lineages belonging to macrohaplogroup L are present in high frequency, attesting to the importance of the ‘‘black slave trade’’ in
that historical period. Finally, the presence of Amerindian haplotypes, although in low frequency,
demonstrate the importance of the Archipelago in
the transoceanic voyages to the Americas.
ACKNOWLEDGMENTS
We thank W. Salo for his technical advice and critical reading of the manuscript. This study was
supported by grants BMC2001-3511 from Ministerio
de Ciencia y Technologia and COF2002-015 from
Gobierno de Canarias to V.M.C.
LITERATURE CITED
Alves-Silva J, da Silva Santos M, Guimarães PEM, Ferreira ACS,
Bandelt HJ, Pena SDJ, Ferreira Prado V. 2000. The ancestry of
Brazilian lineages. Am J Hum Genet 67:444–461.
Anderson S, Bankier AT, Barrell BG, Bruijn MHLDE, Coulson
AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F,
Schreier PH, Smith AJH, Staden R, Young IG. 1981. Sequence
and organization of the human mitochondrial genome. Nature
290:457–465.
Bertorelle G, Excoffier L. 1998. Inferring admixture proportions
from molecular data. Mol Biol Evol 15:1298–1311.
Chen YS, Torroni A, Excoffier L, Santachiara-Benerecetti AS,
Wallace DC. 1995. Analysis of mtDNA variation in African
populations reveals the most ancient of all continent-specific
haplogroups. Am J Hum Genet 57:133–149.
Chomczynski P, Mackey K, Drews R, Wilfinger W. 1997.
DNAzol1: a reagent for the rapid isolation of genomic DNA.
Biotechniques 22:550–553.
Crespillo M, Luque JA, Paredes M, Fernández R, Ramı́rez E,
Valverde JL. 2000. Mitochondrial DNA sequences for 118
individuals from northeastern Spain. Int J Legal Med 114:
130–132.
Dupanloup I, Bertorelle G. 2001. Inferring admixture proportions from molecular data: extension to any number of parental populations. Mol Biol Evol 18:672–675.
Flores C, Larruga JM, González AM, Hernández M, Pinto FM,
Cabrera VM. 2001. The origin of the Canary Island aborigines
425
and their contribution to the modern population: a molecular
genetics perspective. Curr Anthropol 42:749–755.
Flores C, Maca-Meyer N, Pérez JA, González AM, Larruga JM,
Cabrera VM. 2003. A predominant European ancestry of
paternal lineages from Canary Islanders. Ann Hum Genet
67:138–152.
González AM, Brehm A, Pérez JA, Maca-Meyer N, Flores C,
Cabrera VM. 2003. Mitochondrial DNA affinities at the
Atlantic fringe of Europe. Am J Phys Anthropol 120:
391–404.
Green LD, Derr JN, Knight A. 2000. mtDNA affinities of the
peoples of north-central Mexico. Am J Hum Genet 66:989–998.
Höss M, Pääbo S. 1993. DNA extraction from Pleistocene bones
by a silica-based purification method. Nucleic Acids Res 21:
3913–3914.
Larruga JM, Dı́ez F, Pinto FM, Flores C, González AM.
2001. Mitochondrial DNA characterization of European
isolates: the Maragatos from Spain. Eur J Hum Genet 9:
708–716.
Long JC. 1991. The genetic structure of admixed populations.
Genetics 127:417–428.
Maca-Meyer N, González AM, Larruga JM, Flores C, Cabrera
VM. 2001. Major genomic mitochondrial lineages delineate
early human expansions. BMC Genet 2:13.
Maniatis T, Fritsch EF, Sambrook J. 1982. Molecular cloning: a
laboratory manual. Cold Spring Harbor: Cold Spring Harbor
Laboratory.
Mateu E, Comas D, Calafell F, Pérez-Lezaun A, Abade A,
Bertranpetit J. 1997. A tale of two islands: population history
and mitochondrial DNA sequence variation of Bioko and São
Tomé, Gulf of Guinea. Ann Hum Genet 61:507–518.
Monsalve MV, Hagelberg E. 1997. Mitochondrial DNA polymorphisms in Carib people of Belize. Proc R Soc Lond [Biol]
264:1217–1224.
Pereira L, Macaulay V, Torroni A, Scozzari R, Prata MJ,
Amorim A. 2001. Prehistoric and historic traces in the
mtDNA of Mozambique: insughts into the Bantu expansions
and the slave trade. Ann Hum Genet 65:439–458.
Pinto F, González AM, Hernández M, Larruga JM, Cabrera VM.
1996. Genetic relationship between the Canary Islanders and
their African and Spanish ancestors inferred from mitochondrial DNA sequences. Ann Hum Genet 60:321–330.
Rando JC, Pinto F, González AM, Hernández M, Larruga JM,
Cabrera VM, Bandelt HJ. 1998. Mitochondrial DNA analysis
of northwest African populations reveals genetic exchanges
with European, Near Eastern, and sub-Saharan populations.
Ann Hum Genet 62:531–550.
Rando JC, Cabrera VM, Larruga JM, Hernández M, González
AM, Pinto F, Bandelt HJ. 1999. Phylogeographic patterns of
mtDNA reflecting the colonization of the Canary Islands. Ann
Hum Genet 63:413–428.
Raymond M, Rousset F. 1995. An exact test of population differentiation. Evolution 49:1280–1283.
Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V,
Rengo C, Sellito D, Cruciani F, Kivisild T, Villems R, Thomas
M, Rychkov S, Rychkov O, Rychkov Y, Golge M, Dimitrov D,
Hill E, Bradley D, Romano V, Cali F, Vona G, Demaine A,
Papiha S, Triantaphyllidis C, Stefanescu G. 2000. Tracing
European founder lineages in the Near Eastern mtDNA pool.
Am J Hum Genet 67:1251–1276.
Sanz de Magallanes JM. 2001. In memoriam. Enterramientos
en la Parroquia Matriz de La Concepción, V Centenario
(1499–1999) de la Parroquia de la Concepción de Santa Cruz
de Tenerife. Canildo Insular de Tenerife.
Schneider S, Roessli D, Excoffier L. 2000. Arlequin version 2000:
a software for population genetics data analysis. Geneva:
Genetics and Biometry Laboratory, University of Geneva.
Sullivan KM, Mannuci A, Kimpton CP, Gill P. 1993. A rapid
and quantitative DNA sex test: fluorescence-based PCR analysis of X-Y homologous gene amelogenin. Biotechniques 15:
636–641.
Thomas MG, Weale ME, Jones AL, Richards M, Smith A, Redhead N, Torroni A, Scozzari R, Gratrix F, Tarekegn A, Wilson
JF, Capelli C, Bradman N, Goldstein D. 2002. Founding
426
N. MACA-MEYER ET AL.
mothers of Jewish communities: geographically separated
Jewish groups were independently founded by very few
female ancestors. Am J Hum Genet 70:1411–1420.
Torroni A, Huoponen K, Francalacci P, Petrozzi M, Morelli L,
Scozzari R, Obinu D, Savontaus ML, Wallace DC. 1996. Classification of European mtDNAs from an analysis of three
European populations. Genetics 144:1835–1850.
Torroni A, Cruciani F, Rengo C, Sellito D, López-Bigas N,
Rabionet R, Govea N, López de Munain A, Sarduy M,
Romero L, Villamar M, del Castillo I, Moreno F, Estivill X,
Scozzari R. 1999. The A1555G mutation in the 12S rRNA
gene of mtDNA: recurrent origins and founder events in
families affected by sensorineural deafness. Am J Hum
Genet 65:1349–1358.
Watson E, Forster P, Richards M, Bandelt HJ. 1997. Mitochondrial footprints of human expansions in Africa. Am J Hum
Genet 61:691–704.
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR. 1998.
Improved DNA extraction from ancient bones using silicabased spin columns. Am J Phys Anthropol 105:539–543.
Документ
Категория
Без категории
Просмотров
3
Размер файла
135 Кб
Теги
islands, diversity, dna, remains, 17thц18th, tenerife, century, canard, mitochondria
1/--страниц
Пожаловаться на содержимое документа