close

Вход

Забыли?

вход по аккаунту

?

Characteristics of two genes encoding proteins with an ADAM-type metalloprotease domain which are induced during the molting periods in Bombyx mori.

код для вставкиСкачать
Archives of Insect Biochemistry and Physiology 59:91–98 (2005)
Characteristics of Two Genes Encoding Proteins With
an ADAM-Type Metalloprotease Domain, Which Are
Induced During the Molting Periods in Bombyx mori
Manabu Ote,1 Kazuei Mita,2 Hideki Kawasaki,3 Masahiko Kobayashi,1 and Toru Shimada1*
By microarray analyses, we identified two genes (BmADAMTS-1 and BmADAMTS-like) encoding a protein, which are induced
during the pupal ecdysis in the wing discs of Bombyx mori; these genes are homologous to ADAMTS family members (a
disintegrin and metalloproteinase domain, with thrombospondin type-1 repeats). A complete metal-binding motif of the
ADAM-type metalloprotease domain (HEXXHXXGXXHD) was contained in both amino acid sequences. However, thrombospondin
type 1 (TSP-1) repeats were observed only in BmADAMTS-1. The BmADAMTS-1 gene was expressed in the hemocyte and
midgut of the larvae at day 2 of wandering stage (W2), and strongly induced during the pupal ecdysis in the hemolymph. The
BmADAMTS-like gene was expressed in the epithelial tissues of the larvae at W2, and had expression peaks slightly later than
the BmADAMTS-1 gene. Our results indicate that BmADAMTS-1 and BmADAMTS-like may cleave the extracellular matrix
(ECM) in the degenerating and remodeling tissues during the molting periods. Arch. Insect Biochem. Physiol. 59:91–98,
2005. © 2005 Wiley-Liss, Inc.
KEYWORDS: metamorphosis; metalloproteinase; extracellular matrix; Bombyx mori
INTRODUCTION
ADAMTSs comprise a family of 19 genes in the
Homo sapiens genome and three in the Drosophila
melanogaster genome (Porter et al., 2005). ADAMTSs
have an ADAM-like protease domain; however, they
are different from ADAMs in that these proteins
have a varying number of thrombospondin type 1
(TSP-1) repeats at the C-terminus, which are responsible for binding to ECM (Kuno and Matsushima, 1998; Tucker, 2004). Additionally, unlike
the ADAMs, these proteins lack transmembrane
domains and are, therefore, secreted into the ex1
Department of Agricultural and Environmental Biology, University of Tokyo, Tokyo, Japan
2
National Institute of Agrobiological Sciences, Owashi, Tsukuba, Ibaraki, Japan
3
Faculty of Agriculture, Utsunomiya University, Utsunomiya, Tochigi, Japan
tracellular space. ADAMTSs are most studied in
humans because the genes have been shown to be
the cause of some diseases. ADAMTS-1, ADAMTS4, and ADAMTS-5 are believed to mediate the loss
of cartilage aggrecan in arthritis (Tortorella et al.,
2000). ADAMTS-13 mutations cause inherited
thrombocytopenic purpura (Levy et al., 2001). Mutations in ADAMTS-2 cause a severe inherited skin
fragility (Ehlers-Danlos syndrome type VIIC) that
was first observed in a variety of animals and
termed dermatosparaxis (Nusgens et al., 1992;
Colige et al., 1999). Additionally, ADAMTS-1 was
reported to have an important role in ovulation
Contract grant sponsor: BRAIN; Contract grant sponsor: MEXT; Contract grant numbers: 16011209 and 00150012; Contract grant sponsor: MAFF-NIAS (Insect
Technology), Japan.
M. Ote’s present address is Laboratory of Genetics, School of Science and Engineering, Waseda University, 2-7-5 Higashifushimi, Nishi-tokyo, Tokyo 202-0021,
Japan.
*Correspondence to: Dr. Toru Shimada, Department of Agricultural and Environmental Biology, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657,
Japan. E-mail: shimada@ss.ab.a.u-tokyo.ac.jp
Received 21 November 2004; Accepted 1 March 2005
© 2005 Wiley-Liss, Inc.
DOI: 10.1002/arch.20059
Published online in Wiley InterScience (www.interscience.wiley.com)
92
Ote et al.
body at metamorphosis in Sarcophaga peregriana
(Yano et al., 1995).
Here, we report two genes (BmADAMTS-1 and
BmADAMTS-like) encoding proteins that are homologous to ADAMTS family members. The genes
were identified by microarray experiments that examined the expression profiles in the wing discs
of Bombyx mori during pupal ecdysis (Fig. 1). We
report the structural characterization and expression analyses of the genes.
(Russell et al., 2003). In mouse, mutations in
ADAMTS-20 cause a pigment defect (Rao et al.,
2003), and, in C. elegans, adt-1 is expressed
throughout the rays in the male tail and involved
in the morphogenesis of the male copulatory organs (Kuno et al., 2002). In all cases, it is considered that the ADAMTSs exert their functions
through cleavage of ECMs. Some of the ADAMTSs
were verified to cleave ECMs, including aggrecan,
von Willebrand factor, procollagen I, and versican
(Kuno et al., 2000; Fernandes et al., 2001; Somerville et al., 2003).
For the degeneration and remodeling of tissues
during metamorphosis, ECM surrounding the tissues must be partially or fully degraded. Site-specific cleavage of Drosophila collagen IV in the wing
discs is observed when the basement lamina disappears (Fessler et al., 1993). The identified protease that is involved in the cleavage of ECM during
metamorphosis is cathepsin L of Sarcophaga peregriana. Substrate proteins of cathepsin L were identified in the basement membranes of the leg discs,
wing discs, fat body, and brain (Homma and
Natori, 1996). The cathepsin B in the pupal
hemocytes participates in decomposition of the fat
5’RACE was performed to identify the 5’-end
of the cDNA clone wdS20127 using the SMART
RACE cDNA Amplification Kit (Clonetech Laboratories, Palo Alto, CA) with the total RNA of wing
discs from wandering-stage day-3 (W3) larvae of
the p50 strain. The 5’-end of the cDNA was PCRamplified in an amplification reaction (50 µl) containing 2.5 µl of 5’-RACE-Ready cDNA, 0.2 mM
deoxyribonucleotides, 10 µM of a gene-specific
primer 5’- CCTCTCGAGGTAAGGTGTGG (reverse,
+1,260 to +1,241), 10 µM of the Universal Primer
Fig. 1. Expression profiles of BmADAMTS-1 (heS30795)
and BmADAMTS-like (wdS20127) genes obtained from the
microarray experiments (Ote et al., 2004). In the microarray experiments, gene expression patterns in the wing
discs from day 4 of 5th instar (V4) to day 0 of pupal stage
(P0) were compared to those in the reference RNA, which
was a mixture of total RNAs from each time point. In this
figure, amount of the mRNAs are indicated as the logtransformed expression ratio to those in the reference RNA
(details in Ote et al., 2004).
MATERIALS AND METHODS
5’RACE
Archives of Insect Biochemistry and Physiology
BmADAMTS-1 and BmADAMTS-Like Genes in B. mori
Mix supplied in the kit, and 2 U of ExTaq DNA
polymerase Hot Start Version (TaKaRa, Japan).
Temperature cycling was carried out at 94°C for 3
min followed by five cycles of 30 s at 94°C and 3
min at 72°C, five cycles of 30 s at 94°C, 30 s at
70°C, and 3 min at 72°C, and 20 cycles of 30 s at
94°C, 30 s at 68°C, and 3 min at 72°C. The PCR
products were cloned into a pGEM-T Easy Vector
(Promega, Madison, WI), and the nucleotide sequences were determined.
cDNA Library Screening
Full-length cDNA clones corresponding to the
cDNA clone heS30795 were isolated from a fulllength cDNA library of wing discs. The cDNA library was plated on ten LB/Amp plates, where
approximately 300 colonies were grown on a
plate. After overnight incubation, 2 ml of PBS was
added, and the colonies were suspended. The
plate containing the sequence of the heS30795
clone was identified by PCR reactions using ExTaq
DNA polymerase as described above, except that
1 µl of the E. coli suspension and primers 5’TGAATTTGTGTGGGCTTCTG (forward, +2,499 to
+2,518) and 5’-TTGCATCGTAAAATCTTTTGAA (reverse, +3,173 to +3,152). The identified suspension was plated again, and positive colonies were
identified by colony hybridization using the AlkPhos Direct Labeling and Detection System (Amersham Biosciences) according to the manufacturer’s
instructions.
Northern Blot Analysis
Total RNA was extracted from the larvae of
Kinshu x Showa strain using the TRIzol reagent
(Invitrogen, La Jolla, CA). Subsequent processes
were performed following the procedures described previously (Suzuki et al., 1998). Probes
for BmADAMTS-1 and BmADAMTS-like were amplified using cDNA from the larvae at W3 with PCR
primers 5'-TGAATTTGTGTGGGCTTCTG (forward,
+2,499 to +2,518) / 5'-CAAGCGTTACAGCAATATTTC (reverse, +2,984 to +2,964) and 5’-TACCCCGAGATATTGGTCATTG (forward, +1,060 to +1,081)
June 2005
93
/ 5'-CTGCCGTCATGGACCGCTCC (reverse, +1,580
to +1,561), respectively.
Quantitative Reverse Transcriptase-PCR Analysis
The tissues from the larvae, pupae, and adults
were homogenized in the TRIzol reagent (Invitrogen) and the total RNAs were precipitated using isopropyl alcohol. The RNAs (5 µg) were treated by
DNase I (Invitrogen) and reverse-transcribed with
SuperScript II reverse transcriptase (Invitrogen) using an oligo(dT) primer. Real-time PCR was performed with an ABI Prism 7000 Sequence Detector
using the SYBR Green PCR Master Mix (Applied
Biosystems, Foster City, CA). The primers used for
amplification were 5’-CGAAGCACGTCAACTGTCCAT
(forward, +1,941 to +1,961) and 5’-CGTTCGCGCAGTGCAA (reverse, +2,006 to +1,991) for the
BmADAMTS-1 gene and 5’-CGACATGGGCAAGTATCTGTTC (forward, +1,305 to +1,326) and 5’GATCGCAACGGCAATATCG (reverse, +1,368 to
+1,350) for the BmADAMTS-like gene. The PCR
reactions were performed in triplicate for each time
point along with measurements of the Bomby mori
elongation factor 2 (BmEF2) gene. Data were analyzed according to the comparative Ct method (Applied Biosystems protocols) and normalized to the
BmEF2 gene.
DDBJ Submission
The BmADAMTS-1 and BmADAMTS-like cDNAs
have been deposited in the DDBJ database (accession number AB194270 and AB194271, respectively).
RESULTS
The microarray analyses revealed that the two
genes predicted to encode proteins homologous
to ADAMTS family members were induced during
the pupal ecdysis in Bombyx mori (Fig. 1). The
microarray analyses also revealed that the genes
were induced by culturing the wing discs of the
5th instar larvae with 20-hydroxyecdysone (Ote et
al., 2004). The cDNA clones used for the construc-
94
Ote et al.
Fig. 2. A: Domain organization of BmADAMTS-1, BmADAMTS-like, and human ADAMTS-16 analyzed using the
InterPro database. Signal peptides were identified by the
SignalP program. The numbers indicate amino acid positions for start or end of the domain. The putative furin
cleavage sites (RX(K/R)R) indicated by arrows are RYRR335
of BmADAMTS-like and RHKR279 of human ADAMTS-16.
B: Sequence alignment of ADAM-type metalloprotease
domains for BmADAMTS-1, BmADAMTS-like, human
ADAMTS-2, and human ADAMTS-5. The alignment was
made using ClustalW and BoxShade 3.21 (http://www.
ch.embnet.org/software/BOX_form.html). Amino acid residues identical or similar among three or more sequences
are dark- or gray-shaded, respectively. Asterisks indicate
important residues of a metal binding. The methionine
residue of the Met turn is indicated by an arrow.
tion of the microarrays contained only partial sequences of the genes. Sequencing of the full-length
cDNA clones isolated from a full-length cDNA library of the wing discs revealed the predicted
amino acid sequence of BmADAMTS-1. The gene
encoded a protein of 981 amino acid residues. The
most homologous gene in a public database was
human ADAMTS-3, which is also named proArchives of Insect Biochemistry and Physiology
BmADAMTS-1 and BmADAMTS-Like Genes in B. mori
95
Fig. 3. Genome-wide search of ADAMTS-like sequences
in Bombyx mori. The Bombyx whole-genome shotgun contigs
were downloaded from ftp://ftp.ddbj.nig.ac.jp/database2/
wgs/BAAB.gz (Mita et al., 2004) and searched by TBLASTN
at a local machine using the metalloproteinase domain
(280–495 aa.) of the human ADAMTS-16 (Q8TE57) as the
query. The contig sequences showing E values less than 1.0
were aligned. The contigs corresponding to BmADAMTS-1
and BmADAMTS-like genes are indicated by bold lines.
The Drosophila genome database was also searched at http:/
/flybase.net/blast/
collagen I N-propeptidase (Fernandes et al., 2001).
The protein had an ADAM-type metalloprotease
domain containing a metal-binding motif, which
is necessary for the activity of metalloproteases, and
thrombospondin repeats (TSP-1), which have roles
in anchoring at ECM (Fig. 2). A TBLASTN search
revealed that the B. mori genome contained 9 sequences that have amino acid sequence similarities with the ADAM-type metalloprotease domain
of human ADAMTS-16 (Fig. 3).
Northern blot analysis revealed that the BmADAMTS-1 gene was strongly expressed in the
hemocytes and the midgut of W2 larvae. Weaker
expressions were detected in the epidermis, wing
discs, ovaries, silk gland, and fat body (Fig. 4A).
Quantitative real-time PCR analysis revealed that
the BmADAMTS-1 gene is strongly induced during the pupal ecdysis. Weaker induction was detected during the 4th ecdysis and the pupal stage.
These inductions were detected along with the rise
of the ecdysteroid concentration in the hemolymph
(Fig. 5A).
5’ RACE revealed the predicted amino acid sequence of the BmADAMTS-like gene. The genes
encoded a protein of 693 amino acid residues. The
most homologous gene in a public database was
Drosophila LP02257p, which is homologous to the
members of the ADAMTS family. The identified
protein contained a signal sequence and a putative furin cleavage site for the removal of the
prodomain, which ends in a dibasic motif. The protein had a zinc-binding motif, which is necessary
Fig. 4. Northern blot analysis of the BmADAMTS-1 (A)
and BmADAMTS-like (B). Total RNAs were isolated at W2.
Ribosomal RNAs were used
as a control. FB; fat body, SG;
silk gland, OV; ovary, HC;
hemocyte, WD; wing disc,
EP; epidermis, MG; midgut.
June 2005
96
Ote et al.
Fig. 5. Real-time quantitative RT-PCR analysis of BmADAMTS-1 and BmADAMTS-like mRNA. Total RNAs were
isolated from hemocytes for the detection of BmADAMTS1 mRNA (A) and epidermis for BmADAMTS-like mRNA
(B). The expression values were normalized to those of
BmEF2 and log-transformed to a base of two. An average
of values at day 2 of 4th instar (IV2) was transformed to
zero. Average expression values of three measurements at
each time point are presented with an error bar representing a standard error.
for the activity of metalloproteases (Fig. 2B). Although the catalytic domain had homology to
ADAMTS family members, the BmADAMTS-like
gene lacked TSP-1 repeats, which are responsible
for binding to ECM (Fig. 2A).
Northern blot analysis revealed that the BmADAMTS-like gene was expressed in the epidermis
and the wing discs of W2 larvae. A weaker expression was detected in the midgut (Fig. 4B). Quantitative real-time PCR analysis revealed that the
BmADAMTS-like gene is induced during the 4th
ecdysis, pupal ecdysis, pupal stage, and eclosion
(Fig. 5B).
contains 9 sequences with similarities to the ADAMtype metalloprotease domain of ADAMTS family
members. Those correspond to at least five genes,
although it is not yet revealed whether those genes
have TSP-1 repeats. These data may indicate that B.
mori and D. melanogaster genomes have different
compositions of proteins that have the ADAM-type
metalloprotease domain of the ADAMTS family.
BmADAMTS-1 had an ADAM-type metalloprotease domain and four TSP-1 repeats. The
metalloprotease domain contained a complete
metal-binding motif and the subsequent Met turn,
which comprises the zinc-binding environment of
the reprolysin family, including ADAM and snake
metalloproteinases. This indicates the possibility
that BmADAMTS-1 is an active protease. TSP-1 repeats are responsible for binding to ECM. The
presence of TSP-1 repeats in BmADAMTS-1 indicated that the proteins are captured by ECM.
BmADAMTS-1 does not contain a furin cleavage
site between the presumptive prodomain and the
metalloprotease domain. Furin-like convertases
are considered to be responsible for cleaving the
prodomains of ADAMTS family members that
contain a furin cleavage site (Rodriguez-Manzaneque et al., 2000). This cleavage happens typically during intracellular transport to the cellular
surface (Cal et al., 2001). Therefore, BmADAMTS-
DISCUSSION
ADAMTSs are a family of metalloproteases with
a variable number of TSP-1 repeats at the C-terminal region. In H. sapiens, 19 members of the family have been identified. The D. melanogaster
genome contains 4 genes, and the C. elegans genome contains 5 genes, which encode proteins
with strong similarities to the ADAM-type metalloprotease domain of ADAMTS family members. The
ortholog of BmADAMTS-like is LP02257p in D.
melanogaster. Meanwhile, the D. melanogaster genome lacks that of BmADAMTS-1 though the mammalian genomes keep it. The B. mori genome
Archives of Insect Biochemistry and Physiology
BmADAMTS-1 and BmADAMTS-Like Genes in B. mori
1 may not be activated intracellularly but at the
cell surface.
A strong expression of the BmADAMTS-1 gene
was detected in the hemocytes and the midgut, and
a weak expression was detected in other tissues. Insect hemocytes have been observed to adhere to several tissues during metamorphosis (Nardi and
Miklasz, 1989). Therefore, it is possible that the expressions of the BmADAMTS-1 gene observed in several tissues were due to the hemocytes that had
adhered to the tissues. Further analysis, including
in situ detection of the mRNAs, is needed to reveal
the cells expressing the BmADAMTS-1 gene. It is suggested that the hemocytes contribute to the remodeling of ECM in wing discs during metamorphosis
(Nardi and Miklasz, 1989). Considering the fact that
the components of ECM are degraded during metamorphosis (Fessler et al., 1993), it could be speculated that the hemocytes secrete proteases, which
adhere to ECM of the hemocytes or are directly secreted onto ECM, the targets of the proteases.
The BmADAMTS-like gene had a metal-binding motif of the metalloprotease domain. The most
homologous proteins in D. melanogaster were
LP02257p and CG9850, whose functions have not
been revealed. Although the mRNA structures of
the Drosophila genes indicate that they are isoforms
encoded by a gene, the residues for metal binding
were included only in LP02257p. Like CG9850,
the most homologous protein in Anopheles gambie
(ENSANGP00000014071) lacked the residues for
metal binding. However, the genome sequence in
its intron contained the residues surrounded by
well-conserved amino acid residues among D.
melanogaster LP02257p and BmADAMTS-like (Holt
et al., 2002). Therefore, it seems that either isoforms are present that have not been identified, or
its predicted exon/intron structure is not correct
and the sequence encoding the metal-binding domain in its predicted intron should be a coding
region.
The BmADAMTS-like gene did not have a TSP1 repeat that is responsible for binding to ECM.
The reported protein homologous to ADAMTS family members, which lack TSP-1 repeats, is MIG-17
in C. elegans. MIG-17 is secreted from the muscle
June 2005
97
cells and localizes in the basement membranes of
the gonad. MIG-17 regulates the migration of the
distal tip cells (DTCs) during gonadogenesis. The
substrate protein of MIG-17 has not been identified; however, it is considered that the components
of the ECM are degraded by MIG-17 for migration
of the DTCs (Nishiwaki et al., 2000). Absence of a
TSP-1 repeat would indicate that BmADAMTS-like
is secreted from the epithelial tissues into the
hemolymph. As MIG-17, BmADAMTS-like may
degrade ECM proteins in basement membranes of
degenerating or remodeling tissues.
ADAMTS family members are considered to degrade ECM proteins. During the molting periods,
degenerating or remodeling tissues would show sequential breakdown and reconstruction of their
ECM. Therefore, several extracellular proteases must
be involved in these processes. This study revealed
that BmADAMTS-1 and BmADAMTS-like genes are
induced during the molting periods. The targets
of the proteases are still unknown; however, their
distinct expression patterns would indicate that
they cleave ECM in different tissues or stages.
ACKNOWLEDGMENTS
We thank Naoko Omuro for technical assistance. This work was supported by grants from
BRAIN (to M.K. and T.S.), MEXT (No. 16011209
and 00150012) (to T.S.), and MAFF-NIAS (Insect
Technology) (to T.S.), Japan.
LITERATURE CITED
Cal S, Arguelles JM, Fernandez PL, Lopez-Otin C. 2001. Identification, characterization, and intracellular processing of
ADAM-TS12, a novel human disintegrin with a complex
structural organization involving multiple thrombospondin-1 repeats. J Biol Chem 276:17932–17940.
Colige A, Sieron AL, Li SW, Schwarze U, Petty E, Wertelecki W,
Wilcox W, Krakow D, Cohn DH, Reardon W. 1999. Human Ehlers-Danlos syndrome type VII C and bovine
dermatosparaxis are caused by mutations in the procollagen
I N-proteinase gene. Am J Hum Genet 65:308–317.
Fernandes RJ, Hirohata S, Engle JM, Colige A, Cohn DH, Eyre
DR, Apte SS. 2001. Procollagen II amino propeptide pro-
98
Ote et al.
cessing by ADAMTS-3. Insights on dermatosparaxis. J Biol
Chem 276:31502–31509.
Fessler LI, Condic ML, Nelson RE, Fessler JH, Fristrom JW.
1993. Site-specific cleavage of basement membrane collagen IV during Drosophila metamorphosis. Development
117:1061–1069.
Homma K, Natori S. 1996. Identification of substrate proteins for cathepsin L that are selectively hydrolyzed during the differentiation of imaginal discs of Sarcophaga
peregrina. Eur J Biochem 240:443–447.
Kuno K, Matsushima K. 1998. ADAMTS-1 protein anchors at
the extracellular matrix through the thrombospondin type
I motifs and its spacing region. J Biol Chem 273:13912–
13917.
Kuno K, Okada Y, Kawashima H, Nakamura H, Miyasaka M,
Ohno H, Matsushima K. 2000. ADAMTS-1 cleaves a cartilage proteoglycan, aggrecan. FEBS Lett 478:24124–24125.
Kuno K, Baba C., Asaka A, Matsushima C, Matsushima K,
Hosono R. 2002. The Caenorhabditis elegans ADAMTS family gene adt-1 is necessary for morphogenesis of the male
copulatory organs. J Biol Chem 277:12228–12236.
Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN,
McGee BM, Yang AY, Siemieniak DR, Stark KR, Gruppo R,
Sarode R, Shurin SB, Chandrasekaran V, Stabler SP, Sabio
H, Bouhassira EE, Upshaw JD Jr, Ginsburg D, Tsai HM.
2001. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature
413:488–494.
Mita K, Kasahara M, Sasaki S, Nagayasu Y, Yamada T, Kanamori H, Namiki N, Kitagawa M, Yamashita H, Yasukochi
Y, Kadono-Okuda K, Yamamoto K, Ajimura M, Ravikumar
G, Shimomura M, Nagamura Y, Shin-I T, Abe H, Shimada
T, Morishita S, Sasaki T. 2004. The genome sequence of
silkworm, Bombyx mori. DNA Res 11:27–35.
Nardi JB, Miklasz SD. 1989. Hemocytes contribute to both
the formation and breakdown of the basal lamina in developing wings of Manduca sexta. Tissue Cell 21:559–567.
Nishiwaki K, Hisamoto N, Matsumoto K. 2000. A metalloprotease disintegrin that controls cell migration in Caenorhabditis elegans. Science 288:2205–2208.
Nusgens BV, Verellen-Dumoulin C, Hermanns-Le T, de Paepe
A, Nuytinck L, Pierard GE, Lapiere CM. 1992. Evidence for
a relationship between Ehlers-Danlos type VII C in humans
and bovine dermatosparaxis. Nat Genet 1:214–217.
Ote M, Mita K, Kawasaki H, Seki M, Nohata J, Kobayashi M,
Shimada T. 2004. Microarray analysis of gene expression
profiles in wing discs of Bombyx mori during pupal ecdysis.
Insect Biochem Mol Biol 34:775–784.
Porter S, Clark IM, Kevorkian L, Edwards DR. 2005. The
ADAMTS metalloproteinases. Biochem J 386:15–27.
Rao C, Foernzler D, Loftus SK, Liu S, McPherson JD, Jungers
KA, Apte SS, Pavan WJ, Beier DR. 2003. A defect in a novel
ADAMTS family member is the cause of the belted whitespotting mutation. Development 130:4665–4672.
Rodriguez-Manzaneque JC, Milchanowski AB, Dufour EK,
Leduc R, Iruela-Arispe ML. 2000. Characterization of
METH-1/ADAMTS1 processing reveals two distinct active
forms. J Biol Chem 275:33471–33479
Russell DL, Doyle KM, Ochsner SA, Sandy JD, Richards JS.
2003. Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem 278:42330–42339.
Somerville RP, Longpre JM, Jungers KA, Engle JM, Ross M,
Evanko S, Wight TN, Leduc R, Apte SS. 2003. Characterization of ADAMTS-9 and ADAMTS-20 as a distinct
ADAMTS subfamily related to Caenorhabditis elegans GON1. J Biol Chem 278:9503–9513.
Suzuki MG, Shimada T, Kobayashi M. 1998. Absence of dosage compensation at the transcription level of a sex-linked
gene in a female heterogametic insect, Bombyx mori. Heredity 81:275–283.
Tortorella M, Pratta M, Liu RQ, Abbaszade I, Ross H, Burn T,
Arner E. 2000. The thrombospondin motif of aggrecanase1 (ADAMTS-4) is critical for aggrecan substrate recognition and cleavage. J Biol Chem 275:25791–25797.
Tucker RP. 2004. The thrombospondin type 1 repeat superfamily. Int J Biochem Cell Biol 36:969–974.
Yano T, Takahashi N, Kurata S, Natori S. 1995. Regulation of
the expression of cathepsin B in Sarcophaga peregrina (flesh
fly) at the translational level during metamorphosis. Eur J
Biochem 23:39–43.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
0
Размер файла
244 Кб
Теги
two, characteristics, domain, induced, molting, typed, adam, period, protein, morie, genes, encoding, bombyx, metalloprotease
1/--страниц
Пожаловаться на содержимое документа