close

Вход

Забыли?

вход по аккаунту

?

Мутации в гене K-ras у больных колоректальным раком: эпидемиология и клиническое значение

код для вставкиСкачать
ФИО соискателя: Беляева Анна Валерьевна Шифр научной специальности: 14.01.12 - онкология Шифр диссертационного совета: Д 208.052.01 Название организации: Научно-исследовательский институт онкологии им.проф.Н.Н.Петрова Адрес организации: 197758, г.Са
На правах рукописи
Беляева Анна Валерьевна
МУТАЦИИ В ГЕНЕ К-RAS У БОЛЬНЫХ
КОЛОРЕКТАЛЬНЫМ РАКОМ:
ЭПИДЕМИОЛОГИЯ И КЛИНИЧЕСКОЕ
ЗНАЧЕНИЕ
специальности: 14.01.12 – онкология
03.01.04 – биохимия
АВТОРЕФЕРАТ
диссертации на соискание ученой степени
кандидата медицинских наук
Санкт-Петербург
2012
1
Работа выполнена в Федеральном государственном бюджетном
учреждении «Научно-исследовательский институт онкологии имени Н.Н.
Петрова» Министерства здравоохранения и социального развития Российской
Федерации
Научные руководители:
доктор медицинских наук, профессор
Гуляев Алексей Викторович
доктор медицинских наук, профессор
Имянитов Евгений Наумович
Официальные оппоненты:
доктор медицинских наук, профессор
Гафтон Георгий Иванович
доктор медицинских наук, профессор
Комов Вадим Петрович
Ведущее научное учреждение
ГБОУ ВПО Санкт-Петербургский государственный медицинский
университет им. акад. И.П. Павлова Минздравсоцразвития России
Защита состоится «_13_» __марта__ 2012г. в 14.00 часов на заседании
диссертационного совета Д 208.052.01 при Федеральном государственном
бюджетном учреждении «Научно-исследовательский институт онкологии
имени Н.Н. Петрова» Министерства здравоохранения и социального развития
Российской Федерации (197758, Санкт-Петербург, Песочный, ул.
Ленинградская, д.68).
С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ
онкологии им. Н.Н.Петрова» Минздравсоцразвития России по адресу 197758,
Санкт-Петербург,
Песочный,
ул.
Ленинградская,
68,
на
сайте
www.niioncologii.ru и на сайте ВАК.
Автореферат разослан «_10_» __февраля___ 2012 года
Ученый секретарь диссертационного совета
доктор медицинских наук, профессор
Семенов Игорь Иванович
2
Общая характеристика работы
Актуальность проблемы
Колоректальный рак (КРР) является одним из наиболее частых
онкологических заболеваний: ежегодно в мире диагностируется более 1 млн.
200 тыс. карцином толстой кишки и отмечается около 700 тыс. смертей от
данной патологии [Cancer incidence…, 2007]. В США в 2010 году было
зарегистрировано 142 570 новых случаев колоректального рака [Jemal A. et al.,
2010]. В России аналогичный показатель в 2007 г. составил 54 738, в СанктПетербурге в 2008 году было выявлено 2666
заболевших КРР
[«Злокачественные новообразования…», 2007; Мерабишвили В.М., 2010]. В
экономически развитых странах на колоректальный рак приходится примерно
9-14% случаев онкологических заболеваний. КРР в России занимает третье
ранговое место как в структуре онкологической заболеваемости (10%), так и
смертности (10,6%), что практически не отличается от аналогичных
показателей в США [Мерабишвили В.М., 2007; Чиссов В.И. и соавт., 2007;
Jemal A. et al., 2010]. В Санкт-Петербурге, начиная с 2005 г., смертность от
КРР у женщин заняла первое место, обогнав смертность от рака молочной
железы, и составила 19% в структуре онкологической смертности в 2007 г.
[Мерабишвили В.М., 2007, 2008].
Частота возникновения КРР характеризуется большими географическими
колебаниями. Так, в государствах Юго-Восточной Азии КРР выявляется
примерно в 10-20 реже, чем в странах Европы, США, Японии. При этом в
последние годы повсеместно отмечается тенденция к росту заболеваемости и
смертности от КРР.
В настоящее время доказано, что основным механизмом развития
злокачественных опухолей, в том числе и рака толстой кишки, являются
соматические генетические повреждения. Одним из наиболее значимых
событий в молекулярном патогенезе КРР является активирующая мутация в
онкогене K-ras. Уже в конце 80-х годов XX века были начаты работы по
систематическому исследованию статуса генов семейства ras в опухолях у
человека, и было обнаружено, что мутации в гене K-ras выявляются почти в
половине случаев КРР [Vogelstein B. et al., 1988]. В 1990 г. Fearon и Vogelstein
предложили генетическую модель последовательной трансформации аденомы
толстой кишки в аденокарциному, согласно которой мутация в гене K-ras,
запуская постоянное деление клеток, приводит к переходу ранней аденомы в
аденому с выраженной дисплазией. В последующие годы эта модель была
подтверждена многими экспериментальными работами и в настоящее время
считается классической [Fearon E., Vogelstein B., 1990].
В последующие годы в разных странах проводились исследования частоты
мутации в гене K-ras и анализ ее взаимосвязи с клиническим течением КРР. В
частности, было достоверно установлено, что опухоли с мутацией K-ras
практически не отвечают на терапию ингибиторами рецептора эпидермального
фактора роста (epidermal growth factor receptor, EGFR) [Van Cutsem E. et al.,
3
2008]. Являясь частью сигнального каскада, продукт гена K-ras – белок K-ras –
передает сигнал к делению клетки, поступающий с EGFR. Мутированный Kras находится в состоянии постоянной активации вне зависимости от статуса
EGFR, поэтому инактивация данного рецептора в опухолях с мутацией не
сопровождается терапевтическим эффектом.
Встречаемость мутации K-ras в опухолях толстой кишки, по данным
различных авторов, колеблется от 30 до 50% [Andreyev H. et al., 1998, Brink
M. et al., 2003, Hsieh J.S. et al., 2005, Kaji E. et al., 2011]. Вариации в частоте
мутаций K-ras принято объяснять популяционными различиями в образе
жизни и характера питания в различных регионах мира [Мартынюк В.В.,
2000]. Влияние пола и возраста на статус гена K-ras при КРР остается
предметом для дискуссий [Breivik J. et al., 1994, Arber N. et al., 2000, Krtolica
K. et al., 2007, Yuan Y. et al., 2010]. Имеются отдельные указания на связь
мутации гена K-ras с курением [Diergaarde B., 2003], однако эти наблюдения
также требуют подтверждающих исследований. Исследуется взаимосвязь
мутаций в гене с такими клинико-морфологическими параметрами КРР, как
локализация и гистологическое строение опухоли [Schimanski C. et al., 1999,
Frattini M. et al., 2004, Lьchtenborg M. et al., 2005].
Сведения о
прогностической значимости статуса гена K-ras характеризуются
значительными противоречиями [Conlin A. et al., 2005; Roth A.D. et al., 2009].
Цель настоящего исследования – изучение частоты, спектра и
клинического значения мутаций в гене K-ras в аденокарциномах толстой
кишки.
Задачи исследования:
1. Изучить частоту и спектр мутаций в гене K-ras в опухолях толстой
кишки у больных КРР.
2. Сопоставить распределение мутаций с антропометрическими данными
пациентов.
3. Изучить
влияние
экзогенных
интоксикаций
(курения
и
профессиональных вредностей) на статус гена K-ras в опухолях у больных
КРР.
4. Изучить частоту мутаций в гене K-ras в опухолях различных отделов
толстой кишки.
5. Проанализировать взаимосвязь мутаций в гене K-ras с клиникоморфологическими параметрами и степенью распространения опухолевого
процесса.
6. Изучить влияние мутаций в гене K-ras на отдаленные результаты
лечения больных КРР.
4
Положения, выносимые на защиту
1. Более чем в трети аденокарцином толстой кишки выявляются мутации
в гене K-ras.
2. Наблюдается связь мутаций в гене K-ras с полом и возрастом больных
КРР.
3. Курение влияет на возникновение мутаций в 13 кодоне гена K-ras.
4. Частота и спектр мутаций в гене K-ras варьирует в опухолях,
развивающихся в различных отделах толстой кишки.
5. У больных КРР с мутациями в гене K-ras чаще обнаруживаются
метастазы в регионарных лимфатических узлах.
Научная новизна
• Впервые в России на большом клиническом материале (207 больных
КРР) установлена частота мутаций в гене K-ras при КРР.
• Впервые обнаружено влияние курения и
вредностей на частоту мутации в кодоне 13 гена K-ras.
профессиональных
• Впервые обнаружено преобладание мутаций в кодоне 13 у больных с
локализацией опухоли в дистальных отделах толстой кишки (сигмовидной и
прямой).
• Впервые обнаружено благоприятное влияние мутаций в гене K-ras на
отдаленные результаты лечения больных с низкодифференцированным раком
толстой кишки.
• Впервые обнаружено, что у больных КРР с K-ras мутациями частота
регионарных метастазов выше по сравнению с больными с диким типом гена
K-ras.
Научная и практическая значимость
Полученные данные о достаточно высокой частоте мутаций K-ras при КРР
(около 40%) и корреляции K-ras мутаций с некоторыми клиникоморфологическими параметрами позволяют выдвинуть гипотезу о
существовании, по крайней мере, двух вариантов патогенеза заболевания,
имеющих различное клиническое течение. Следовательно, определение K-ras
мутаций можно использовать как в качестве предиктивного маркера для
определения чувствительности к терапии антителами к EGFR, так и в качестве
прогностического маркера. При этом значение этого показателя будет
5
зависеть от
параметрами.
его
сочетания
с
другими
клинико-морфологическими
Обнаруженное влияние курения и профессиональных вредностей на
частоту мутации в кодоне 13 гена K-ras позволяет предполагать
чувствительность именно кодона 13 к токсическим воздействиям, что
расширяет наши представления о молекулярных механизмах воздействия
хронических интоксикаций, что требует дальнейшего изучения. В этом плане
обнаруженное преобладание мутаций в кодоне 13 у больных раком
сигмовидной и прямой кишки позволяет предположить, что в этиопатогенезе
этих локализаций КРР определенное место занимает хроническая
интоксикация.
Внедрение в практику
Результаты работы были внедрены и применяются при обследовании и
лечении больных КРР в ФГБУ «НИИ онкологии им. проф. Н.Н. Петрова»
Минздравсоцразвития России.
Структура диссертации:
диссертация изложена на 150 страницах и состоит из введения, обзора
литературы, трех глав собственных исследований, выводов и практических
рекомендаций. Текст иллюстрирован 22 таблицами, 47 рисунками. Указатель
литературы содержит 146 названий работ отечественных и зарубежных
авторов.
Апробация работы:
материалы диссертации были доложены на конференции молодых ученых
ФГБУ «НИИ онкологии им. проф. Н.Н. Петрова» Минздравсоцразвития
России (Санкт-Петербург, март 2011), конференции по фундаментальной
онкологии «Петровские чтения - 2011» (Санкт-Петербург, апрель 2011),
конференции
«Современные
принципы
диагностики
и
лечения
колоректального рака» (Москва, май 2011), XI Всероссийской конференции
молодых ученых «Актуальные вопросы экспериментальной и клинической
онкологии» (Москва, ноябрь 2011).
Содержание работы
Материалы и методы исследования
Для решения поставленных в ходе работы задач было проведено
ретроспективное исследование частоты мутаций в гене K-ras у больных КРР.
На первом этапе исследования были проанализированы клинико-лабораторные
данные о 317 больных КРР, находившихся на лечении в клинике НИИ
онкологии им. Н.Н. Петрова в 2005-2006 гг. При анализе гистологических
заключений диагноз «аденокарцинома толстой кишки» был подтвержден у 262
больных. Доступными для исследования в архиве лаборатории
6
патоморфологии оказались 212 опухолевых образцов, залитых в парафиновые
блоки, от 207 больных. Сведения, полученные из историй болезни и
амбулаторных карт, заносились в специально разработанные для этого
исследования анкеты. В дальнейшем из собранного материала были созданы
базы данных по различным параметрам исследования. Всего в исследовании
анализировалось 17 параметров, характеризующих организм больного и
опухолевый процесс. Для оценки влияния различных параметров было создано
19 баз данных, которые далее обрабатывались с применением
математических методов статистики. Среди параметров, характеризующих
организм больного, изучались следующие: пол, возраст, вес, индекс массы
тела, наследственность, курение, наличие профессиональных и иных
вредностей, наличие других доброкачественных и злокачественных опухолей,
вид и объем полученного лечения. Среди параметров, характеризующих
опухолевый процесс, анализировались стадия заболевания по системе TNM,
глубина инвазии, наличие регионарных и отдаленных метастазов,
локализация, дифференцировка и гистологический тип опухоли.
Для изучения мутаций в гене K-ras были использованы клинические
данные и биологические образцы от 207 больных КРР. 212 опухолевых
образцов были представлены в 196 случаях первичной опухолью, в 11 случаях
- материалом из метастатического очага, в 5 – из рецидивного. При этом у
троих больных удалось исследовать образцы и первичной опухоли, и
отдаленных метастазов, а у одной больной – образцы местного рецидива
первичной опухоли и образцы метахронной опухоли толстой кишки.
На основании клинических данных и гистологического исследования
операционного материала были рестадированы 199 больных согласно 7-му
изданию классификации TNM (AJCC Cancer Staging Handbook. Seventh
Edition, 2010). Распределение больных по стадиям заболевания оказалось
следующим: у 5 (2.5%) больных был установлен диагноз рака in situ (стадия
0), у 31 (15.6%) – стадия I, у 68 (34.2%) – стадия II, у 46 (23.1%) – стадия III
и у 49 (24.6%) – стадия IV. Гистологический тип и степень дифференцировки
опухоли определялась в соответствии с классификацией ВОЗ (Pathology and
Genetics of Tumours of the Digestive System, 2000).
Больные были прослежены в сроки от 53 до 77 месяцев. Отдаленные
результаты удалось проследить у 152 больных. Информация об исходе
заболевания и наличии рецидива была получена с помощью телефонных
контактов с пациентами и их родственниками, путем анализа данных
амбулаторных карт и, в случае повторных госпитализаций пациентов, историй
болезни. Данные об исходе заболевания для пациентов – жителей СанктПетербурга, связь с которыми не удалось установить, были получены из базы
данных Популяционного ракового регистра Санкт-Петербурга (руководитель
– д.м.н., проф. В.М. Мерабишвили).
Срезы с парафиновых блоков толщиной 15 мкм наносились на предметные
стекла и подвергались гистологическому исследованию на наличие
опухолевой ткани. Под контролем световой микроскопии определялись
7
участки, содержащие более 40% опухолевых клеток. Исследованный
микропрепарат сопоставлялся с парафиновым блоком. С участка
парафинового блока, соответствующего наибольшему количеству опухолевых
клеток,
по
данным
исследования
микропрепарата,
выполнялась
стереотаксическая микродиссекция. Из полученного материала выделяли
ДНК.
Методика определения статуса гена K-ras
• Выделение ДНК
Срезы опухолевой ткани депарафинизировались в двух сменах ксилола по
5 минут. Затем образцы промывались в двух сменах 96% этанола по 2 минуты.
После тщательного удаления этанола к тканям добавлялись лизирующий
буфер (10 ммоль Tris-HCl (pH=8.0), 0.1 ммоль ЭДТА; pH=8.0, 2% натрия
додецилсульфат) и протеиназа К (20 мг/мл). Инкубация образцов проводилась
при 60єС в течение 8-16 часов до полного лизиса тканей. Далее
осуществлялась фенол-хлороформная экстракция. К лизату добавлялся
однократный объем нейтрального фенола и 0,3 объема смеси хлороформизоаминовый спирт (24:1). После интенсивного десятиминутного
встряхивания пробы центрифугировались при 15000 g в течение 20 минут.
Затем надосадочная жидкость (супернатант) отбиралась в чистые пробирки, в
которые добавляли 0,1 объема 3М ацетата Na (pH=4.0), 0,3 объема
хлороформа. После интенсивного встряхивания образцы центрифугировались
при 15000g в течение 20 минут. Cупернатант отбирался в чистые эппендорфы.
К пробам добавлялся раствор гликогена (20 мг/мл) в качестве ко-осадителя и 1
объем холодного изопропанола. Пробы выдерживались при температуре -20єС
в течение не менее трех часов. Затем пробирки центрифугировались при
15000 g в течение 30 минут. Изопропанол удалялся, а полученный осадок
однократно промывался в 70% этаноле в течение 10 минут. После
тщательного удаления этанола осадок подсушивался в термостате при 40єС, а
затем растворялся в 30 мкл стерильной воды при 65єС в течение 10 минут.
Раствор ДНК хранился при -20єС до использования в полимеразной цепной
реакции (ПЦР).
• ПЦР
Праймеры для ПЦР-амплификации фрагментов, включающих кодоны 12,
13, 61 и 146 гена K-ras, приведены в таблице. ПЦР-амплификация проводилась
в конечном объеме 20 мкл. В состав реакционной смеси входили: 1 мкл
раствора ДНК; 0,5 единиц ДНК-полимеразы; однократный ПЦР буфер (pH
8.3);
2,5
мМ
MgCl2;
по
200
мкМ
каждого
из
четырех
дезоксинуклеотидтрифосфатов (dATP, dCTP, dGTP, dTTP); 0,3 мкМ прямого и
обратного праймеров; интеркалирующий краситель Eva Green I (20X раствор).
8
Таблица 1
Праймеры, использованные для детекции мутаций в гене K-ras
Вид мутации
Последовательность нуклеотидов
Размер фрагмента
(число
нуклеотидных
последовательностей)
KRAS1F
AATGACTGAATATAAACTTGTG
G
122
KRAS1R
CAAGATTTACCTCTATTGTTGG
M13-KRASc61F
TGTAAAACGACGGCCAGTACCT
GTCTCTTGGATATTCTC
M13-KRASc61R
AGCGGATAACAATTTCACACAG
GTACTGGTCCCTCATTGCAC
KRASc146F
GTAGACACAAAACAGGCTCAG
KRASc146R
TGTATTTATTTCAGTGTTACTTAC
106
102
Реакция начиналась с фазы активации Taq-полимеразы при температуре
95єС в течение 10 минут. Последующие 40 - 45 циклов ПЦР состояли из фаз
денатурации (при температуре 95єС в течение 15 секунд), отжига (при
температуре 60єС в течение 30 секунд) и элонгации (при температуре 72єС в
течение 60 секунд). Продукт ПЦР
анализировался посредством
высокоточного анализа кинетики плавления (high-resolution melting, HRM) на
приборах CFX96 (Bio-Rad, USA) или RotorGene 6000 (Corbett Research,
Australia) с шагом повышения температуры каждую секунду на 0,1є в
интервале с 72єС до 92єС. При выявлении отличий кривой плавления от
контрольных образцов дикого типа продукт реакции подвергался
секвенированию.
• Секвенирование ДНК
Очистку ПЦР-продукта проводили с использованием наборов PCR-Clean-up
kit (Axygen, USA). Очищенный амплификат добавляли в сиквенсную реакцию в
количестве 5 мкл, смесь для реакции также включала 3 мкл DTCS mix (Beckman
Coulter,
USA),
1
мкл
прямого
праймера
5’TCATTATTTTTATTATAAGGCCTGCTGAA-3’ (до конечной концентрации 2
пкмоль) и стерильную воду до конечного объема 20 мкл. Секвенирование
проводилось с помощью набора GenomeLab DTCS Quick Start Kit (Beckman
9
Coulter, USA) согласно рекомендациям производителя. Продукт реакции
секвенирования после преципитации этанолом разбавлялся в 40 мл SLS (Sample
Loading Solution, Beckman Coulter, USA) и подвергался капиллярному
электрофорезу в системе генетического анализа CEQ 8000 (Beckman Coulter,
USA).
Методы статистической обработки результатов исследования
В исследовании использовались пакеты прикладных программ: Statistica
for Windows 8.0 - для статистического анализа, MS Office 2007 – для
организации и формирования матрицы данных, а также построения графиков и
диаграмм.
В ходе исследования применялись различные процедуры и методы
статистического анализа. Для оценки количественных показателей
производились: определение числовых характеристик переменных; оценка
соответствия
эмпирического
закона
распределения
количественных
переменных теоретическому закону нормального распределения по критерию
Шапиро-Уилка; оценка значимости различий количественных показателей в
независимых выборках по U-критерию Манна-Уитни (Mann-Whitney U Test);
оценка значимости различий количественных показателей в связанных
выборках по критерию Вилкоксона (Wilcoxon Matched Pairs Test). Для
проверки гипотезы о происхождении групп, сформированных по
качественному признаку, из одной и той же популяции, проводилась оценка на
основе построения таблиц сопряжённости наблюдаемых и ожидаемых частот;
применялся критерий Хи-квадрат Пирсона (Pearson Chi-square), при его
неустойчивости использовался двусторонний точный тест Фишера (Fisher
exact test). Оценка степени влияния качественного фактора на дисперсию
количественных показателей проводилась с использованием дисперсионного
рангового метода ANOVA Kruskal-Wallis H-test. Для оценки силы и
направления связи между количественными показателями с использованием
коэффициента корреляции Пирсона R. Для переменных, распределение
которых достоверно отличалось от закона нормального распределения,
использовался коэффициента корреляции Спирмена. Анализ показателей
выживаемости пациентов и возникновения прогрессии заболевания в одной и в
нескольких группах, а также оценку влияния факторов на выживаемость
больных осуществляли с помощью таблиц времени жизни, метода КапланаМейера, регрессионной модели пропорциональных рисков Кокса и
дискриминантного анализа [Реброва О.Ю., 2003; Юнкеров В.И. и соавт., 2005;
Мерабишвили В.М., 2010].
Результаты и обсуждение
При исследовании 212 образцов опухолей (196 – первичных, 5 –
рецидивных, 11 – метастатических) от 207 больных было обнаружено 82
мутации в гене K-ras. У 77 больных выявлено по одной мутации в образце
опухоли. У одной больной, как в первичной опухоли, так и в удаленном
синхронном одиночном метастазе из легкого выявлена идентичная мутация в
10
кодоне12. При проведении дальнейшего анализа с целью более точной
обработки данных было решено учитывать отдельно мутацию в первичной
опухоли при анализе первичных опухолей, а мутацию в отдаленном метастазе
– отдельно при анализе только материала из метастазов. Лишь у одной
больной были обнаружены сразу два вида K-ras мутации – в кодоне 12 и
кодоне 146. У данной больной был первично-множественный метахронный рак
толстой кишки, в клинику она поступила с рецидивом в зоне анастомоза
спустя 2 года после правосторонней гемиколэктомии и метахронной опухолью
сигмовидной кишки. При этом в опухоли сигмовидной кишки было
обнаружено сразу две мутации в гене K-ras – в кодонах 12 и 146, а в местном
рецидиве опухоли слепой кишки также выявлена мутация в кодоне 12 гена Kras.
Таким образом, всего из 207 больных мутации в гене K-ras были
выявлены в опухолях толстой кишки у 79 пациентов, частота обнаружения
мутаций в гене K-ras в опухолях у исследованных больных КРР составила
38,2%. Полученные нами данные, с одной стороны, соответствуют данным,
полученным в крупных мультицентровых исследованиях о том, что мутация в
гене K-ras обнаруживается примерно у трети больных раком толстой кишки
[Andreyev H.J. et al., 1998; Andreyev H.J. et al., 2001]. С другой стороны,
учитывая возможные географические колебания генетических мутаций,
отражающие диетические и другие особенности исследуемой популяции,
которые наблюдаются при эпидемиологических исследованиях, полученная
нами частота в 38,2% вполне может соответствовать выявляемой частоте
мутаций в популяции Северо-Западного региона России.
Из 196 образцов первичных опухолей мутации в гене K-ras были
обнаружены в 72 образцах (36,7%). Из пяти образцов рецидивных опухолей в
двух были обнаружены мутации в гене K-ras (40,0%), причем обе
обнаруженные мутации были выявлены в рецидивных опухолях в зоне
межкишечного анастомоза. 8 мутаций были обнаружены в 11 образцах из
отдаленных метастазов (72,7%). Одновременное исследование образцов
первичной опухоли и синхронных либо метахронных отдаленных метастазов
были произведено у трех больных. При этом у одной больной мутация в гене
K-ras была обнаружена как в первичной опухоли, так и в отдаленном
метастазе.
Из выявленных 82 мутаций наиболее часто мутации в гене K-ras
обнаруживались в кодоне 12 – 51 мутация (62,2%). В два раза реже мутации
выявлялись в кодоне 13 – в 23 образцах (28,0%). Мутации в кодонах 61 и 146
были достаточно редким событием и встречались с одинаковой частотой (по
4,9% каждый). Также были проанализированы виды мутаций в каждом из
исследованных кодонов (табл.2).
11
Таблица 2
Спектр обнаруженных соматических мутаций в гене K-ras
Кодон
12
13
61
146
Вид замены
Количество замен
Нуклеотидная
аминокислотная
N
%
G>C
глицин?аланин
3/212
1,4
G>T
глицин?валин
17/212
8,0
G>T
глицин?цистеин
11/212
5,2
G>A
глицин?аспартат
18/212
8,5
G>A
глицин?серин
2/212
0,9
G>A
глицин?цистеин
1/212
0,5
G>A
глицин?аспартат
22/212
10,4
G>C
глицин?гистидин
2/212
0,9
A>T
глицин?лейцин
2/212
0,9
С>T
аланин?валин
1/212
0,5
G>A
аланин?тирозин
2/212
0,9
G>T
аланин?серин
1/212
0,5
Связь мутации в гене K-ras с полом, возрастом и
семейным онкологическим анамнезом
Мутации в гене K-ras были обнаружены у 49 из 115 женщин и у 30 из 92
мужчин. Частота мутаций среди женщин составила 42,6%, среди мужчин –
32,6% (p=0,08). У женщин 35 мутаций было выявлено в кодоне12, что
составило 30,4% от общего числа женщин, 11 мутаций - в кодоне 13 (9,6%),
одна мутация – в кодоне 61 (0,9%), 2 мутации в кодоне 146 (1,7%). У мужчин
мутации в кодоне 12 были выявлены в 14 случаях, мутаций в кодоне 13 – у
12 мужчин, в кодоне 61 - у трех мужчин, мутация в кодоне 146 была
выявлена только у одного мужчины (15,2%, 13,0%, 3,3% и 1,1% от общего
числа мужчин, соответственно). Таким образом, частота мутаций в кодоне 12
у женщин вдвое превышала аналогичный показатель у мужчин (30,4% и
12
15,2%, соответственно, p<0,01). Частота мутаций в других кодонах среди
женщин и мужчин была сопоставима.
Средний возраст всех больных, вошедших в наше исследование, составил
63,3±11,1 лет. Средний возраст больных с мутацией в гене K-ras и без
мутации существенно не отличался и составлял 62,7±10,9 лет и 64,1±11,4 лет,
соответственно, p=0.39. Тем не менее, частота мутаций в различных
возрастных группах несколько варьировала (рис.1).
Рис.1. Частота мутации в гене K-ras у больных разных возрастных групп
Максимальная частота мутаций наблюдалась среди больных старше 80 лет
(у пяти из шести больных). Также довольно высокая частота мутации отмечена
среди больных моложе 40 лет: у 4 из 7 больных. У больных старше 40 и
моложе 80 лет мутация в гене K-ras была выявлена у 70 из 194 больных
(36,1%), т.е. примерно у трети больных данного возраста. Однако, учитывая
небольшое число наблюдений больных моложе 40 и старше 80 лет, не
получено статистически значимых различий в частоте мутаций в гене K-ras у
больных разных возрастных групп.
Случаи опухолевых заболеваний у родственников были выявлены у 77 из
207 больных (37,2%); мутации в гене K-ras были выявлены у 26 пациентов из
этой категории (33,8%). У больных с неотягощенным семейным
онкологическим анамнезом мутации в опухоли определялись чаще – у 53 из
130 больных (40,8%), однако достоверных различий выявить не удалось
(p>0,05). Отсутствие достоверных различий у больных с разным семейным
анамнезом может свидетельствовать о том, что мутация в гене K-ras не
13
связана с наследственным характером злокачественных опухолей и ее
возникновение определяется другими факторами патогенеза.
Связь частоты мутации в гене K-ras с воздействием экзогенных
канцерогенов
Связи мутаций в гене K-ras с курением посвящены единичные работы, и
лишь одна из них подтверждает связь мутаций гена K-ras с курением
[Diergaarde B., 2003]. При анализе связи этих параметров были использованы
данные о курении в анамнезе, отмеченные в первичной медицинской
документации у 205 из 207 исследованных больных. Из них продолжали
курить или курили в прошлом 48 человек (23,4%), некурящих было 157
человек (76,6%). Мутации в гене K-ras были обнаружены у 17 курящих и 62
некурящих больных (35,4% и 39,5%, соответственно). Из 79 больных с
мутацией курильщики составляли 21,5%. Доля курильщиков среди больных с
диким типом гена была сопоставима и составляла 24,6%.
Был также проанализирован спектр мутаций в гене K-ras у курящих
больных в сравнении с некурящими (табл. 3).
Таблица 3
Спектр мутаций в гене K-ras у курящих и некурящих больных КРР
Курящие
Некурящие
Всего
Локализация
мутации
n
%
N
%
n
%
12 кодон
5
29,4
44
71,0
49
62,0
13 кодон
10
58,8
13
21,0
23
28,4
61 кодон
1
5,9
3
4,8
4
4,9
146 кодон
1
5,9
2
3,2
3
4,9
Всего
17
100,0
62
59,3
79
100,0
При этом было выявлено, что частота мутации в кодоне 12 вдвое меньше у
курящих больных по сравнению с общей группой больных и почти втрое
меньше по сравнению с группой некурящих. В то же время частота мутаций в
кодоне 13 вдвое больше частоты мутации у больных общей группы и почти
втрое больше, чем у некурящих больных (p=0,02, рис. 2).
14
Несмотря на то, что курильщики составляют менее четверти от всех
больных КРР, в опухолях у курильщиков было выявлено 10 из 23 мутаций в 13
кодоне (43,5%). Это дает основания предполагать, что табакокурение является
одной из основных причин мутаций именно в 13 кодоне гена K-ras.
1,2
1
???????
0,8
????? ???
64,6%
60,5%
61,8%
0,6
0,4
0,2
0
146 ?????
61 ?????
2,1%
2,1%
1,3%
1,9%
8,3%
1,4%
1,9%
11,1%
28,0%
23,7%
?????????
??? ???????
13 ?????
12 ?????
20,8%
10,4%
???????
Рис. 2. Частота различных мутаций в гене K-ras у курящих и некурящих
больных в сравнении с общей группой больных
Данные о наличии или отсутствии профессиональных либо других
вредностей удалось найти в медицинской документации 206 больных. Данные
о каких либо видах вредности были обнаружены у 32 больных (15,5%).
Основными видами вредностей были контакты с химическими реагентами - у
11 больных из 32 (34,4%), воздействие ионизирующего излучения – у 8
больных (25,0%), воздействие сверхвысоких частот – у пяти больных (15,6%),
контакт с пылью – у трех больных (9,4%) и воздействие высоких температур –
у двух больных (6,3%). Еще у трех больных (9,4%) вид вредности указан не
был.
У 32 больных с указанием на вредность в анамнезе было выявлено 14
мутаций в гене K-ras, что составило 43,8%. У 174 больных без указания на
вредность мутация была выявлена у 65 больных, что составило 37,4%.
Достоверных различий в частоте мутации в гене K-ras между группами
больных с указанием на вредность и без него получено не было (p>0,05).
У больных с указанием на вредность среди выявленных мутаций в гене Kras было 7 мутаций в кодоне 12 и 7 мутаций – в кодоне 13, что составило по
21,9% от общего числа больных, подвергавшихся вредным воздействиям.
Мутаций в кодонах 61 и 146 в этой группе больных выявлено не было. У
15
больных, не имевших контакт с потенциально вредными агентами, было
выявлено 42 мутации в кодоне 12, 16 мутаций в кодоне 13, 4 мутации в кодоне
61 и 3 мутации в кодоне 146. Частота мутаций в каждом из кодонов у этой
группы больных составила 24,1%, 9,2%, 2,3% и 1,7%, соответственно (рис.3).
Рис. 3. Частота различных мутаций в гене K-ras у больных,
подвергавшихся и не подвергавшихся вредным воздействиям в анамнезе
Полученные результаты свидетельствуют о том, что у курильщиков и
больных, подвергавшихся воздействию профессиональных и иных видов
вредностей, значительно чаще выявляется мутация в кодоне 13 гена K-ras
(p=0,06) и удельный вес данной мутации в этих группах больных существенно
превышает таковой в группе больных без указанных вредных воздействий
(p=0,03).
Связь мутации в гене K-ras c основными характеристиками опухолевого
процесса
Связь мутации в гене K-ras с локализацией опухоли
Среди больных КРР, вошедших в исследование, больных раком ободочной
кишки было 97 (46,9%), больных раком прямой кишки – 110 (53,1%). Был
произведен расчет частоты мутаций в гене K-ras в зависимости от локализации
опухоли. Среди больных раком ободочной кишки мутации была выявлена у 31
больного (32,0%), дикий тип гена – у 66 больных (68,0%). У больных раком
прямой кишки мутации выявлялись несколько чаще и были обнаружены у 48
из 110 больных, что составило 43,6% (p=0,08).
Была проанализирована частота мутации в гене K-ras в опухолях,
располагающихся в различных отделах ободочной кишки. Точная локализация
опухоли была указана в 74 из 80 случаев опухолей с мутациями в гене K-ras.
Таким образом, анализ связи места мутации в гене K-ras c точной
локализацией опухоли был проведен среди 45 опухолей с мутацией в кодоне
16
12, 19 опухолей с мутацией в кодоне 13, четырех опухолей с мутацией в
кодоне 61 и трех опухолей с мутацией в кодоне 146 (рис. 4). При анализе
частоты мутаций в опухолях, локализующихся в различных отделах прямой
кишки, мутация выявлена в девяти из 27 опухолей ректосигмоидного и
верхнеампулярного отдела (33,3%), в 12 из 31 опухолей среднеампулярного
отдела (38,7%) и в 17 из 34 опухолей нижнеампулярного отдела прямой кишки
(50,0%).
Рис. 4. Спектр мутаций в гене K-ras в опухолях различных отделов
ободочной и прямой кишки
На основании проведенного анализа было установлено, что частота
мутаций в опухолях нижних отделов прямой кишки существенно превышает
аналогичный показатель в опухолях вышележащих отделов прямой кишки.
Подавляющее большинство мутаций в кодоне 13 происходят в опухолях
сигмовидной и прямой кишки (p=0,04, рис. 4). Все обнаруженные мутации в
кодоне выявляются только в опухолях прямой кишки 61. Данные литературы
по вопросу связи K-ras –мутации с локализацией опухоли в толстой кишке
весьма противоречивы, однако большинство авторов все же указывает на
большую частоту мутаций в дистально расположенных опухолях [Breivik J. Et
al., 1994; Ahnen D.J. et al., 1998; Brink M. et al., 2003; Luch-tenborg M. et al.,
2005]. Полученные нами данные согласуются с представлением большинства
авторов о преобладании K-ras – мутации в дистальных отделах толстой кишки,
что, возможно, связано с более долгим нахождением каловых масс в
терминальных отделах толстой кишки.
17
Связь мутации в гене K-ras с гистологическим типом и степенью
дифференцировки опухоли
У 184 из 207 (88,9%) больных КРР опухоли были представлены
аденокарциномой и у 23 (11,1%) – муцинозным раком. У больных с
аденокарциномой мутации в гене K-ras были выявлены в 68 случаях (37,0%), с
муцинозной аденокарциномой - в 11 (47,8%) (p>0,05).
Степень дифференцировки опухоли была определена у 188 исследованных
больных. У 20 больных (10,6%) была высокодифференцированная опухоль, у
137 (72,9%) – умеренно дифференцированная и у 31 больного (16,5%) низкодифференцированная опухоль толстой кишки. Мутация в гене K-ras была
обнаружена в 10 опухолях с высокой степенью дифференцировки (50,0%), 48
случаях умеренно дифференцированных опухолей (35,0%) выявлены мутации
и в 11 низкодифференцированных опухолях
(35,5%). Таким образом,
достоверных различий в частоте мутаций в опухолях с различной степенью
дифференцировки выявлено не было (p=0,10).
Связь частоты мутации в гене K-ras с распространением опухоли
• Связь частоты мутации в гене K-ras с глубиной инвазии опухоли
Глубина инвазии опухолью стенки кишки на основании гистологического
заключения установлена у 185 больных. У 5 больных (2,7%) опухоль не
проникала глубже собственной пластинки либо мышечного слоя слизистой и
классифицировалась как рак in situ, у 7 больных (3,8%) опухоль прорастала
подслизистый слой (T1), у 32 (17,3%) – инфильтрировала мышечный слой
(T2), у 104 больных (56,2%) опухоль прорастала субсерозную оболочку либо
врастала в околокишечную клетчатку на неперитонизированных участках
кишки (T3), у 27 (14,6%) прорастала висцеральную брюшину (T4a), у 10
больных (5,4%) морфологически было подтверждено истинное врастание
опухоли в соседние органы и структуры (T4b).
При анализе показателя T достоверной связи между глубиной инвазии и
мутацией в гене K-ras получено не было (p=0,19). Однако была отмечена
некоторая тенденция уменьшения частоты мутации с увеличением глубины
инвазии опухоли. При распределении исследованных больных на две группы: с
выходом за пределы стенки кишки (T3-4b) и без него (Tis-T2) было
обнаружено, что в опухолях, ограниченных кишечной стенкой, мутации в гене
K-ras определялись несколько чаще, чем в опухолях, выходящих за пределы
стенки кишки – 47,7% и 33,3%, соответственно, p=0,08.
• Анализ частоты мутации в гене K-ras в зависимости от поражения
регионарных лимфатических узлов
Некоторые исследователи обнаружили связь между мутацией в гене K-ras
и лимфогенным метастазированием опухолей толстой кишки [Pajkos G. et al.,
2000; Hsieh et al., 2005; Hirata et al., 2007; Chang Y.S. et al., 2009]. В нашем
18
исследовании оценка поражения регионарных лимфатических узлов у 185
больных проводилась на основании результатов гистологического
исследования операционного материала. Из 185 больных метастазы в
регионарные лимфатические узлы были выявлены и гистологически
верифицированы у 72 больных (38,9%, табл. 4).
Среди всех больных, у которых было оценено поражение регионарных
лимфатических узлов, мутация в гене K-ras была обнаружена у 68 больных
(36,8%).
Таблица 4
Сопоставление частоты поражения регионарных лимфатических узлов в
группах больных КРР с мутантным и диким типом гена K-ras
Состояние
регионарных
лимфатических
узлов
Больные с
мутацией
Больные с диким
типом гена
Всего
n
%
N
%
n
%
N0
35
51,5
78
66,7
113
61,1
N+
33
48,5
39
33,3
72
38,9
Всего
68
100,0
117
100,0
185
100,0
При этом мутация была выявлена менее чем у трети больных без
поражения лимфатических узлов и почти у половины больных с метастазами в
регионарные лимфатические узлы (30,1% и 46,8%, соответственно, p=0,04).
При анализе частоты регионарных метастазов у больных с мутацией и без нее
также выявлено, что среди больных КРР с мутацией поражение регионарных
лимфатических узлов метастазами встречается значительно чаще по
сравнению с аналогичным показателем у больных с диким типом гена K-ras
(48,5% и 33,3%, соответственно, p=0,04, табл.4).
Анализ частоты мутации в гене K-ras в зависимости от наличия отдаленных
метастазов
Из данного исследования были исключены трое больных, у которых
материалом для исследования служили образцы из метахронных отдаленных
метастазов. Из 204-х исследованных больных на момент госпитализации в
стационар синхронные отдаленные метастазы были выявлены у 49 (24,0%).
Среди больных с отдаленными метастазами у 20 больных (40,8%) выявлена
мутация в гене K-ras, у 29 больных (59,2%) – дикий тип гена. Среди больных
без синхронных отдаленных метастазов мутация выявлена у 57 больных
19
(36,8%), дикий тип гена – у 98 больных (63,2%). Связи мутации в гене K-ras с
количеством и локализацией отдаленных метастазов выявлено не было.
•
Связь мутации в гене K-ras со стадией заболевания
Среди больных, у которых определение мутации было проведено в
образцах первичной опухоли, у 120 (60,8%) выявлен дикий тип гена K-ras и у
78 (39,2%) – мутация в данном гене. Распределение больных по стадиям среди
больных с мутацией в гене K-ras и без нее было следующим: рак in situ – 5,3%
и 0,8%, соответственно, I стадия – 17,1% и 14,6%, соответственно, II стадия –
22,4% и 41,5%, III стадия – 28,9% и 19,5%, IV стадия – 26,3% и 23,6%,
соответственно. Таким образом, частота установления II стадии рака толстой
кишки среди больных с диким типом гена K-ras значительно превышает
частоту II стадии среди больных с мутацией, тогда как III стадия, напротив
чаще выявляется у больных с мутацией в данном гене (41,5% и 22,4% и 28,9%
и 19,5%, соответственно, p=0,02).
Анализ прогностической значимости мутации в гене K-ras у больных КРР
Общая выживаемость больных с мутацией в гене K-ras и без нее
достоверно не отличалась. Однако выживаемость после первого года
наблюдения у больных с мутацией была ниже вплоть до окончания пятого года
наблюдения (рис. 5). Вероятно, это могло быть связано с тем, что, согласно
полученным нами данным, доля больных с мутацией была существенно выше
среди больных c III и IV стадией заболевания, имеющих гораздо худший
прогноз, а среди больных со II стадией с более благоприятным прогнозом доля
больные с мутацией составляли не более четверти больных.
Рис. 5. Выживаемость больных КРР с мутацией и диким типом гена K-ras
20
Был проведен анализ влияния клинических факторов (возраст, пол
больного, степень дифференцировки, локализация опухоли, стадия
заболевания, наличие поражения регионарных лимфатических узлов) и
изучаемого генетического маркера – мутации в гене K-ras – на общую
выживаемость больных КРР.
Достоверные различия в выживаемости больных с мутацией в гене K-ras и
диким типом гена были выявлены только в связи со степенью
дифференцировки опухолей толстой кишки.
Было обнаружено, что среди больных с низкодифференцированной
опухолью с диким типом гена выживаемость была достоверно ниже по
сравнению с больными с аналогичной степенью дифференцировки с мутацией
в гене K-ras и по сравнению с выживаемостью больных с
умереннодифференцированными опухолями и диким типом гена K-ras
(p=0,02) (рис. 6). Вероятно, низкодифференцированная опухоль у больных с
мутацией является результатом длительного злокачественного процесса,
длительность которого привела к снижению дифференцировки исходной
высокодифференцированной опухоли, развившейся на фоне мутации в гене Kras и имеющей более длительное, и, как следствие, относительно более
благоприятное течение процесса.
Рис. 6. Общая выживаемость больных КРР с умеренной и низкой степенью
дифференцировки опухоли в зависимости от статуса гена K-ras
На основании результатов проведенного исследования можно заключить,
что мутация в гене K-ras влияет на патогенез и течение опухолевого процесса,
в том числе лимфогенное метастазирование. Влияние K-ras мутации на
прогноз также определяется связью с такими исследованными параметрами,
21
как пол, возраст больных и степень дифференцировки опухоли, но сама по
себе мутация не является самостоятельным независимым фактором прогноза
заболевания.
ВЫВОДЫ
1. Частота мутаций в гене K-ras в опухолях у больных КРР составляет
38,2%. Распределение мутаций в гене K-ras по кодонам составило: кодон 12 –
62,2 %, кодон 13 – 28,0 %, кодон 61 – 4,9 %, кодон 146 – 4,9 %.
2. Мутации в кодоне 12 выявляются в два раза чаще в карциномах
толстой кишки у женщин по сравнению с мужчинами (30,4% и 15,2%,
соответственно, p<0,01).
3. Частота мутаций в кодоне 13 у курильщиков более чем вдвое больше
по сравнению с некурящими больными (20,8% и 8,3%, соответственно,
p=0,02).
4. Частота мутации в кодоне 13 у больных с наличием
профессиональных вредностей в анамнезе в два раза больше по сравнению
больными, не имевшими вредностей в анамнезе (21,9% и 9,2%,
соответственно, p=0,03).
5. Частота и спектр мутаций в гене K-ras варьирует в опухолях,
развивающихся в различных отделах толстой кишки. Большинство мутаций в
кодоне 13 (78,2%) отмечается в опухолях сигмовидной и прямой кишки, в то
время как большинство мутаций в кодоне 12 (73,3%) наблюдается в
проксимально лежащих отделах толстой кишки (p=0,04).
6. У больных КРР с мутацией в гене K-ras метастазы в регионарных
лимфатических узлах встречаются достоверно чаще по сравнению с
аналогичным показателем у больных с диким типом гена K-ras (48,5% и
33,3%, соответственно, p=0,04).
7. В группе больных с низкодифференцированными опухолями толстой
кишки мутация в гене K-ras была ассоциирована с лучшей отдалённой
выживаемостью (у больных с мутацией 5-летняя выживаемость составляла
51,8% по сравнению с 33,4% у больных с диким типом гена, p=0,02).
Практическая значимость
1. С учетом полученных в исследовании данных о частоте мутантного
(38,2%) и дикого (61,8%) типа гена K-ras в аденокарциномах толстой кишки и
имеющихся данных рандомизированных исследований об эффективности
терапии ингибиторами EGFR только у больных с диким типом гена, данный
вид терапии может быть рекомендован к применению примерно у 60%
больных КРР.
22
2. Полученные данные о том, что частота регионарных метастазов у
больных с мутациями в гене K-ras значительно выше, чем у больных с диким
типом гена, необходимо учитывать при планировании неоадъювантного и
адъювантного лечения больных КРР.
Список работ, опубликованных по теме диссертации
1.
Беляева А.В., Моисеенко А.Б., Гуляев А.В. Современные
представления о прогностических факторах колоректального рака. // Вопросы
онкологии. – 2011. – Т. 57. – ?3. – С. 279-285.
2.
Беляева А.В., Суспицын Е.Н., Янус Г.А., Имянитов Е.Н., Иевлева
А.Г., Гуляев А.В. Эпидемиология и клиническое значение мутации в гене
KRAS у российских больных колоректальным раком. // Вопросы онкологии
(приложение). – 2011. – Т.57. – ?2. – С. 9-10.
3.
Беляева А.В., Суспицын Е.Н., Имянитов Е.Н., Гуляев А.В.,
Моисеенко А.Б. Значение статуса гена KRAS в определении злокачественного
потенциала и клиническом течении опухолей толстой кишки. // Поволжский
онкологический вестник. – 2011. – ?1. – С. 21-22.
4.
Беляева А.В., Суспицын Е.Н., Имянитов Е.Н., Иевлева А.Г., Гуляев
А.В., Моисеенко А.Б., Корнилов А.В.. Значение мутации в гене KRAS в
клиническом течении колоректального рака. / Материалы II съезда
колопроктологов стран СНГ. – Одесса. 18-20 мая 2011. – С. 82-83.
5.
Беляева А.В., Имянитов Е.Н., Гуляев А.В., Моисеенко А.Б.,
Корнилов А.В. Роль мутации в гене K-ras в патогенезе и клиническом течении
колоректального рака. // Современные принципы диагностики и лечения
колоректального рака: материалы конференции, посвященные памяти
профессора В.И.Кныша. – Москва. 26-27 мая 2011. – С. 18.
6.
Беляева А.В., Янус Г.А., Суспицын Е.Н., Имянитов Е.Н., Гуляев А.В.,
Моисеенко А.Б. Частота мутации гена KRAS у больных раком толстой кишки
и ее значение в определении злокачественного потенциала и клиническом
течении опухолей толстой кишки. //Актуальные вопросы клинической
онкологии: сборник научных трудов. – Санкт-Петербург: Аграф +, 2011. –
С.90-91.
7.
Belyaeva A.V., Yanus G.A., Imyanitov E.N., Suspitsin E.N., Goulyaev
A.V., Ievleva A.G., Moiseenko A.B. Significance of mutation in K-RAS gene in
pathogenesis and clinical course of colorectal cancer. // European Journal of
Cancer. – 2011. – V.47. Supplement 1. ? 6065.
8.
Беляева А.В., Янус Г.А., Суспицын Е.Н., Зайцева О.А., Яцук О.С.,
Гуляев А.В., Имянитов Е.Н. Клинико-патогенетические особенности
колоректального рака у больных с диким и мутантным типом гена k-ras. //
Онкохирургия. – 2011. – Т. 3. – ?4. – С. 15-16.
9.
Беляева А.В., Янус Г.А., Суспицын Е.Н., Зайцева О.А., Яцук О.С.,
Моисеенко А.Б., Гуляев А.В., Имянитов Е.Н. Возрастные и клиникопатогенетические особенности колоректального рака, ассоциированные со
статусом гена k-ras. // Успехи геронтологии. – 2012. – Т.25. - ?1. – С.40-45.
23
Благодарности
Выражаю глубокую признательность за постоянное внимание и
содействие моим научным руководителям, д.м.н., проф. А.В. Гуляеву и д.м.н.,
проф. Е.Н. Имянитову. Высказываю искреннюю благодарность за
всестороннюю помощь в выполнении работы своим друзьям и коллегам –
сотрудникам лаборатории молекулярной онкологии,
лаборатории
морфологии опухолей, популяционного ракового регистра и отделения
абдоминальной онкологии.
?????????? ? ?????????? ??? «???-?????»
????? ?42-0208-26. ?????? ?????? 60?84/16. ????? 100 ??.
191119, ?????-?????????, ??. ??????????????, ?. 11
???./????: 740-11-80
www.740-11-80.ru
24
Документ
Категория
Медицинские науки
Просмотров
318
Размер файла
565 Кб
Теги
кандидатская
1/--страниц
Пожаловаться на содержимое документа