close

Вход

Забыли?

вход по аккаунту

?

Polymorphisms in the interleukin-1 receptor antagonist and interleukin-6 genes affect risk of osteolysis in patients with total hip arthroplasty.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 58, No. 10, October 2008, pp 3157–3165
DOI 10.1002/art.23863
© 2008, American College of Rheumatology
Polymorphisms in the Interleukin-1 Receptor Antagonist and
Interleukin-6 Genes Affect Risk of Osteolysis in Patients With
Total Hip Arthroplasty
Andrew Gordon,1 E. Kiss-Toth,1 Ian Stockley,2 Richard Eastell,1 and J. Mark Wilkinson1
ciated with osteolysis. The uncommon IL6 haplotype
ⴚ174G/ⴚ572G/ⴚ597A (osteolysis group frequency
2.4%, control group frequency 0.8%) was associated with
osteolysis (P ⴝ 0.02, calculated using Haploview software). The IL1RA ⴙ2018CC genotype was associated
with increased mRNA expression compared with the
ⴙ2018TT genotype in both unstimulated and stimulated
PBMCs (P ⴝ 0.01 by analysis of variance, after Bonferroni correction).
Conclusion. The IL1RA ⴙ2018C allele is associated with a decreased risk of osteolysis after THA and
with increased IL-1 receptor antagonist mRNA expression in vitro. An uncommon haplotype within the promoter region of the gene for IL-6 is positively associated
with osteolysis.
Objective. To determine whether osteolysis after
total hip arthroplasty (THA) is associated with common
polymorphisms within the genes encoding the
interleukin-1 (IL-1) family and IL-6, and to determine
whether polymorphisms that are associated with osteolysis affect in vitro messenger RNA (mRNA) expression
in human peripheral blood mononuclear cells (PBMCs)
in response to wear particles.
Methods. Unrelated white subjects of North European descent (n ⴝ 612) were recruited a mean of 11
years after cemented THA for primary osteoarthritis. Of
these subjects, 272 had previous osteolysis and 340 had
no radiographic evidence of osteolysis (control group).
Genomic DNA was genotyped for the following singlenucleotide polymorphisms (SNPs): IL1A ⴙ4845, IL1B
ⴙ3954, IL1B –3737, IL1B –511, IL1RA ⴙ2018, IL6 –174,
IL6 –572, and IL6 –597. In a subset of 60 subjects,
PBMCs were extracted and stimulated with titanium
particles and/or endotoxin, and cytokine mRNA expression was measured using quantitative real-time reverse
transcriptase–polymerase chain reaction.
Results. The odds ratio (OR) for osteolysis associated with carriage of the IL1RA ⴙ2018C allele was
0.66 (95% confidence interval [95% CI] 0.48–0.91) (P ⴝ
0.012). The remaining SNPs were not individually asso-
Particulate wear debris is implicated as a major
factor contributing to osteolysis and aseptic loosening
after total hip arthroplasty (THA) (1). In this model,
macrophages in the periprosthetic environment express
proinflammatory cytokines and enzymes in response to
implant-derived wear particles. Both in vitro and in vivo
evidence shows that wear debris–stimulated macrophages release interleukin-1 (IL-1) family and IL-6
cytokines, and these cytokines are found at high levels in
osteolytic tissues (2–6), synovial fluid (7), and regional
lymph nodes retrieved from failed THAs, while they are
not found in stable implants (8). These cytokines are
known to mediate bone resorption, both in vivo and
in vitro. The proinflammatory cytokines IL-1␣ and
IL-1␤ bind to IL-1 receptor type I (IL-1RI) and initiate
cellular signaling. Both IL-1␣ and IL-1␤ induce increased osteoclast formation and activation, effects that
are mediated through RANKL (9,10). IL-1R antagonist
(IL-1Ra) also binds to IL-1RI and acts as a competitive
antagonist to signal transduction (11). IL-6 binds to the
IL-6 receptor, consisting of a signal transducer and a co-
Supported by the Royal College of Surgeons of England, the
Arthritis Research Campaign, the Cavendish Hip Foundation, and the
John Charnley Trust.
1
Andrew Gordon, MB ChB, MRCS, E. Kiss-Toth, PhD,
Richard Eastell, MD, FRCP, J. Mark Wilkinson, PhD, FRCS: University of Sheffield, Sheffield, UK; 2Ian Stockley, MD, FRCS: Northern
General Hospital, Sheffield, UK.
Dr. Eastell owns stock or stock options in Interleukin Genetics.
Address correspondence and reprint requests to J. Mark
Wilkinson, PhD, FRCS, Academic Unit of Bone Metabolism, Sorby
Wing, Northern General Hospital, Herries Road, Sheffield S5 7AU,
UK. E-mail: j.m.wilkinson@sheffield.ac.uk.
Submitted for publication March 16, 2008; accepted in revised
form June 6, 2008.
3157
3158
GORDON ET AL
receptor chain, and initiates downstream signaling that
results in osteoclast formation, although its osteoclastogenic effect is weaker than that of IL-1 (12,13).
The development of osteolysis after THA is
influenced in part by environmental factors (14). However, much of the observed variation between patients in
susceptibility to osteolysis remains unexplained and may
be influenced by genetic factors. Several polymorphisms
within the genes encoding the IL-1 family and IL-6 have
been described (http://www.ncbi.nlm.nih.gov/snp/).
These polymorphisms are associated with differences in
susceptibility to infectious and inflammatory conditions
and disorders of bone, including decreased bone mineral
density, rheumatoid arthritis (RA), osteoarthritis (OA),
and periodontitis (15–20). Recently, polymorphisms
within the genes encoding tumor necrosis factor, IL-6,
and transforming growth factor ␤, as well as within wnt
signaling genes, have been associated with osteolysis
after THA (21–23). However, the potential association
with osteolysis of polymorphisms within the genes encoding the IL-1 family remains unexplored, and polymorphisms within the gene encoding IL-6 have, to date,
been studied only in a small subject population (22). At
a cellular level, DNA variation may affect gene transcription, messenger RNA (mRNA) stability, protein
quantity, and protein function. However, the function of
these polymorphisms in the setting of osteolysis also
remains unclear.
One aim of this study was to determine whether
there is an association between osteolysis after THA and
common polymorphisms in the genes encoding the IL-1
family and IL-6. Using quantitative real-time reverse
transcriptase–polymerase chain reaction (RT-PCR), we
further aimed to determine whether polymorphisms
significantly associated with osteolysis in our population
affect in vitro mRNA expression in human peripheral
blood mononuclear cells (PBMCs) in response to wear
particles.
SUBJECTS AND METHODS
Case–control association study. Study subjects and
phenotyping. The study was approved by the local research
ethics committee, and all subjects provided written, informed
consent prior to participation. White subjects of North European descent were recruited. All had a diagnosis of idiopathic
OA of the hip and had previously received a cemented THA
with a polyethylene-on-metal bearing couple. The exclusion
criteria have been reported elsewhere (21).
The subjects were divided into 2 phenotype groups: an
osteolysis group and a control group. The osteolysis group
comprised subjects with current radiographic evidence of
osteolysis and subjects who had previously undergone revision
for confirmed aseptic loosening. The criteria of Harris and
McGann and those of Harris and Penenberg were used to
define loosening of the femoral or pelvic component, respectively (24,25). Control group subjects had no current evidence
of osteolysis on plain anteroposterior and lateral radiographs
of the hip obtained on the day of genotyping.
The EBRA-Digital method (University of Innsbruck,
Innsbruck, Austria) was used to measure acetabular polyethylene wear on digitized anteroposterior radiographs of the
pelvis, according to a protocol described previously (26). In the
osteolysis subjects, measurements were made using the radiograph obtained immediately prior to revision surgery, and in
the control subjects, the radiograph obtained on the day of
genotyping was used.
Single-nucleotide polymorphism (SNP) selection and
genotyping. Genomic DNA was extracted from whole blood
using the chloroform–ethanol method. Candidate SNPs within
the genes encoding IL-1␣, IL-1␤, IL-1Ra, and IL-6 were
selected using information available in the public databases
dbSNP (http://www.ncbi.nlm.nih.gov/snp/) and HapMap
(http://www.hapmap.org/) according to the following criteria:
1) validated SNPs, 2) minor allele frequency in European
populations ⬎5%, and 3) reported data showing association
with bone diseases from at least 2 independent sources. DNA
was genotyped for the SNPs rs17561 (IL1A ⫹4845), rs4848306
(IL1B ⫺3737), rs16944 (IL1B ⫺511), rs1143634 (IL1B ⫹3954),
rs419598 (IL1RA ⫹2018), and rs1800795 (IL6 ⫺174), using the
TaqMan 5⬘ nuclease method (Applied Biosystems, Warrington, UK). Probes and primer sequences are listed in Table
1. The SNPs rs1800796 (IL6 ⫺572) and rs1800797 (IL6 ⫺597)
were assayed using TaqMan Assay on Demand minor groove
binder probes and primers (Applied Biosystems) (Table 1).
The TaqMan 5⬘ nuclease method reaction mixture
contained 1⫻ Taq polymerase and 0.8 ng/␮l of DNA template
in a final volume of 15 ␮l. The primer concentration varied
between 100 nM and 500 nM, and the probe concentration
varied between 50 nM and 100 nM, following assay optimization. The PCR conditions were heating to 50°C for 2 minutes,
then 95°C for 10 minutes, followed by 40 cycles at 95°C for 15
seconds and 61°C for 1 minute. The TaqMan Assay on
Demand reaction mixture and PCR conditions were prepared
following the manufacturer’s instructions. PCR was performed
on a PTC-200 thermal cycler (MJ Research, Waltham, MA),
and fluorescence detection and genotype identification were
performed using an ABI Prism 7900HT sequence detector
(Applied Biosystems). Repeat genotyping for quality control
in 10% of the subjects revealed 100% concordance.
PBMC stimulation study. Subject selection and phenotyping. This study received separate approval from the local
research ethics committee. All subjects provided written, informed consent prior to participation. We selected a subgroup
of subjects who had participated in both the control and
osteolysis groups of the genotyping population. The exclusion
criteria for this study were any history of active or recent
viral/bacterial infections within the preceding month, current
use of antiinflammatory or immunomodulatory agents, any
history of chronic inflammatory disorders, and current radiographic evidence of osteolysis. Subjects who had previously had
a revision procedure for osteolysis were recruited at least 1
RISK OF OSTEOLYSIS CONFERRED BY POLYMORPHISMS IN THA
3159
Table 1. Sequences of probes and primers for the IL1 gene family SNPs and for RT-PCR*
SNP ID no., site
rs17561, IL1A ⫹4845
rs4848306, IL1B ⫺3737
rs16944, IL1B ⫺511
rs1143634, IL1B ⫹3954
rs419598, IL1RA ⫹2018
rs1800795, IL6 ⫺174
Cytokine
IL-1Ra
␤-actin
Primer sequence
Probe sequence
TGCACTTGTGATCATGGTTTTAGA
TCCTCATAAAGTTGTATTTCACATTGC
CTAAGCCCTCCTTGTTCTAGACCA
CTCTTGGATCCAGGTTCTCAGATT
TTGAGGGTGTGGGTCTCTACCT
AGGAGCCTGAACCCTGCATAC
GCCTGCCCTTCTGATTTTATACC
CATCGTGCACATAAGCCTCGTTA
GGGATGTTAACCAGAAGACCTTCTATCT
CAACCACTCACCTTCTAAATTGACATT
GCTGATTGGAAACCTTATTAAGATTGT
AATGACGACCTAAGCTGCACTTT
AAGCCTAGGTCAGCACCTTTTAGCTTCC
CAAGCCTAGGTCATCACCTTTTAGCTTCC
AATGGAATGTCCCTTGGACTCTGCAT
AATGGAATGTTCCTTGGACTCTGCATG
TTCTCTGCCTCAGGAGCTCTCTGTCA
TTCTCTGCCTCGGGAGCTCTCTGT
CAGAACCTATCTTCTTCGACACATGGGA
TTCAGAACCTATCTTCTTTGACACATGGGA
ACAACCAACTAGTTGCCGGATACTTGC
AACAACCAACTAGTTGCTGGATACTTGCAA
ACGTCCTTTAGCATGGCAAGACACAAC
ACGTCCTTTAGCATCGCAAGACACAAC
TTGAGGGTGTGGGTCTCTACCT
AGGAGCCTGAACCCTGCATAC
GGGATGTTAACCAGAAGACCTTCTATCT
CAACCACTCACCTTCTAAATTGACATT
TTCTCTGCCTCGGGAGCTCTCTGT
AACAACCAACTAGTTGCTGGATACTTGCAA
* Shown are oligonucleotide sequences for TaqMan genotyping (for single-nucleotide polymorphisms [SNPs]) and for TaqMan reverse
transcriptase–polymerase chain reaction (RT-PCR) (for cytokines). Forward primers are shown above reverse primers in primer sequences; TET
probes are shown above FAM probes in probe sequences. The SNPs rs1800796 (IL6 ⫺572) and rs1800797 (IL6 ⫺597) were assayed using TaqMan
Assay on Demand minor groove binder probes and primers (Applied Biosystems, Warrington, UK). The context sequence for SNP rs1800796
(Applied Biosystems assay ID no. C-11326893-10) was ATGGCCAGGCAGTTCTACAACAGCC[C/G]CTCACAGGGAGAGCCAGAACACAGA. The context sequence for SNP rs1800797 (Applied Biosystems assay ID no. C-1839695-20) was TGAAGTAACTGCACGAAATTTGAGG[A/G]TGGCCAGGCAGTTCTACAACAGCCG. IL-1Ra ⫽ interleukin-1 receptor antagonist.
year following any surgical intervention and were free from any
surgical complications. Investigators were blinded to individual
genotypes at the time of subject selection.
PBMC collection and preparation. Peripheral blood was
obtained from all subjects between the hours of 9 AM and 11 AM
following an overnight fast in order to standardize collection
conditions. Thirty milliliters of peripheral blood was diluted
1:2 with Dulbecco’s modified Eagle’s medium (DMEM; Gibco
Life Technologies, Paisley, UK) and layered onto sucrose
solution (Lymphoprep; Axis-Shield, Rodeløkk, Norway).
PBMCs were collected after centrifugation at 800g for 20
minutes at 4°C. PBMCs were washed twice by suspension in
DMEM and centrifugation at 350g for 10 minutes and 5
minutes, respectively. Following the final wash, cells were
suspended in complete growth mixture consisting of DMEM
containing 10% fetal calf serum, 5% L-glutamine, and 1%
penicillin/streptomycin.
Particle preparation and PBMC stimulation. Particles
were supplied as a gift from Dr. E. M. Greenfield (Case
Western Reserve University, Cleveland, OH). Two types of
titanium particles (Johnson Matthey, Ward Hill, MA) had
been prepared according to protocols previously described
(27). These included endotoxin-stripped particles (Ti) and
commercially pure endotoxin-stripped particles with adherent
lipopolysaccharide (LPS) added back (Ti plus LPS). The
protocols for preparation of the 2 types of particles are
described in detail elsewhere, as are their size characteristics
and their ability to induce cytokine production in mononuclear
cells (28,29). High Sensitivity Limulus Amebocyte Lysate assay
(BioWhittaker, Walkersville, MD) confirmed endotoxin levels
of 0 EU/ml and 140 EU/ml for the Ti and Ti plus LPS particles,
respectively.
PBMCs were plated in duplicate in 96-well plates at a
concentration of 5 ⫻ 106/well and were incubated for 2 hours
(in 5% CO2 at 37°C) to allow sedimentation. Cell viability was
confirmed by cell counting with trypan blue exclusion (97%
viability was observed). PBMCs were then incubated with
either Ti or Ti plus LPS particles at a concentration of 830
particles per cell. This particle-to-cell ratio had been previously
found to give maximal mRNA expression with particle stimulation (data not shown). Cells stimulated with endotoxin (100
ng/ml LPS) and unstimulated cells acted as positive and
negative controls, respectively. All stimulations were performed in duplicate. Cells were incubated for 3 hours in 5%
CO2 at 37°C. A preliminary time-course experiment demonstrated that this time point gave the greatest discrimination for
mRNA expression between LPS-stimulated and unstimulated
cells (data not shown).
RNA extraction and quantitation. Following stimulation, culture plates were spun at 2,000 revolutions per minute
for 2 minutes at 4°C, and the cell supernatant was removed.
The cells were then lysed and homogenized using QIA shredder columns (Qiagen, Crawley, UK), and total RNA was
extracted using the RNeasy mini kit (Qiagen) according to the
manufacturer’s instructions. Total RNA was reverse transcribed using a high-capacity complementary DNA (cDNA)
archive kit (Applied Biosystems, Foster City, CA) according to
the manufacturer’s instructions. Primers and probes were
synthesized by BioSource International (Camarillo, CA) and
were designed using PrimerSelect LaserGene software (DNA
Star, Madison, WI) (Table 1). Each quantitative real-time
RT-PCR assay was performed in duplicate in a total volume of
15 ␮l containing 1.5 ␮l cDNA, one-step TaqMan quantitative
real-time RT-PCR Master Mix, primers, and probes. PCR was
3160
GORDON ET AL
Table 2.
Characteristics of the genotype study subjects*
Characteristic
Control group
(n ⫽ 340)
Osteolysis group
(n ⫽ 272)
Age at primary THA, years
No. of men/no. of women
Body mass index, kg/m2
Annual wear rate, median (IQR) mm/year
Osteolysis-free survival, years¶
65 ⫾ 8
142/198
28 ⫾ 5
0.07 (0.05–0.10)
12 ⫾ 4
59 ⫾ 9
148/124
28 ⫾ 5
0.13 (0.08–0.21)
10 ⫾ 5
P
⬍0.001†
⬍0.001‡
⬎0.05†
⬍0.001§
⬍0.001§
* Except where indicated otherwise, values are the mean ⫾ SD. IQR ⫽ interquartile range.
† By Student’s t-test.
‡ By chi-square test.
§ By Mann-Whitney U test.
¶ Osteolysis-free survival for the control group was the time from primary total hip arthroplasty (THA)
surgery to the date of clinical review and genotyping; for the osteolysis group, it was the time from primary
THA surgery to the date of diagnosis of osteolysis.
performed on a PTC-200 thermal cycler. The PCR conditions
were 95°C for 10 minutes, followed by 40 cycles of denaturing
at 95°C for 15 seconds and annealing/extension at 60°C for 1
minute. Detection of PCR products was performed using an
ABI Prism 7900HT sequence detection system. Results were
analyzed using ABI Prism SDS version 2.1 software and
expressed as a ratio to ␤-actin mRNA expression.
Study replication. Blood was obtained from all patients
in duplicate, with a 1-week interval between each venesection.
The experimental stimulation protocol was also followed in
duplicate, with a 1-week interval between stimulations. Results
for mRNA expression for each study were analyzed separately
to confirm the robustness of the findings.
Statistical analysis. All statistical analyses were
2-tailed and were made using SPSS statistical software (SPSS,
Chicago, IL). Between-group comparisons were made using
Student’s t-test for continuous normally distributed variables
and the Mann-Whitney U test for continuous non-normally
distributed variables. The chi-square test with Yates’ correction was used for analysis of allele carriage rates. Odds ratios
(ORs) were calculated from counts of haplotypes estimated
using the expectation-maximization algorithm in Haploview
4.0 (Broad Institute, Cambridge, MA). Results of the mRNA
stimulation assays were analyzed using repeated-measures
analysis of variance (ANOVA), with inclusion of revision
status as a covariate. Messenger RNA expression levels for the
replication study were compared using the Pearson correlation
coefficient for each stimulation condition.
RESULTS
Case–control association study findings. Six hundred twelve subjects were recruited between February
2000 and April 2006, of whom 272 formed the osteolysis
group. Within this group, 147 subjects (54%) had osteolysis around both the pelvic and femoral components,
69 subjects (25%) had osteolysis affecting only the pelvic
component, and 56 subjects (21%) had femoral osteol-
ysis only. Subjects in the osteolysis group were younger,
a greater proportion were men, and they had a higher
median annual rate of polyethylene wear compared with
the control subjects (P ⬍ 0.05 for all comparisons)
(Table 2). Implant wear was measured in 544 subjects
(89%). For the remaining subjects, radiographs were
unavailable or were of insufficient quality for wear
measurements.
Single SNP analysis. The distribution of genotypes
for all SNPs within the control group showed them to be
in Hardy-Weinberg equilibrium (P ⬎ 0.05 by chi-square
test) (Table 3). In the osteolysis group, all SNPs were in
Hardy-Weinberg equilibrium (P ⬎ 0.05 by chi-square
test) except for SNP rs419598 (P ⫽ 0.01 by chi-square
test) (Table 3). Repeat genotyping using TaqMan in
75% of this population and direct sequencing in a
nonselective subgroup of 35 subjects showed 100%
concordance with the original genotyping calls.
The genotype distribution for SNP rs419598 differed between control and osteolysis groups (P ⫽ 0.007
by chi-square test). Carriage of the IL1RA ⫹2018C
allele was underrepresented in the osteolysis group
compared with the control group (P ⫽ 0.01 by chi-square
test) (Table 3). The OR for osteolysis associated with
carriage of the IL1RA ⫹2018C allele was 0.66 (95%
confidence interval [95% CI] 0.48–0.91) (P ⫽ 0.012).
After adjustment for the effects of other significant
covariates (age, sex, polyethylene wear, and osteolysisfree survival) using multiple logistic regression analysis,
the OR for osteolysis associated with carriage of the
IL1RA ⫹2018C allele was 0.69 (95% CI 0.48–0.99) (P ⫽
0.048). No significant differences in genotype or OR
were observed between the THA groups for the remaining IL1 or IL6 SNPs (P ⬎ 0.05) (Table 3).
RISK OF OSTEOLYSIS CONFERRED BY POLYMORPHISMS IN THA
Table 3. Genotype distribution and minor allele carriage rates for
the studied SNPs in subjects with osteolysis versus control subjects*
Genotype frequency
SNP ID no./site,
alleles
rs17561/IL1A ⫹4845
G/G
G/T
T/T
rs4848306/IL1B ⫺3737
C/C
C/T
T/T
rs16944/IL1B ⫺511
C/C
C/T
T/T
rs1143634/IL1B ⫹3954
C/C
C/T
T/T
rs419598/IL1RA ⫹2018
T/T
T/C
C/C
rs1800797/IL6 ⫺597
G/G
G/A
A/A
rs1800796/IL6 ⫺572
G/G
G/C
C/C
rs1800795/IL6 ⫺174
G/G
G/C
C/C
Minor allele
carriage rate, %
Control Osteolysis Control Osteolysis
group
group
group
group
(n ⫽ 340) (n ⫽ 272) (n ⫽ 340) (n ⫽ 272)
159
144
36
136
110
22
53
49
93
172
75
69
139
63
73
75
164
141
34
128
110
31
52
52
184
137
18
159
94
16
46
41
180†
134
26
171
74
26
47‡
37
125
149
65
90
119
60
63
67
308
30
0
240
30
0
9
11
122
164
54
89
135
47
64
67
* The genotype distributions within each group were in HardyWeinberg equilibrium (P ⬎ 0.05 by chi-square test), with the exception
of the osteolysis group for the single-nucleotide polymorphism (SNP)
rs419598 (P ⫽ 0.01 by chi-square test).
† P ⫽ 0.007 versus osteolysis group, by chi-square test.
‡ P ⫽ 0.01 versus osteolysis group, by chi-square test.
Haplotype analysis. Thirteen haplotypes (haplotype frequency range 32–1%) for the IL1 family SNPs
and 6 haplotypes (haplotype frequency range 53–1.5%)
for the IL6 SNPs were analyzed using Haploview 4.0.
The least frequent IL6 haplotype (–174G/–572G/–597A)
was associated with osteolysis (2.4% in the osteolysis
group versus 0.8% in the control group; P ⫽ 0.02,
calculated using Haploview software) (Table 4). No
other IL6 or IL1 haplotypes were associated with osteolysis.
PBMC stimulation study findings. Sixty subjects
(mean ⫾ SD age 75 ⫾ 6 years, 30 men and 30 women)
3161
were recruited. The IL1RA ⫹2018 (rs419598) genotype
distributions in this cohort were 33 with TT, 21 with CT,
and 6 with CC (in Hardy-Weinberg equilibrium, P ⬎
0.05). For both visit 1 and visit 2 PBMC stimulations,
there was an allele–dose relationship between the number of copies of the C allele (0, 1, or 2) and increasing
IL-1Ra mRNA expression (P ⫽ 0.023 by ANOVA at
visit 1, P ⫽ 0.031 by ANOVA at visit 2, P ⫽ 0.033 by
ANOVA for the combined data set) (Figure 1). Post hoc
analysis within the repeated-measures ANOVA for the
combined data set (Figure 1, bottom panel) gave a
pooled mean ⫾ SEM estimate for mRNA expression
(relative to ␤-actin) of 0.51 ⫾ 0.04 for the TT genotype,
0.57 ⫾ 0.05 for the CT genotype, and 0.81 ⫾ 0.10 for the
CC genotype. IL-1Ra mRNA expression for the CC
genotype was significantly greater than that for the TT
genotype (P ⫽ 0.01 by ANOVA, after Bonferroni correction), but the significance of the difference between
the CC and CT genotypes was borderline (P ⫽ 0.07 by
ANOVA, after Bonferroni correction).
An increase in IL-1Ra mRNA expression at 3
hours occurred following PBMC stimulation with all 3
agonists (LPS, Ti, and Ti plus LPS) compared with
unstimulated PBMCs for the subjects at visit 1 (P ⬍ 0.01
for all comparisons, by post hoc analysis with Bonferroni
correction). A similar pattern was replicated at the visit
2 PBMC stimulations (P ⬍ 0.01 for all comparisons).
Revision status was not a predictor of IL-1Ra mRNA
expression levels independent of rs419598 C allele copy
number (n ⫽ 28 controls, n ⫽ 32 with previous revision;
P ⬎ 0.05 by ANOVA for both visits).
IL-1Ra mRNA expression for individual subjects
was highly reproducible between stimulation studies
(visit 1 and visit 2) for each stimulation condition.
Pearson correlation coefficients (r) for mRNA expression between visit 1 and visit 2 for unstimulated cells and
cells stimulated with LPS, Ti, or Ti plus LPS were 0.69,
Table 4. IL6 haplotype frequencies in the osteolysis group versus the
control group*
Haplotype
IL6 ⫺174/⫺572/⫺597
Haplotype
frequency
Haplotype frequency
osteolysis group:
control group
P
G/G/G
C/G/A
G/C/G
G/C/A
C/G/G
G/G/A
0.528
0.391
0.028
0.019
0.016
0.015
0.50:0.55
0.40:0.39
0.03:0.03
0.02:0.02
0.018:0.014
0.024:0.008
⬎0.05
⬎0.05
⬎0.05
⬎0.05
⬎0.05
0.02
* Data are not shown for IL1 family haplotypes (all P ⬎ 0.05).
3162
GORDON ET AL
Genotype/phenotype mRNA expression analyses
were not conducted for the IL6 haplotype –174G/
–572G/–597A that was associated with osteolysis in the
case–control association study, since this haplotype was
insufficiently frequent in the population to conduct
PBMC stimulation assays. Genotype/phenotype mRNA
expression analyses were not performed for IL1A and
IL1B, since no significant associations between genotype
and phenotype were identified in the case–control association study.
DISCUSSION
Figure 1. Effect of IL1RA ⫹2018 (rs419598) genotype on in vitro
expression of mRNA for interleukin-1 receptor antagonist (IL-1Ra) in
peripheral blood mononuclear cells obtained from 60 subjects who had
undergone total hip arthroplasty. Data are shown as box plots. Each box
represents the 25th to 75th percentiles. Lines outside the boxes represent
the minimum and maximum values. Lines inside the boxes represent the
median. Top, Results at subject visit 1; middle, results at subject visit 2;
bottom, combined results of both visit data sets. The comparison variable
is mRNA expression between the genotypes TT, CT, and CC across all
conditions of stimulation, analyzed by repeated-measures analysis of
variance (ANOVA). LPS ⫽ lipopolysaccharide; Ti ⫽ titanium.
0.64, 0.70, and 0.68, respectively (P ⬍ 0.001 for all
correlations) (Figure 2).
In this study we examined the association of SNPs
in the IL1 gene family and in the IL6 gene with osteolysis
after cemented THA. We found that the less common C
allele at SNP rs419598 (IL1RA ⫹2018), which encodes
the antiinflammatory cytokine IL-1Ra, was negatively
associated with osteolysis. We also examined the relationship between alleles of SNP rs419598 and mRNA
expression in stimulated PBMCs obtained from a clinically relevant population of patients who had undergone
THA, comprising subjects without osteolysis and subjects who had previously expressed the osteolysis phenotype. Compared with the TT genotype, the CC genotype
at rs419598 was associated with increased IL-1Ra
mRNA production in response to PBMC stimulation.
This effect was repeatable between subject attendances
and robust to different stimulation conditions.
A rare haplotype within the gene for IL-6
(–174G/–572G/–597A, with a frequency of ⬍5% in our
population) was positively associated with osteolysis.
However, this haplotype was insufficiently common to
allow a PBMC stimulation study to be conducted. Our
findings with respect to IL-6 are, however, consistent
with a preliminary report by Kolundzic et al, who found
that the individual SNPs at –572 and –597 were not
associated with osteolysis (22), although they found that
a compound genotype comprising –572CC and –597GA
was associated with osteolysis.
The SNP rs419598 (IL1RA ⫹2018) is associated
with several chronic inflammatory conditions including
Sjögren’s syndrome, alopecia areata, and atherosclerosis
(30–32). It is also associated with pathologies of bone
and joints, including osteoporotic fracture (33), and with
susceptibility to RA (34,35). Our finding that alleles of
this SNP are associated with differential mRNA expression does not, however, give evidence of a direct effect of
the alleles on mRNA transcription or mRNA stability.
This variant is a synonymous SNP in exon 2 of the
IL1RA gene, and Clay et al have reported that this SNP
has no effect on mRNA levels in the human keratinocyte
RISK OF OSTEOLYSIS CONFERRED BY POLYMORPHISMS IN THA
3163
Figure 2. Pearson correlation coefficients comparing IL-1Ra mRNA production between visit 1 and visit
2 in peripheral blood mononuclear cells obtained from 60 subjects who had undergone total hip
arthroplasty. All stimulations were performed independently at each visit. See Figure 1 for definitions.
cell population (36). The C allele at this site is in 100%
linkage disequilibrium with allele 2 of a variable-number
tandem repeat (VNTR) in intron 2 of the IL1RA gene
(36). The region surrounding the VNTR contains 3
putative protein binding sites—an interferon-␣ (IFN␣)
silencer, an IFN␤ silencer, and an acute-phase response
element—and this polymorphism may affect binding of
transcription factors to these regulatory elements, or it
may affect RNA stability (37).
Several studies have investigated the relationship
between the IL1RA VNTR or IL1RA ⫹2018 polymorphism and IL-1Ra mRNA or protein production.
Wilkinson et al found that carriage of this allele resulted
in an almost 2-fold increase in IL-1Ra mRNA induction
in LPS-stimulated PBMCs compared with PBMCs carrying only the T allele at this site (38), and this is
consistent with our study findings. Schrijver et al found
an allele dose-response relationship between C allele
copy number and IL-1Ra protein production in human
whole blood stimulated with LPS (39). Danis et al have
also described an association between this allele and
increased IL-1Ra protein production by monocytes from
healthy human subjects in response to granulocyte–
macrophage colony-stimulating factor stimulation (40).
However, this allele has also been associated in other
studies with decreased mRNA or protein expression
(41,42). These conflicting results may, however, reflect
differences in mechanisms between the diseases studied,
between pathologic and physiologic conditions, and between the in vivo and in vitro environment. Further
functional studies in this area are warranted to define
the potential role of this allelic variant on bone resorption activity in clinically relevant in vitro models of
particle-induced osteolysis.
Further, at an epidemiologic level, recent advances in medical imaging of osteolytic lesions using
computed tomography and magnetic resonance imaging
allow accurate volumetric measurement of osteolytic
lesions in relation to implant wear (43,44). These techniques may be applied to evaluating the effect of identified allelic variants on the severity of osteolysis in
prospective studies in vivo, and to quantitating the
3164
GORDON ET AL
interaction between wear rate and genotype in the
pathogenesis of osteolysis.
In conclusion, we have shown that carriage of the
IL1RA ⫹2018C allele appears to protect against osteolysis after cemented THA, and that this allele is positively
associated with IL-1Ra mRNA production in response
to clinically relevant stimuli, which may provide a mechanistic explanation for the observed association. At
present, the functional role of the IL1RA ⫹2018 polymorphism in relation to the IL1RA intron 2 VNTR
remains unclear. However, the finding that the ⫹2018C
allele is overrepresented in patients with surviving THA
implants compared with those with osteolysis supports
the importance of the IL1 gene cluster family in osteolysis and aseptic loosening.
AUTHOR CONTRIBUTIONS
Dr. Wilkinson had full access to all of the data in the study
and takes responsibility for the integrity of the data and the accuracy
of the data analysis.
Study design. Gordon, Kiss-Toth, Stockley, Eastell, Wilkinson.
Acquisition of data. Gordon, Wilkinson.
Analysis and interpretation of data. Gordon, Kiss-Toth, Wilkinson.
Manuscript preparation. Gordon, Kiss-Toth, Stockley, Eastell,
Wilkinson.
Statistical analysis. Gordon, Wilkinson.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
REFERENCES
1. Goldring SR, Jasty M, Roelke MS, Rourke CM, Bringhurst FR,
Harris WH. Formation of a synovial-like membrane at the
bone–cement interface: its role in bone resorption and implant
loosening after total hip replacement. Arthritis Rheum 1986;29:
836–42.
2. Chiba J, Rubash HE, Kim KJ, Iwaki Y. The characterization of
cytokines in the interface tissue obtained from failed cementless
total hip arthroplasty with and without femoral osteolysis. Clin
Orthop Relat Res 1994;300:304–12.
3. Shanbhag AS, Jacobs JJ, Black J, Galante JO, Glant TT. Cellular
mediators secreted by interfacial membranes obtained at revision
total hip arthroplasty. J Arthroplasty 1995;10:498–506.
4. Goodman SB, Chin RC, Chiou SS, Schurman DJ, Woolson ST,
Masada MP. A clinical-pathologic-biochemical study of the membrane surrounding loosened and nonloosened total hip arthroplasties. Clin Orthop Relat Res 1989;244:182–7.
5. Jiranek WA, Machado M, Jasty M, Jevsevar D, Wolfe HJ,
Goldring SR, et al. Production of cytokines around loosened
cemented acetabular components: analysis with immunohistochemical techniques and in situ hybridization. J Bone Joint Surg
Am 1993;75:863–79.
6. Stea S, Visentin M, Granchi D, Ciapetti G, Donati ME, Sudanese
A, et al. Cytokines and osteolysis around total hip prostheses.
Cytokine 2000;12:1575–9.
7. Kim KJ, Hijikata H, Itoh T, Kumegawa M. Joint fluid from
patients with failed total hip arthroplasty stimulates pit formation
by mouse osteoclasts on dentin slices. J Biomed Mater Res
1998;43:234–40.
8. Hicks DG, Judkins AR, Sickel JZ, Rosier RN, Puzas JE, O’Keefe
RJ. Granular histiocytosis of pelvic lymph nodes following total
hip arthroplasty: the presence of wear debris, cytokine production,
19.
20.
21.
22.
23.
24.
25.
and immunologically activated macrophages. J Bone Joint Surg
Am 1996;78:482–96.
Gowen M, Wood DD, Ihrie EJ, McGuire MK, Russell RG. An
interleukin 1 like factor stimulates bone resorption in vitro. Nature
1983;306:378–80.
Suda T, Nakamura I, Jimi E, Takahashi N. Regulation of osteoclast function. J Bone Miner Res 1997;12:869–79.
Slack J, McMahan CJ, Waugh S, Schooley K, Spriggs MK, Sims
JE, et al. Independent binding of interleukin-1␣ and interleukin-1␤ to type I and type II interleukin-1 receptors. J Biol Chem
1993;268:2513–24.
Jilka RL, Hangoc G, Girasole G, Passeri G, Williams DC, Abrams
JS, et al. Increased osteoclast development after estrogen loss:
mediation by interleukin-6. Science 1992;257:88–91.
Grey A, Mitnick MA, Masiukiewicz U, Sun BH, Rudikoff S, Jilka
RL, et al. A role for interleukin-6 in parathyroid hormone-induced
bone resorption in vivo. Endocrinology 1999;140:4683–90.
Furnes O, Lie SA, Espehaug B, Vollset SE, Engesaeter LB,
Havelin LI. Hip disease and the prognosis of total hip replacements: a review of 53,698 primary total hip replacements reported
to the Norwegian Arthroplasty Register 1987–99. J Bone Joint
Surg Br 2001;83:579–86.
Gruica B, Wang HY, Lang NP, Buser D. Impact of IL-1 genotype
and smoking status on the prognosis of osseointegrated implants.
Clin Oral Implants Res 2004;15:393–400.
Moffett SP, Zmuda JM, Cauley JA, Stone KL, Nevitt MC, Ensrud
KE, et al. Association of the G-174C variant in the interleukin-6
promoter region with bone loss and fracture risk in older women.
J Bone Miner Res 2004;19:1612–8.
Timms AE, Crane AM, Sims AM, Cordell HJ, Bradbury LA,
Abbott A, et al. The interleukin 1 gene cluster contains a major
susceptibility locus for ankylosing spondylitis. Am J Hum Genet
2004;75:587–95.
Chen HY, Chen WC, Wu MC, Tsai FJ, Lin CC. Interleukin-1␤
and interleukin-1 receptor antagonist gene polymorphism in postmenopausal women: correlation to bone mineral density and
susceptibility to osteoporosis. Maturitas 2003;44:49–54.
Stern AG, de Carvalho MR, Buck GA, Adler RA, Rao TP, Disler
D, et al, and members of the I-NODAL network (Investigation of
Nodal Osteoarthritis to Detect an Association with Loci encoding
IL-1). Association of erosive hand osteoarthritis with a single
nucleotide polymorphism on the gene encoding interleukin-1␤.
Osteoarthritis Cartilage 2003;11:394–402.
Cvetkovic JT, Wallberg-Jonsson S, Stegmayr B, Rantapaa-Dahlqvist S, Lefvert AK. Susceptibility for and clinical manifestations
of rheumatoid arthritis are associated with polymorphisms of the
TNF-␣, IL-1␤, and IL-1Ra genes. J Rheumatol 2002;29:212–9.
Wilkinson JM, Wilson AG, Stockley I, Scott IR, Macdonald DA,
Hamer AJ, et al. Variation in the TNF gene promoter and risk of
osteolysis after total hip arthroplasty. J Bone Miner Res 2003;18:
1995–2001.
Kolundzic R, Orlic D, Trkulja V, Pavelic K, Troselj KG. Single
nucleotide polymorphisms in the interleukin-6 gene promoter,
tumor necrosis factor-␣ gene promoter, and transforming growth
factor-␤1 gene signal sequence as predictors of time to onset of
aseptic loosening after total hip arthroplasty: preliminary study.
J Orthop Sci 2006;11:592–600.
Gordon A, Southam L, Loughlin J, Wilson AG, Stockley I, Hamer
AJ, et al. Variation in the secreted frizzled-related protein-3 gene
and risk of osteolysis and heterotopic ossification after total hip
arthroplasty. J Orthop Res 2007;25:1665–70.
Harris WH, McGann WA. Loosening of the femoral component
after use of the medullary-plug cementing technique: follow-up
note with a minimum five-year follow-up. J Bone Joint Surg Am
1986;68:1064–6.
Harris WH, Penenberg BL. Further follow-up on socket fixation
using a metal-backed acetabular component for total hip replacement: a minimum ten-year follow-up study. J Bone Joint Surg Am
1987;69:1140–3.
RISK OF OSTEOLYSIS CONFERRED BY POLYMORPHISMS IN THA
26. Wilkinson JM, Hamer AJ, Elson RA, Stockley I, Eastell R.
Precision of EBRA-Digital software for monitoring implant migration after total hip arthroplasty. J Arthroplasty 2002;17:910–6.
27. Bi Y, Seabold JM, Kaar SG, Ragab AA, Goldberg VM, Anderson
JM, et al. Adherent endotoxin on orthopedic wear particles
stimulates cytokine production and osteoclast differentiation.
J Bone Miner Res 2001;16:2082–91.
28. Ragab AA, Van De Motter R, Lavish SA, Goldberg VM, Ninomiya JT, Carlin CR, et al. Measurement and removal of
adherent endotoxin from titanium particles and implant surfaces.
J Orthop Res 1999;17:803–9.
29. Bi Y, Collier TO, Goldberg VM, Anderson JM, Greenfield EM.
Adherent endotoxin mediates biological responses of titanium
particles without stimulating their phagocytosis. J Orthop Res
2002;20:696–703.
30. Perrier S, Coussediere C, Dubost JJ, Albuisson E, Sauvezie B. IL-1
receptor antagonist (IL-1RA) gene polymorphism in Sjögren’s
syndrome and rheumatoid arthritis. Clin Immunol Immunopathol
1998;87:309–13.
31. Tazi-Ahnini R, Cox A, McDonagh AJ, Nicklin MJ, di Giovine FS,
Timms JM, et al. Genetic analysis of the interleukin-1 receptor
antagonist and its homologue IL-1L1 in alopecia areata: strong
severity association and possible gene interaction. Eur J Immunogenet 2002;29:25–30.
32. Worrall BB, Azhar S, Nyquist PA, Ackerman RH, Hamm TL,
DeGraba TJ. Interleukin-1 receptor antagonist gene polymorphisms in carotid atherosclerosis. Stroke 2003;34:790–3.
33. Langdahl BL, Lokke E, Carstens M, Stenkjaer LL, Eriksen EF.
Osteoporotic fractures are associated with an 86-base pair repeat
polymorphism in the interleukin-1–receptor antagonist gene but
not with polymorphisms in the interleukin-1␤ gene. J Bone Miner
Res 2000;15:402–14.
34. Lee YH, Kim HJ, Rho YH, Choi SJ, Ji JD, Song GG. Interleukin-1 receptor antagonist gene polymorphism and rheumatoid
arthritis. Rheumatol Int 2004;24:133–6.
35. Kaijzel EL, van Dongen H, Bakker AM, Breedveld FC, Huizinga
TW, Verweij CL. Relationship of polymorphisms of the interleu-
36.
37.
38.
39.
40.
41.
42.
43.
44.
3165
kin-1 gene cluster to occurrence and severity of rheumatoid
arthritis. Tissue Antigens 2002;59:122–6.
Clay FE, Tarlow JK, Cork MJ, Cox A, Nicklin MJ, Duff GW.
Novel interleukin-1 receptor antagonist exon polymorphisms and
their use in allele-specific mRNA assessment. Hum Genet 1996;
97:723–6.
Tarlow JK, Blakemore AI, Lennard A, Solari R, Hughes HN,
Steinkasserer, et al. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp
tandem repeat. Hum Genet 1993;91:403–4.
Wilkinson RJ, Patel P, Llewelyn M, Hirsch CS, Pasvol G, Snounou
G, et al. Influence of polymorphism in the genes for the interleukin (IL)-1 receptor antagonist and IL-1␤ on tuberculosis. J Exp
Med 1999;189:1863–74.
Schrijver HM, van As J, Crusius JB, Dijkstra CD, Uitdehaag BM.
Interleukin (IL)-1 gene polymorphisms: relevance of disease severity associated alleles with IL-1␤ and IL-1ra production in
multiple sclerosis. Mediators Inflamm 2003;12:89–94.
Danis VA, Millington M, Hyland VJ, Grennan D. Cytokine
production by normal human monocytes: inter-subject variation
and relationship to an IL-1 receptor antagonist (IL-1Ra) gene
polymorphism. Clin Exp Immunol 1995;99:303–10.
Carter MJ, Jones S, Camp NJ, Cox A, Mee J, Warren B, et al.
Functional correlates of the interleukin-1 receptor antagonist gene
polymorphism in the colonic mucosa in ulcerative colitis. Genes
Immun 2004;5:8–15.
Rafiq S, Stevens K, Hurst AJ, Murray A, Henley W, Weedon MN,
et al. Common genetic variation in the gene encoding interleukin1-receptor antagonist (IL-1RA) is associated with altered circulating IL-1RA levels. Genes Immun 2007;8:344–51.
Looney RJ, Boyd A, Totterman S, Seo GS, Tamez-Pena J,
Campbell D, et al. Volumetric computerized tomography as a
measurement of periprosthetic acetabular osteolysis and its correlation with wear. Arthritis Res 2002;4:59–63.
Walde TA, Weiland DE, Leung SB, Kitamura N, Sychterz CJ,
Engh CA Jr, et al. Comparison of CT, MRI, and radiographs in
assessing pelvic osteolysis: a cadaveric study. Clin Orthop Relat
Res 2005;437:138–44.
Документ
Категория
Без категории
Просмотров
3
Размер файла
113 Кб
Теги
osteolysis, hip, tota, patients, affects, polymorphism, antagonisms, interleukin, genes, receptov, risk, arthroplasty
1/--страниц
Пожаловаться на содержимое документа