close

Вход

Забыли?

вход по аккаунту

?

Type I collagen ╨Ю┬▒1 Sp1 transcription factor binding site polymorphism is associated with reduced risk of hip osteoarthritis defined by severe joint space narrowing in elderly women.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 52, No. 5, May 2005, pp 1431–1436
DOI 10.1002/art.21011
© 2005, American College of Rheumatology
Type I Collagen ␣1 Sp1 Transcription Factor Binding Site
Polymorphism Is Associated With Reduced Risk of
Hip Osteoarthritis Defined by Severe Joint Space Narrowing
in Elderly Women
K. Lian,1 J. M. Zmuda,2 M. C. Nevitt,1 L. Lui,1 M. C. Hochberg,3 D. Greene,4 J. Li,4
J. Wang,4 and N. E. Lane1
severe JSN (score >3), and 131 (23%) had moderate or
moderate-to-severe femoral osteophytosis (score >2).
There was no association of the T/T genotype with either
radiographic hip OA or radiographic hip OA characterized by osteophytosis. For radiographic OA of the hip
characterized by moderate-to-severe JSN, the odds of
disease were significantly reduced among subjects with
the T/T compared with the G/G genotype (OR 0.30, 95%
CI 0.11–0.81, P ⴝ 0.02) and did not change after
adjustment for potential confounders (OR 0.36, 95% CI
0.13–0.99, P ⴝ 0.048).
Conclusion. The T/T genotype of the COL1A1 Sp1
polymorphism was associated with a reduced risk of
radiographic OA of the hip characterized by JSN. This
association should be confirmed in other populations to
determine if mechanistic studies are warranted.
Objective. A common G/T substitution at an Sp1
binding site in intron 1 of the COL1A1 gene has been
reported to be associated with reduced bone mineral
density and increased risk of osteoporotic fracture. The
purpose of this study was to examine whether there is an
association between COL1A1 Sp1 polymorphism and
radiographic osteoarthritis (OA) of the hip in elderly
women in the Study of Osteoporotic Fractures.
Methods. Radiographic hip OA status of subjects
was defined by the presence of 1 of the following criteria
in either hip: a joint space narrowing (JSN) score of >3,
a Croft summary grade of >3, or both definite (score
>2) osteophytes and JSN in the same hip. Cases of
radiographic OA of the hip were further subdivided into
those with JSN score >3 and those with a femoral
osteophyte score >2 and JSN score <2. The COL1A1
Sp1 polymorphism was genotyped using allele-specific
kinetic polymerase chain reaction in 4,746 women.
Multivariate logistic regression was performed to estimate odds ratios (ORs) and 95% confidence intervals
(95% CIs).
Results. Radiographic OA of the hip was present
in 571 women (12%). Of these patients, 325 (57%) had
The prevalence of symptomatic osteoarthritis
(OA) of the hip is ⬃3% among adults 30 years and older
in the US, and accounts for a significant health care
burden (1). Multiple risk factors for OA of the hip,
including age, obesity, joint injury, occupational factors,
sex, and ethnicity, among others, have been well established (1). Furthermore, it is also known that genetic
factors play a strong role in the development of hip OA.
Several twin and family studies (2,3) have demonstrated
a significantly increased risk for OA of the hip among
siblings of affected individuals. In addition, genomewide scans, fine-scale mapping, and other association
analyses have identified several loci that may be associated with OA of the hip (2,3).
Recently, type I collagen ␣1 (COL1A1) has
emerged as a candidate gene of interest in OA (3). Type
I collagen is a heterotrimer consisting of 2 ␣1 chains and
1 ␣2 chain, and is the major protein in bone (4). The
Supported by the NIH (grants 1R01-AG-05407 and 1R01AR-40431), the Doris Duke Clinical Research Fellowship Program for
Medical Students (grant 20000684), and the Rosalind Russell Arthritis
Research Foundation.
1
K. Lian, MS, M. C. Nevitt, PhD, L. Lui, MA, MS, N. E. Lane,
MD: University of California at San Francisco; 2J. M. Zmuda, PhD:
University of Pittsburgh, Pittsburgh, Pennsylvania; 3M. C. Hochberg,
MD: University of Maryland, Baltimore; 4D. Greene, MD, J. Li, PhD,
J. Wang, MS: Roche Molecular Systems, Alameda, California.
Address correspondence and reprint requests to N. E. Lane,
MD, Division of Rheumatology, Department of Medicine, University
of California at Davis and San Francisco, PO Box 589, Burlingame, CA
94011. E-mail: nancy.lane@ucdmc.ucdavis.edu.
Submitted for publication August 24, 2004; accepted in
revised form January 25, 2005.
1431
1432
LIAN ET AL
gene encoding COL1A1 is an important candidate for
the regulation of bone metabolism and bone mass, and
mutations in this gene are known to cause osteogenesis
imperfecta (4). Grant and colleagues have identified a
G-to-T polymorphism in a transcription factor binding
site for Sp1 in the first intron of the COL1A1 gene (5).
Several studies have examined the relationship of this
polymorphism to bone mineral density (BMD), osteoporosis, and fracture (5–8). In addition, higher adjusted
BMD increases the risk of OA of the hip (9–11).
Studies of the association of the COL1A1 Sp1
polymorphism and OA have produced conflicting results, with one showing a positive association with OA of
the knee and hip (12) and two showing a lack of an
association with OA of the spine and hip (3,13). However, the studies may have been underpowered to detect
significant associations. Since the material properties of
the subchondral bone are believed to be associated with
both the development and the progression of OA (14),
and the COL1A1 Sp1 polymorphism increases the risk
of osteoporosis due to changes in both bone composition
and bone strength (7), we hypothesized that subjects
with the COL1A1 Sp1 polymorphism might have a
different risk for OA of the hip. To test this hypothesis,
we examined the association between the COL1A1 Sp1
binding site polymorphism and radiographic OA of the
hip in a large cohort of older postmenopausal women, in
an effort to further elucidate the role of COL1A1 in the
pathogenesis of OA of the hip.
PATIENTS AND METHODS
Study population. All subjects were participants in the
Study of Osteoporotic Fractures (SOF), a multicenter cohort
study initiated in 1986 to determine risk factors for osteoporotic fractures in elderly women (15). Participants were all age
65 or older at baseline and were recruited from populationbased listings at 4 clinical centers in the US: Baltimore, MD,
Minneapolis, MN, Monongahela Valley, PA (near Pittsburgh),
and Portland, OR. Exclusion criteria for the parent study (the
SOF) included bilateral hip replacement and an inability to
walk unassisted; African American women were excluded
because of their low risk of hip fracture. The study was
approved by the institutional review board at each of the
institutions involved, and all subjects provided written informed consent at enrollment and at each clinical examination.
Buffy coat specimens were collected from a total of
6,975 participants at either visit 2 (1989–1990) or visit 6
(1997–1998), and genotyping was performed in all women who
provided adequate consent for genetic studies (Figure 1).
Bilateral anteroposterior pelvic radiographs were obtained at
baseline and at visit 5 (mean 8.3 years of followup) (16). The
present analysis used only the visit-5 radiograph to evaluate
radiographic OA of the hip for this study.
Figure 1. Flow chart of the study subjects. SOF ⫽ Study of Osteoporotic Fractures; OA ⫽ osteoarthritis; JSN ⫽ joint space narrowing.
COL1A1 genotyping. Genotyping was performed with
Axys Sequana on DNA from 3,501 subjects using a TaqMan
assay with a standardized protocol, performed on an ABI 7700
(Perkin Elmer, Emeryville, CA). The following primers and
probes were utilized (17): forward primer AATCAGCCGCTCCCATTCTCCTA, reverse primer GGAGGGCGAGGGAGGAGAGAA, G2046 probe (FAM fluorophore)
TCATCCCGCCCCCATTCCCTG, 2046T probe (TET fluorophore) TCATCCCGCCCACATTCCCTGG.
An additional 3,247 samples were genotyped at Roche
Molecular Systems for COL1A1G2046T by allele-specific
kinetic-method polymerase chain reaction as described by
Germer et al (18), with the modification of using a single
sample for each reaction. The 2 allele-specific primers and 1
common primer used were as follows: allele-specific G2046
CTGCCCAGGGAATGG, allele-specific 2046T CCTGCCCAGGGAATGT, common primer AAGGGAGGTCCAGCCCTCAT.
Amplification reactions were run in GeneAmp 5700
Sequence Detection Systems (SDS) instruments (PE Biosystems, Foster City, CA). The cycle at which the relative
fluorescence reached a threshold of 0.5, using the SDS software from PE Biosystems, was defined as Ct. The Ct of each
amplification reaction was determined, and the difference
between the Ct for allele 1 and that for allele 2 (⌬Ct) was used
as the assay result. Samples with ⌬Ct results between ⫺3.0 and
3.0 were considered heterozygous (G/T). Samples with ⌬Ct
results below ⫺3.0 were considered homozygous for the major
allele (G/G), and samples with ⌬Ct results above 3.0 were
considered homozygous for the minor allele (T/T).
Since genotyping was performed in 2 different settings
HIP OA, COL1A1, AND GENETICS
Table 1.
1433
Characteristics of the study subjects*
Characteristic
Radiographic hip
OA cases
(n ⫽ 571)
Controls
(n ⫽ 4,175)
P
79.6 ⫾ 5.0
157.6 ⫾ 6.3
66.3 ⫾ 12.8
26.7 ⫾ 5.0
4.4
462.2 ⫾ 548.3
48.4 ⫾ 5.4
17.9
48.0
46.1
73.7
78.4 ⫾ 4.6
157.8 ⫾ 6.2
66.2 ⫾ 12.9
26.6 ⫾ 4.8
4.8
570.2 ⫾ 636.9
48.3 ⫾ 5.6
19.0
47.9
50.0
81.0
⬍0.01
0.51
0.88
0.47
0.66
⬍0.01
0.68
0.51
0.96
0.08
⬍0.01
0.74 ⫾ 0.13
0.67 ⫾ 0.14
0.37 ⫾ 0.10
0.73 ⫾ 0.14
0.62 ⫾ 0.11
0.37 ⫾ 0.09
0.61
⬍0.01
0.14
Age, years
Height, cm
Weight, kg
BMI, kg/m2
Current smoker, %
Physical activity (walking), kcal/week
Age at menopause, years
Current estrogen use, %
Current vitamin D use, %
Calcium supplement use, %
Health status, good/excellent, %
Areal BMD by DXA, gm/cm2
Total hip
Femoral neck
Calcaneal
Genotype frequency, %
G/G
G/T
T/T
66.8
30.0
3.2
65.3
30.9
3.8
* Except where indicated otherwise, values are the mean ⫾ SD. P values were determined by chi-square
test for dichotomous variables and by Student’s t-test for continuous variables. OA ⫽ osteoarthritis;
BMI ⫽ body mass index; BMD ⫽ bone mineral density; DXA ⫽ dual x-ray absorptiometry.
with different protocols, 40 subjects were genotyped by both
methods and sequenced, with 100% agreement.
Radiographic assessments. Details of radiographic
scoring methods for hip OA have been described previously
(9,16). Subjects were considered to have radiographic hip OA
if they satisfied at least 1 of 3 criteria: joint space narrowing
(JSN) score ⱖ3, Croft summary grade ⱖ3 (ⱖ3 individual
radiographic features), or both definite (score ⱖ2) osteophytes
and JSN in the same hip. Controls (no radiographic hip OA)
were subjects who had no findings of hip OA on the visit-5
radiograph. For the present study, subjects with a diagnosis of
rheumatoid arthritis, Paget’s disease of bone, or bilateral hip
fractures were excluded from this analysis (14). In this study, 32
subjects had unilateral total hip replacements (THRs). For
these subjects, we used the contralateral hip (non-THR hip) to
define radiographic hip OA from the visit-5 radiograph.
In addition, we further characterized patients with
radiographic hip OA into those with JSN score ⱖ3 (n ⫽ 325)
and those with a femoral osteophyte score of ⱖ2 and a JSN
score ⱕ2 (n ⫽ 131), to try to further assess radiographic OA of
the hip by phenotype (Figure 1). Reproducibility was good,
with kappa scores for interrater reliability of 0.66 for definite
JSN (score ⱖ2), 0.71 for definite osteophytes, and 0.65 for
summary grades ⱖ2. The intraclass correlation coefficient was
0.85 for the continuous measurement of minimal joint space
(9,16).
Covariate assessment. All study participants completed a self-administered questionnaire at the baseline and
followup visits that included age, self-reported health status,
current medication use (including multivitamins and other
supplements), daily physical activity, and smoking history.
Demographic data presented are from visit 5. Height was
measured using a wall-mounted Harpenden stadiometer (Hol-
tain, Dyfed, UK), and weight was measured with a balance
beam scale; methods have been previously described (9,15,16).
Protocols for BMD measurements of the hip were performed
using dual x-ray absorptiometry (QDR 1000; Hologic,
Waltham, MA), and calcaneus was measured using single x-ray
absorptiometry (OsteoAnalyzers; Siemens-Osteon, Wahiawa,
HI), as previously described (9).
Statistical analysis. Differences in demographic and
BMD variables between radiographic hip OA cases and controls without radiographic hip OA were assessed by Student’s
t-test for continuous variables and by chi-square test for
dichotomous variables. Hardy-Weinberg equilibrium was assessed in both groups by chi-square test, and allele frequencies
were calculated using the gene counting method. Logistic
regression was used to estimate odds ratios (ORs) and 95%
confidence intervals (95% CIs) for each genotype (G/G, G/T,
and T/T) and the risk of any radiographic hip OA, radiographic
hip OA defined by JSN score ⱖ3, or radiographic hip OA
defined by femoral osteophytosis of score ⱖ2. All analyses for
the association of COL1A1 Sp1 genotypes and radiographic
hip OA categories were performed both with and without
adjustments for known and potential confounding variables
including age, height, weight, estrogen use, and femoral neck
BMD. Statistical analysis was performed using the statistical
software program SAS, version 8.2 (SAS Institute, Cary, NC).
RESULTS
Characteristics of the study subjects and genotype frequencies. Among the 4,746 study subjects, 571
satisfied the criteria for radiographic hip OA, of whom
1434
LIAN ET AL
Table 2.
Association between COL1A1 and radiographic hip OA status*
Genotype
Cases/total (%)
Unadjusted OR
(95% CI)†
Adjusted OR
(95% CI)‡
Radiographic hip OA
G/G
G/T
T/T
Osteophytosis
G/G
G/T
T/T
Joint space narrowing
G/G
G/T
T/T
571/4,746 (12.0)
382/3,108 (12.3)
171/1,462 (11.7)
18/176 (10.2)
131/4,746 (2.8)
79/3,108 (2.5)
46/1,462 (3.2)
6/176 (3.4)
325/4,746 (6.8)
224/3,108 (7.2)
97/1,462 (6.6)
4/176 (2.3)
–
1.00 (referent)
0.95 (0.78–1.15)
0.81 (0.49–1.34)
–
1.00 (referent)
1.23 (0.85–1.80)
1.31 (0.56–3.05)
–
1.00 (referent)
0.92 (0.72–1.17)
0.30 (0.11–0.81)
–
1.00 (referent)
0.90 (0.79–1.19)
0.83 (0.49–1.40)
–
1.00 (referent)
1.32 (0.91–1.93)
1.22 (0.48–3.11)
–
1.00 (referent)
0.95 (0.73–1.23)
0.36 (0.13–0.99)
* OA ⫽ osteoarthritis; OR ⫽ odds ratio; 95% CI ⫽ 95% confidence interval.
† Unadjusted logistic regression analysis.
‡ Adjusted for age, height, weight, estrogen use, and femoral neck bone mineral density.
325 subjects had JSN score ⱖ3 and 131 had moderateto-severe osteophytes (Figure 1). Compared with the
4,175 control subjects who did not satisfy the radiographic hip OA criteria, the patients identified as having
radiographic OA of the hip were older, reported less
walking activity and poorer overall health status, and
had higher femoral neck BMD (Table 1). No other
demographic or BMD variables were significantly different between the 2 groups.
The frequency of the T allele in the cohort was
19.1% and was similar to frequencies observed in similar
populations (6,12). Genotype frequencies did not deviate from Hardy-Weinberg equilibrium.
Odds ratios for radiographic OA of the hip.
There was no significant association between the T/T
genotypes and radiographic hip OA case status in unadjusted models or in models adjusted for age, height,
weight, estrogen use, and femoral neck BMD (Table 2).
Similarly, there was no association between either of the
genotypes and the presence of radiographic OA of the
hip as characterized by femoral osteophyte score ⱖ2,
with or without similar adjustment for covariates. However, there was a 70% reduction in the odds of radiographic hip OA characterized by severe JSN in subjects
with the T/T genotype, compared with the G/G genotype
(OR 0.30, 95% CI 0.11–0.81, P ⫽ 0.02). This reduction
in radiographic hip OA risk remained significant after
adjustment for age, height, weight, estrogen use, and
femoral neck BMD (P ⫽ 0.048) (Table 2).
DISCUSSION
The present study addressed the association between the COL1A1 Sp1 binding site polymorphism and
the risk of radiographic OA of the hip. While there was
no association between the Sp1 polymorphism and radiographic hip OA defined by any of the 3 different
criteria or by osteophytosis as the predominant radiographic feature, there was a significant reduction in the
odds of radiographic hip OA as characterized by severe
JSN among subjects with the T/T genotype. Because
joint space narrowing observed by hip radiography is a
surrogate measure of articular cartilage loss, we speculate that this effect may reflect the role of the COL1A1
genotype on articular cartilage or subchondral bone
metabolism in the development of hip OA.
The relationship between the COL1A1 Sp1 binding site polymorphism and osteoporosis, as well as
fracture risk, has been well established (5–8). Moreover,
haplotype analysis has demonstrated that the relationship with fracture risk is specific for the Sp1 site, rather
than other polymorphisms (8). The Sp1 transcription
factor binding site is located in the first intron of the
COL1A1 gene, a region that has been identified as
important for the regulation of collagen transcription
(7). In a series of experiments, Mann et al demonstrated
that the G/T genotype was associated with altered
production of the collagen protein, with an increased
ratio of ␣1(I) to ␣2(I) protein chains (7). This result was
accompanied by an increase in expression of COL1A1
messenger RNA (mRNA) relative to COL1A2 mRNA
and reduced biomechanic strength among those with the
G/T genotype versus those with the G/G genotype. In
the current study, we found that women with 2 copies of
the variant T allele had decreased hip OA risk, but this
will have to be evaluated in another study population.
At present, it is unclear how altered collagen
HIP OA, COL1A1, AND GENETICS
production and reduced bone strength as a result of the
presence of the T allele contributes to the development
of hip OA characterized by severe joint space narrowing.
These are recognized subsets of radiographic hip OA,
and we don’t know about differences in pathogenesis.
Higher adjusted levels of BMD are associated with
increased odds of radiographic hip OA with osteophytes
(9–11) but not radiographic hip OA characterized by
JSN alone. Since the T/T genotype is associated with
lower BMD and increased risk of fractures, we speculate
that it is also associated with radiographic OA of the hip
characterized by severe JSN. This association was
present, however, even after adjustment for BMD. This
suggests that bone strength may be important. While
Radin et al found that changes in the subchondral bone
strength preceded articular cartilage loss in a rabbit
model of OA (13), Burr has shown that increased bone
turnover and decreased subchondral bone strength are
both important in the development of OA with cartilage
loss (19). Since the pathogenesis of hip OA may differ in
these 2 subtypes of OA, it is possible that altered
collagen in subjects with this COL1A1 polymorphism
may result in weaker bone that slows the development of
OA. Furthermore, this latter effect appears to be mediated by increased joint space narrowing. Additional
work is now required to determine how altered bone
composition adjacent to the hip joint may reduce the risk
of hip OA.
Two previous studies have investigated the role
of COL1A1 in OA. Aerssens et al found no association
of the COL1A1 Sp1 polymorphism with hip OA in a
case–control study comparing postmenopausal women
with THR for OA of the hip and those with no hip OA
(14). Given the small sample of only 75 cases, it is
possible that the lack of association was due to insufficient power to detect a difference between the groups.
The study by Aerssens and colleagues focused on elderly
women with THR, while our study focused on women
with radiographic OA of the hip and excluded subjects
with hip replacement. These differences may also explain our divergent results. In a separate proband–
spouse case–control study, Loughlin et al found a weak
association of the COL1A1 Sp1 polymorphism with hip
or knee OA (12). Compared with female controls,
elderly women with OA requiring hip or knee replacement had a significantly different genotype distribution,
with a relative increase in the G allele (OR 1.58, 95% CI
1.09–2.29). However, this effect did not remain significant after stratifying by hip or knee replacement (11). It
is possible that these results are consistent with ours, in
that the G allele may be associated with the develop-
1435
ment of hip OA, while the T allele may be protective
against hip OA. Also, Loughlin et al defined cases by
joint replacement, so their results may not be comparable with ours.
This study offers several strengths, including its
large community-based cohort of elderly white women
and a validated radiographic scoring system making
phenotype-specific definitions to fully characterize the
extent of radiographic hip OA. However, there are also
several potential limitations. Our definitions of radiographic OA of the hip may not be comparable with other
grading schemes. Also, despite the large number of
subjects in our cohort, we only had 571 subjects with
radiographic hip OA, and the numbers of participants
were smaller when we subdivided by either genotype or
individual radiographic features. Another potential limiting factor is that our study participants were all white
women age 65 years and older, and our findings may not
be generalizable to other populations.
In summary, we found that the T/T genotype at a
binding site for the Sp1 transcription factor in COL1A1
was associated with reduced risk of radiographic OA of
the hip as defined by severe joint space narrowing. While
our findings require confirmation in other populations,
they suggest that the COL1A1 Sp1 genotype may be
associated with a reduction in the development of hip
OA, and that this effect may be mediated by changes in
bone quantity and/or quality. In addition, our results
highlight the importance of phenotypic definition in the
genetic analyses of OA susceptibility.
REFERENCES
1. Felson DT, Lawrence RC, Dieppe PA, Hirsch R, Helmick CG,
Jordan JM, et al. Osteoarthritis: new insights. I. The disease and its
risk factors [review]. Ann Intern Med 2000;133:635–46.
2. Spector TD, MacGregor AJ. Risk factors for osteoarthritis: genetics. Osteoarthritis Cartilage 2004;12 Suppl A:S39–44.
3. Loughlin J. Genetic epidemiology of primary osteoarthritis. Curr
Opin Rheumatol 2001;13:111–6.
4. Kuivaniemi H, Tromp G, Prockop DJ. Mutations in collagen
genes: causes of rare and some common diseases in humans.
FASEB J 1991;5:2052–60.
5. Grant SF, Reid DM, Blake G, Herd R, Fogelman I, Ralston SH.
Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I ␣ 1 gene. Nat
Genet 1996;14:203–5.
6. Uitterlinden AG, Burger H, Huang Q, Yue F, McGuigan FE,
Grant SF, et al. Relation of alleles of the collagen type I␣1 gene to
bone density and the risk of osteoporotic fractures in postmenopausal women. N Engl J Med 1998;338:1016–21.
7. Mann V, Hobson EE, Li B, Stewart TL, Grant SF, Robins SP, et
al. A COL1A1 Sp1 binding site polymorphism predisposes to
osteoporotic fracture by affecting bone density and quality. J Clin
Invest 2001;107:889–907.
8. McGuigan FA, Reid DM, Ralston SH. Susceptibility to osteoporotic fracture is determined by allelic variation at the Sp1 site,
1436
9.
10.
11.
12.
13.
rather than other polymorphic sites at the COL1A1 locus. Osteoporos Int 2000;11:338–43.
Nevitt MC, Lane NE, Scott JC, Hochberg MC, Pressman AR,
Genant AK, et al, and the Study of Osteoporotic Fractures
Research Group. Radiographic osteoarthritis of the hip and bone
mineral density. Arthritis Rheum 1995;38:907–16.
Hart DJ, Cronin C, Daniels M, Worthy T, Doyle DV, Spector TD.
The relationship of bone density and fracture to incident and
progressive radiographic osteoarthritis of the knee: the Chingford
Study. Arthritis Rheum 2002;46:92–9.
Sowers M, Lachance L, Jamadar D, Hochberg MC, Hollis B,
Crutchfield M, et al. The associations of bone mineral density and
bone turnover markers with osteoarthritis of the hand and knee in
pre- and perimenopausal women. Arthritis Rheum 1999;42:483–9.
Loughlin J, Sinsheimer JS, Mustafa Z, Carr AJ, Clipsham K,
Bloomfield VA, et al. Association analysis of the vitamin D
receptor gene, the type I collagen gene COL1A1, and the estrogen
receptor gene in idiopathic osteoarthritis. J Rheumatol 2000;27:
779–84.
Radin EL, Paul IL, Rose RM. Role of mechanical factors in the
pathogenesis of OA. Lancet 1972;1:519–22.
LIAN ET AL
14. Aerssens J, Dequeker J, Peeters J, Breemans S, Boonen S. Lack of
association between osteoarthritis of the hip and gene polymorphisms of VDR, COL1A1, and COL2A1 in postmenopausal
women. Arthritis Rheum 1998;11:1946–50.
15. Cummings SR, Nevitt MC, Browner WS, Stone K, Fox KM,
Ensrud KE, et al, and the Study of Osteoporotic Fractures
Research Group. Risk factors for hip fracture in white women.
N Engl J Med 1995;332:767–73.
16. Lane NE, Nevitt MC, Hochberg MC, Hung YY, Palermo L.
Progression of radiographic hip osteoarthritis over eight years in a
community sample of elderly white women. Arthritis Rheum
2004;50:1477–86.
17. Morin PA, Saiz R, Monjazeb A. High-throughput single nucleotide polymorphism genotyping by fluorescent 5⬘ exonuclease assay.
Biotechniques 1999;27:538–52.
18. Germer S, Holland MJ, Higuchi R. High throughput SNP allelefrequency determination in pooled DNA samples by kinetic PCR.
Genome Res 2000;10:258–66.
19. Burr JB. The importance of subchondral bone in pression of OA.
J Rheumatol 2004;31 Suppl 70:77–82.
Документ
Категория
Без категории
Просмотров
8
Размер файла
106 Кб
Теги
narrowing, site, women, hip, associates, joint, osteoarthritis, typed, reduced, elderly, severa, defined, factors, space, polymorphism, sp1, transcription, risk, binding, collagen
1/--страниц
Пожаловаться на содержимое документа