close

Вход

Забыли?

вход по аккаунту

?

Different T cell subsets in the nodule and synovial membraneAbsence of interleukin-17A in rheumatoid nodules.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 58, No. 6, June 2008, pp 1601–1608
DOI 10.1002/art.23455
© 2008, American College of Rheumatology
Different T Cell Subsets in the Nodule and Synovial Membrane
Absence of Interleukin-17A in Rheumatoid Nodules
Lisa K. Stamp,1 Andrea Easson,2 Ulrike Lehnigk,2 John Highton,2 and Paul A. Hessian2
the expression of IFN␥ was 0.67 ⴞ 0.68 ng and that of
IL-12 was 0.48 ⴞ 0.23 ng.
Conclusion. IL-17 family members are varyingly
expressed in rheumatoid nodules. The paucity of IL-17A
in nodules suggests an important difference from that
observed in the synovium. The expression of IL-23 below
a critical threshold level seems the most likely explanation for the virtual absence of IL-17A. The presence of
tissue destruction within the nodule despite the absence
of IL-17A suggests that IL-17A may be an important
amplifier rather than an absolute requirement for inflammation in RA.
Objective. To determine gene expression of the
interleukin-17 (IL-17) family members (IL-17A–F) in
rheumatoid subcutaneous nodules, and to assess the
cytokines involved in regulating IL-17A expression.
Methods. Total RNA was isolated from 19 nodules
obtained from 16 different patients with rheumatoid
arthritis (RA). Reverse transcription–polymerase chain
reaction (PCR) was used to screen for gene expression
of the IL-17 subtypes (IL-17A–F) in all nodules. Quantitative real-time PCR was used to measure the expression of interferon-␥ (IFN␥), IL-6, IL-23, IL-12, and
transforming growth factor ␤ (TGF␤), relative to
GAPDH as control, in a subset of 10 nodules.
Results. IL-17A gene expression was present in
only 1 of 19 nodules, IL-17B in 17 of 19 nodules, IL-17C
in 18 of 19 nodules, IL-17D in 16 of 19 nodules, and
IL-17E in 3 of 19 nodules. IL-17F was absent in all
samples. Cytokines that stimulate IL-17A production
(IL-6, IL-23) as well as those that inhibit IL-17A production (IL-12, IFN␥, TGF␤) were present in the majority of nodules. Quantitative real-time PCR showed a
similar pattern of gene expression for the individual
cytokines between the different nodules. The mean ⴞ
SD expression of IL-6 relative to GAPDH was 2.28 ⴞ 2.2
ng, and that of TGF␤ was 2.96 ⴞ 1.14 ng. There was a
lower relative expression of IL-23 (0.05 ⴞ 0.05 ng), while
Rheumatoid arthritis (RA) is a common autoimmune condition, characterized by inflammation of the
joint synovial lining and eventual destruction of the
joints. Rheumatoid nodules, which are most commonly
located at subcutaneous sites overlying bony prominences, are a characteristic extraarticular feature. Nodules are tissue destructive, are typically found in those
patients with more severe disease (1), and are a marker
for increased mortality (2).
Whether the rheumatoid nodule represents the
same type of tissue-destructive inflammatory lesion as
that found in the synovium or represents a different type
of lesion remains unclear. A long-held view has been
that the rheumatoid nodule and other extraarticular
manifestations of RA result from a different mechanism,
namely immune complex deposition (1). However, studies from our own laboratory have shown marked similarities between the nodule and the synovium. Both
lesions contain monocyte/macrophages and T cells (3)
and putative dendritic cells (4), and both lesions have a
broadly Th1 cytokine profile (5). This has led to our
hypothesis that the core inflammatory mechanisms in
the rheumatoid nodule and in other systemic lesions are
essentially the same as those in the synovial lesion.
However, it is apparent that although the nodule
Supported by the University of Otago, the Royal Australasian
College of Physicians, Lottery Health New Zealand, and the New
Zealand Health Research Council.
1
Lisa K. Stamp, MBChB, FRACP, PhD: University of Otago,
Christchurch, New Zealand; 2Andrea Easson, Ulrike Lehnigk, PhD,
John Highton, MD, FRACP, Paul A. Hessian, PhD: University of
Otago, Dunedin, New Zealand.
Address correspondence and reprint requests to Lisa K.
Stamp, MBChB, FRACP, PhD, Department of Medicine, University
of Otago, Christchurch, PO Box 4345, Christchurch 8140, New Zealand. E-mail: lisa.stamp@cdhb.govt.nz.
Submitted for publication October 3, 2007; accepted in revised form February 20, 2008.
1601
1602
STAMP ET AL
Table 1. Characteristics of all 16 patients from whom samples of
rheumatoid nodules were obtained and of the 10 patients whose
nodules were evaluated by quantitative real-time polymerase chain
reaction (PCR)*
Characteristic
Age, mean (range) years
Male/female
RF positive
Radiographic erosions
Disease duration, mean (range)
years
ESR, mean (range) mm/hour
CRP, mean (range) mg/dl
Taking DMARDs
Taking methotrexate
Taking prednisone
Total
(n ⫽ 16)
Quantitative
real-time PCR
(n ⫽ 10)
62.6 (46–76)
1/15
13/16 (81)
16/16 (100)
13.8 (3–30)
61.3 (46–75)
0/10
7/10 (70)
10/10 (100)
16.7 (5–30)
30 (4–66)
19 (5–38)
15/16 (94)
11/16 (69)
3/16 (19)
28 (4–65)
19.8 (5–38)
9/10 (90)
6/10 (60)
0
* Except where indicated otherwise, values are the no./total no. (%) of
patients. Comparable values in the 4 patients from whom synovial
tissue samples were obtained were as follows: mean age 68 years
(range 61–79), 2 male/2 female, all 4 rheumatoid factor (RF) positive,
all 4 with erosions, mean disease duration 14.5 years (range 2–25.8),
mean erythrocyte sedimentation rate (ESR) 37.5 mm/hour (range
3–85), 3 taking disease-modifying antirheumatic drugs (DMARDs), 2
taking methotrexate, and 3 taking prednisone.
and synovial lesions may share similar basic mechanisms,
additional features are present in the synovial lesion that
are not found in the nodule. This includes the presence
of B lymphocytes and lymphoid follicles that are absent
from typical subcutaneous nodules. Understanding the
similarities and differences in inflammatory mechanisms
in the articular and extraarticular features of RA would
provide greater insight into the nature of the antigens
recognized, would elucidate why patients with extraarticular disease have increased mortality, and would
provide guidance on how we should treat such patients
(6).
The rheumatoid synovium is characterized by
infiltration of monocyte/macrophages, T cells, and dendritic cells, which produce a variety of inflammatory
cytokines. T cells present within the RA synovium are
typically Th1 (CD4⫹) cells expressing the mature memory cell marker CD45RO (7). Despite the abundance of
T cells, there is a paucity of T cell cytokines; for
example, although interferon-␥ (IFN␥) is present, the
levels of this cytokine are low in comparison with that
observed in other Th1-mediated diseases (8). Recently,
the T cell cytokine interleukin-17A (IL-17A) has been
found in rheumatoid synovium and synovial fluid. IL17A has proinflammatory actions, both directly and
through synergy with tumor necrosis factor ␣ (TNF␣)
and IL-1␤, and has been implicated in the pathogenesis
of bone and joint damage in RA (9). The IL-17 family
has 6 members (IL-17A–F), of which IL-17A has been
associated with RA. IL-17C, IL-17E (also known as
IL-25), and IL-17F have also been detected in RA
synovial fluid mononuclear cells (10).
Although IL-17A is produced by CD4⫹,
CD45RO⫹ memory T cells (11), integration of IL-17A
into the existing Th1/Th2 paradigm has been difficult.
Recently, a specific subset of T cells that produce
IL-17A, known as Th17 cells, has been identified in
murine models, and these cells are thought to be important in induction of autoimmune disease (12,13). Development of this unique Th17 cell population is promoted
through the actions of IL-6 and transforming growth
factor ␤ (TGF␤) on naive murine CD4⫹ T cells, while
IL-23 is important in the maintenance and expansion of
Th17 cells (14,15). In contrast, IFN␥, IL-2, IL-4, IL-25,
and IL-27 inhibit the development of murine Th17 cells
(12,16,17).
Until very recently, there was a paucity of data on
Th17 cells in humans. It is now apparent that there are
significant differences between mice and humans with
respect to Th17 cell differentiation. While TGF␤ is
critical in the mouse, this cytokine is not needed for
development of IL-17A–producing cells in humans and,
indeed, may inhibit IL-17A production (18,19). IL-6
alone has been reported to be a poor inducer, and IL-1
to be a potent inducer, of IL-17A production by activated CD4⫹ T cells (18,19). However, AcostaRodriguez et al reported that IL-1 in combination with
IL-6 promotes production of IL-17A and IFN␥ in the
cells (19). IL-23 remains an important inducer of Th17
cells and of IL-17A production (18,20,21). In human T
cells ex vivo, IL-12 inhibits IL-17A production (21). IL-2
has also been reported to up-regulate IL-17A expression
in human peripheral blood mononuclear cells ex vivo,
whereas IFN␥ inhibits IL-17A expression (22).
The aim of the present study was to determine
whether the genes for IL-17A–F are expressed in rheumatoid nodules in a pattern similar to that documented
in the synovial lesions of patients with RA. There was
particular interest in the expression of the IL-17A gene
and those cytokines important in the regulation of Th17
cell differentiation.
PATIENTS AND METHODS
Sample collection. Nineteen nodules were obtained
from 16 different patients with RA whose diagnosis fulfilled
the American College of Rheumatology (formerly, the American Rheumatism Association) criteria for RA (23). Synovium
was obtained from 4 patients with RA. Details on all of the
patients are shown in Table 1. Ethics approval was obtained
from the University of Otago Ethics Committee.
IL-17 SUBSETS IN RHEUMATOID NODULES AND SYNOVIAL MEMBRANE
1603
Table 2. Primers and annealing temperatures for polymerase chain reaction (PCR) screening assays and
for quantitative real-time PCR*
Assay, gene, primer
Screening
IL-17A
5⬘
3⬘
IL-17B
5⬘
3⬘
IL-17C
5⬘
3⬘
IL-17D
5⬘
3⬘
IL-17E
5⬘
3⬘
IL-17F
5⬘
3⬘
IL-6
5⬘
3⬘
IL-12p35
5⬘
3⬘
IL-23p19
5⬘
3⬘
TGF␤
5⬘
3⬘
␤-actin
5⬘
3⬘
Quantitative real-time PCR
TGF␤
5⬘
3⬘
GAPDH
5⬘
3⬘
Oligonucleotide sequence
Annealing
temperature,
°C
ATGACTCCTGGGAAGACCTCATTG
TTAGGCCACATGGTGGACAATCGG
55
CTGGGGCTACAGCATCAACC
GTGCAGCCCACAGCGATGGT
45
CCGTTCAGTGTGACCGCCGA
GTTGGGAAGAGGCAGCCTGC
50
GCCAAAGAGATAGGGACGCA
TTCATCAGTCAGCCATCGGT
45
TGAAGTGCTGTCTGGAGCAG
TCCTCAGAATCATCCATGTC
42
GAAGACATCTCCATGAATT
ACATACACACATACATTGTG
40
GTACATCCTCGACGGCATCTCAGC
GGTTGGGTCAGGGGTGGTTATTGC
55
CCTGGACCACCTCAGTTTGG
CTAAGGCACAGGGCCATCAT
50
CTGCTTGCAAAGGATCCACC
TTGAAGCGGAGAAGGAGACG
62
GCGTGCTAATGGTGGAAAC
ACTCCGGTGACATCAAAAGATAA
47
CGCCCTGGACTTCGAGCAAG
GCCAGGGTACATGGTGGTGC
54
CAACAATTCCTGGCGATACCT
GCTAAGGCGAAAGCCCTCAAT
60
TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
60
* IL-17 ⫽ interleukin-17; TGF␤ ⫽ transforming growth factor ␤.
Analysis of cytokine gene expression. Total RNA was
extracted from 50–100 mg of nodule or synovial tissue using
Qiagen RNeasy mini kits (Qiagen, Hilden, Germany). RNA
(0.5 ␮g or 1 ␮g) was reverse transcribed at 42°C for 50 minutes
using Superscript II (Life Technologies, Carlsbad, CA) and
oligo(dT)12-18 primers. For screening assays, complementary
DNA (cDNA) was amplified by polymerase chain reaction
(PCR) under nonsaturating conditions with the respective
gene-specific primer pairs and under various annealing temperatures, as detailed in Table 2. Each PCR amplification cycle
consisted of a 15-minute denaturation at 95°C at the start of
the reaction, followed by 35 cycles of denaturation at 94°C for
30–60 seconds of annealing and then an extension at 72°C for
30–60 seconds, with a final 10-minute extension at 72°C.
Amplified products were analyzed by 1.3% agarose gel electro-
phoresis with ethidium bromide staining. Controls for the PCR
included reactions with known positive cDNA (pooled nodule
reference [n ⫽ 5] or tonsil tissue) or in which no cDNA was
added.
Quantitative real-time PCR was undertaken using
TaqMan gene expression assays for IL-6, IL-12, IL-23, and
IFN␥ (Applied Biosystems, Foster City, CA) or SYBR Green
assays for TGF␤ on 10 nodule samples from different patients.
Primers used in the quantitative real-time PCR SYBR Green
assays for TGF␤ (and for GAPDH as control) are detailed in
Table 2.
Statistical analysis. Analysis of the data was undertaken in triplicate samples. Results are expressed as the
mean ⫾ SD ng RNA for each gene of interest, relative to the
expression of GAPDH RNA.
1604
STAMP ET AL
RESULTS
Expression of IL-17A–F in rheumatoid nodules.
IL-17A gene expression was present in 1 (5%) of 19
nodules (Figure 1A). Irrespective of this single positive
nodule, 2 other nodules from the same patient were
subsequently found to be negative for IL-17A. The
positive nodule was from a tendon sheath, and the
histologic characteristics of this nodule were similar to
those of the other nodules. Another nodule obtained
from a tendon sheath in a different patient was subsequently found to be negative for IL-17A. Despite the
absence of IL-17A in nodule samples, IL-17A was
readily detected in rheumatoid synovial tissue by PCR
screening assays (Figure 1B).
IL-17B, IL-17C, and IL-17D were found in the
majority of nodule samples (Table 3). Only a minority of
samples expressed IL-17E. In contrast, no expression of
IL-17F was observed in any of the nodule samples
(Table 3).
Expression of genes for cytokines that regulate
IL-17A production. In an attempt to explain the absence
of IL-17A in rheumatoid nodules, cytokines known to be
involved in the regulation of Th17 cell differentiation
were examined. The results are summarized in Table 3.
IL-6 and IL-23, which promote Th17 cell differentiation and IL-17A production, as well as IL-12,
TGF␤, and IFN␥, which inhibit Th17 cell differentiation, were present in the nodules. We previously reported the absence of IL-4 (a potent inhibitor of Th17
cell differentiation) and IL-2 (a promoter of Th17) in
rheumatoid nodules (5).
Quantitative real-time PCR was undertaken to
Figure 1. Representative polymerase chain reaction showing expression of interleukin-17A (IL-17A) in A, rheumatoid nodules and B,
rheumatoid synovium. The amplicon is the expected size for IL-17A, at
468 bp.
Table 3. Expression of IL-17 subtypes A–F and cytokines regulating
IL-17A expression in rheumatoid nodules*
Cytokine
Nodules (n ⫽ 19)
IL-17A
IL-17B
IL-17C
IL-17D
IL-17E
IL-17F
IL-6
TGF␤
IL-12p35
IL-23p19
1 (5)
17 (89)
18 (95)
16 (84)
3 (16)
0 (0)
17 (89)
19 (100)
9 (47)
13 (68)
* Values are the no. (%) of nodules positive for each cytokine. See
Table 2 for definitions.
examine the balance between the expression of cytokines thought to promote or inhibit Th17 cell differentiation and the production of IL-17A. Overall, the
pattern of cytokine gene expression was similar for
the individual cytokines between each nodule sample
(Figure 2). With regard to the cytokines that are known
to stimulate IL-17A, the mean ⫾ SD gene expression for
IL-6 was 2.28 ⫾ 2.2 ng, while that for IL-23 was lower,
at 0.05 ⫾ 0.05 ng. With regard to the IL-17A–inhibitory
cytokines IFN␥, TGF␤ and IL-12, all 3 were clearly
present in the rheumatoid nodules (IFN␥ gene expression 0.67 ⫾ 0.68 ng, IL-12 0.48 ⫾ 0.23 ng, and TGF␤
2.96 ⫾ 1.14 ng) (Figure 3).
Figure 2. Quantitative RNA expression analysis of cytokines involved
in Th17 cell differentiation and in interleukin-17 (IL-17) production in
10 different rheumatoid nodules. Each color and symbol represent
data from an individual nodule. IFN␥ ⫽ interferon-␥; TGF␤ ⫽
transforming growth factor ␤.
IL-17 SUBSETS IN RHEUMATOID NODULES AND SYNOVIAL MEMBRANE
Figure 3. Quantitative real-time polymerase chain reaction analysis of
cytokines involved in stimulation and inhibition of Th17 cells and of
interleukin-17A (IL-17A) production in 10 different rheumatoid nodules. RNA expression for A, positive regulators of IL-17A (IL-6, IL-23)
and B, inhibitors of IL-17A (IL-12, interferon-␥ [IFN␥], transforming
growth factor ␤ [TGF␤]) is shown relative to that for GAPDH. Each
circle represents data from an individual nodule; bars show the mean
for each group.
DISCUSSION
The IL-17 family members IL-17A–F are variably
expressed in rheumatoid nodules. The presence of IL17C, IL-17E, and IL-17F, but not that of IL-17B and
IL-17D, in synovial fluid and peripheral blood mononuclear cells from patients with RA has previously been
reported (10). Whereas the actions of IL-17A in RA
have received significant attention, the role of the other
IL-17 members has been less well investigated.
In humans, the cellular sources of IL-17B and
IL-17C have not been identified, and the actions of these
2 cytokines are not well defined. IL-17B has been
identified in chondrocytes in the middle and deep zones
of normal bovine cartilage (24). More recently, in a
murine collagen-induced arthritis (CIA) model, levels of
IL-17B and IL-17C were found to be elevated compared
with those in controls. IL-17B was exclusively expressed
in the inflamed cartilage, whereas IL-17C was expressed
by a variety of cells, including CD4⫹ T cells, macrophages, and dendritic cells (25). Furthermore, in experiments using a murine fibroblast cell line, IL-17B and
IL-17C induced expression of IL-1␤. In murine peritoneal exudate cells, IL-17B induced expression of IL-1␤,
IL-6, IL-23, and TNF␣, and IL-17C induced expression
of IL-1␤, IL-23, and TNF␣ (25). Adoptive transfer of
IL-17B– and IL-17C–transduced CD4⫹ T cells exacerbated CIA in these mice. The results from these studies
suggest that IL-17B and IL-17C have important proinflammatory effects in CIA.
Although IL-17C has been reported in human
synovial fluid mononuclear cells, IL-17B has not been
found (10). Thus, confirmation of the presence of IL17B and IL-17C in rheumatoid nodules, as reported
herein, gives further weight to the suggestions derived
1605
from animal models that IL-17 family members have a
role in human disease. The nature and significance of
their involvement is worthy of further investigation.
Among peripheral blood cells, IL-17D is produced by resting CD4⫹ T cells and CD19⫹ B cells.
Stimulation of human umbilical vein endothelial cells
with IL-17D induces secretion of IL-6 and IL-8, but not
IL-1␤, IFN␥, or TNF␣ (26). Although IL-17D has not
been found in human synovial fluid or peripheral blood
mononuclear cells (10), we were able to detect this
cytokine in rheumatoid nodules. These data highlight
another difference between the nodule, in which B cells
are absent, and the synovium and suggest that particularly the T cells within the 2 lesions have differences.
IL-17E (also known as IL-25) is produced by mast cells
and induces Th2-type responses (27). Its role in RA has
not been defined. The actions of IL-17F are similar to
those of IL-17A.
To date, IL-17A is the only T cell–derived cytokine found in significant quantities in rheumatoid synovium. IL-17A has a number of proinflammatory actions,
both directly and through synergy with IL-1␤ and TNF␣,
including stimulation of the production of IL-6, IL-8,
IL-1␤, TNF␣, and prostaglandin E2 from monocyte/
macrophages and synoviocytes (28,29). In addition, IL17A may mediate the bone destruction observed in RA
through induction of matrix metalloproteinases (30),
stimulation of osteoclast precursors (31), inhibition of
proteoglycan synthesis (32), and increased expression of
RANK and RANKL (33).
In animal models, inhibition of murine IL-17A
with neutralizing antibodies has been shown to suppress
the onset of experimentally induced arthritis, reduce the
severity of the arthritis, and reduce synovial RANKL
messenger RNA (mRNA) expression and bone erosion
(34,35). In patients with RA, the levels of IL-17A
mRNA in synovium along with the levels of IL-1␤,
TNF␣, and IL-10 mRNA have been reported to be
predictive of damage progression (36). Thus, IL-17A
links both inflammation and bone destruction in RA.
Whether IL-17A has a role in the extraarticular tissue–
damaging lesions of RA, such as the rheumatoid nodule,
has not been determined previously.
We therefore assessed the presence of IL-17A in
rheumatoid nodules. Despite the presence of IL-17A
mRNA in rheumatoid synovial tissue, 18 of the 19
nodule samples did not express IL-17A mRNA. There
are several explanations for only one nodule being found
positive for IL-17A. First, this nodule was the only one
obtained from a tendon sheath in this study. and although we found no histologic evidence in replicate
1606
tissue pieces, the sample analyzed for IL-17A may have
been contaminated with synovial membrane tissue from
the sheath. Alternatively, the morphologic features of
nodules may differ depending on their location in the
tissue. For example, RA-associated pulmonary nodules
contain B lymphocytes, but these are not present in
subcutaneous nodules (37). This latter possibility seems
less likely, given that the only other nodule available for
analysis from a tendon sheath was negative for IL-17A.
In mice, it has been shown that IL-17A is produced by a distinct subset of CD4⫹ T cells known as
Th17 cells. Differentiation of Th17 cells from naive
CD4⫹ Th cells is driven by TGF␤ and IL-6. IL-23, which
consists of the IL-12p40 subunit and a unique IL-23p19
subunit, has a critical role in maintenance and expansion
of Th17 cells (14,15). The importance of IL-23 has been
highlighted in a murine model of arthritis in which
specific absence of the IL-23 gene conferred complete
resistance to the development of CIA in mice. Furthermore, the resistance to CIA in IL-23–deficient mice
correlated with the absence of IL-17A–producing T
cells (38).
In patients with RA, serum and synovial fluid
concentrations of IL-23 have been reported to be higher
compared with those in patients with osteoarthritis or
healthy controls (39). Furthermore, IL-23p19 is upregulated in RA synovial fibroblasts, an effect that is
mediated, at least in part, by IL-17A (39). Thus, there
appears to be an important positive feedback loop
between IL-23 and IL-17A, which may be important in
driving synovial inflammation. In contrast, it has been
demonstrated that the sensitivity of IFN␥-knockout
mice to CIA is associated with increased IL-17A production, and administration of anti–IL-17A antibodies
markedly reduces the incidence and severity of CIA
(40). The importance of IL-23 in autoimmune diseases is
also highlighted by the relationship between the IL-23
receptor (IL-23R) polymorphism and the prevalence of
inflammatory bowel disease (41), whereas the data with
respect to the role of IL-23R in RA are conflicting
(42,43).
In an attempt to explain the lack of IL-17A in
rheumatoid nodules, we examined the expression of
those cytokines suggested, in murine and human studies,
to be involved in the regulation of Th17 cell differentiation and in the production of IL-17A. Although IL-6
was clearly present, there was only minimal expression of
IL-23. In contrast, those cytokines suggested to inhibit
IL-17A production, namely IFN␥, TGF␤, and IL-12,
were all present. Thus, while T cells are present in
STAMP ET AL
rheumatoid nodules, our data suggest that these are not
IL-17A–producing Th17 cells.
Although the story of Th17 cell differentiation
and IL-17A production in human T cells is far from
complete, given the available data in human systems, the
relative lack of IL-23 may explain, at least in part, the
absence of IL-17A in rheumatoid nodules. However,
other cytokines, as yet unidentified, may be important in
regulating Th17 cell differentiation and IL-17A production. This is highlighted by recent evidence suggesting
that IL-23R–negative T cells are still capable of producing IL-17A (19).
The rheumatoid nodule and synovial lesion share
a number of similarities. Monocyte/macrophages, T
cells, and putative dendritic cells are found in both
lesions (4). Expression of adhesion molecules is similar
between the nodule and the synovium, with the exception of E-selectin, which has higher expression in the
nodule (44). The cytokine profile of the 2 lesions is also
similar and resembles that of a Th1 granuloma (5).
Nevertheless, there are also significant differences between the 2 lesions. B cells and lymphoid follicles, which
are present in the synovium, are typically absent from
subcutaneous nodules. In comparison, the necrosis
found in the nodule is usually absent in the synovium.
Further evidence of differences between the 2 lesions
comes from the response to therapy. For example,
whereas infliximab and methotrexate can effectively
suppress synovial inflammation, infliximab has no effect
on subcutaneous nodules (45), and methotrexate can
exacerbate nodules.
The relative absence of IL-17A in the nodule as
compared with its presence in the synovium highlights
another important difference between the 2 lesions,
particularly with regard to the T cell populations
present. Recirculation of T cells between articular and
extraarticular locations in RA has been hypothesized as
a possible explanation for this difference (46). This is
based, at least in part, on the similarities observed
between the T cells in both lesions, including similar
patterns of adhesion molecule expression and T cell
receptor rearrangements (47). However, the absence of
IL-17A in rheumatoid nodules suggests that there may
be important differences between the T cell populations
present within these 2 lesions.
Recent evidence suggests that there is a distinct
window early in the inflammatory phase during which
the IL-17A response can be modulated (48). IL-17A
production by murine T cells in vitro is suppressed by
IL-27 when CD4⫹ T cells are in the early stages of T cell
activation, but not when they are fully activated (49).
IL-17 SUBSETS IN RHEUMATOID NODULES AND SYNOVIAL MEMBRANE
Similarly, in murine models, suppression of Th17 cell
development by IFN␥ and IL-4 appears to be limited to
an early stage of Th17 cell differentiation, with mature
Th17 cells being resistant to inhibition by IFN␥ and IL-4
(12). In a murine model of experimental autoimmune
encephalomyelitis, IL-23 was reported to be critical in
the induction phase, but not the effector phase, of the
disease. Of note, fully differentiated T cells that induced
encephalomyelitis could continue to produce IL-17A in
the absence of IL-23 (50). Given these data, it is possible
that the local environment during the initiation phase
differs between synovial lesions and nodule lesions,
thereby allowing expression of Th17 cells and IL-17A
production in the synovium but not the nodule.
In summary, IL-17 subtypes A–F are varyingly
expressed in rheumatoid nodules. IL-17A is absent from
the majority of nodules, despite its presence in rheumatoid synovium. Low levels of IL-23 and high levels of
TGF␤ in the nodule may be the explanation for the
absence of IL-17A. While IL-17A may have a role in the
inflammatory process in the synovium, the nodule appears to be IL-17A independent. The presence of tissue
destruction within the nodule despite the absence of
IL-17A suggests that IL-17A may be an important
amplifier rather than an absolute requirement for inflammation in RA.
AUTHOR CONTRIBUTIONS
Dr. Stamp had full access to all of the data in the study and
takes responsibility for the integrity of the data and the accuracy of the
data analysis.
Study design. Stamp, Highton, Hessian.
Acquisition of data. Easson, Lehnigk, Hessian.
Analysis and interpretation of data. Stamp, Easson, Lehnigk, Highton,
Hessian.
Manuscript preparation. Stamp, Easson, Highton, Hessian.
Statistical analysis. Stamp, Easson, Lehnigk, Hessian.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
REFERENCES
1. Ziff M. The rheumatoid nodule. Arthritis Rheum 1990;33:761–7.
2. Gabriel SE, Crowson CS, Maradit Kremers H, Doran MF, Turesson C, O’Fallon WM, et al. Survival in rheumatoid arthritis: a
population-based analysis of trends over 40 years. Arthritis Rheum
2003;48:54–8.
3. Highton J, Palmer DG, Smith MD, Hessian PA. Phenotypic
markers of lymphocyte and mononuclear phagocyte activation
within rheumatoid nodules. J Rheumatol 1990;17:1130–6.
4. Highton J, Kean A, Hessian PA, Thomson J, Rietveld J, Hart DN.
Cells expressing dendritic cell markers are present in the rheumatoid nodule. J Rheumatol 2000;27:339–46.
5. Hessian PA, Highton J, Kean A, Sun CK, Chin M. Cytokine
profile of the rheumatoid nodule suggests that it is a Th1 granuloma. Arthritis Rheum 2003;48:334–8.
6. Highton J, Hessian PA, Stamp L. The rheumatoid nodule: peri-
20.
21.
22.
23.
24.
1607
pheral or central to rheumatoid arthritis? [editorial]. Rheumatology (Oxford) 2007;46:1385–7.
Kohem CL, Brezinschek RI, Wisbey H, Tortorella C, Lipsky PE,
Oppenheimer-Marks N. Enrichment of differentiated CD45RBdim,
CD27⫺ memory T cells in the peripheral blood, synovial fluid, and
synovial tissue of patients with rheumatoid arthritis. Arthritis
Rheum 1996;39:844–54.
Dolhain RJ, Ter Haar NT, Hoefakker S, Tak PP, de Ley M,
Claassen E, et al. Increased expression of interferon (IFN)-␥
together with IFN-␥ receptor in the rheumatoid synovial membrane compared with synovium of patients with osteoarthritis. Br J
Rheumatol 1996;35:24–32.
Stamp LK, James MJ, Cleland LG. Interleukin-17: the missing link
between T-cell accumulation and effector cell functions in rheumatoid arthritis? Immunol Cell Biol 2004;82:1–9.
Hwang SY, Kim HY. Expression of IL-17 homologs and their
receptors in the synovial cells of rheumatoid arthritis patients. Mol
Cells 2005;19:180–4.
Fossiez F, Djossou O, Chomarat P, Flores-Romo L, Ait-Yahia S,
Maat C, et al. T cell interleukin-17 induces stromal cells to
produce proinflammatory and hematopoietic cytokines. J Exp
Med 1996;183:2593–603.
Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL,
Murphy K, et al. Interleukin 17-producing CD4⫹ effector T cells
develop via a lineage distinct from the T helper type 1 and 2
lineages. Nat Immunol 2005;6:1123–32.
Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, et al.
A distinct lineage of CD4 T cells regulates tissue inflammation by
producing interleukin 17. Nat Immunol 2005;6:1133–41.
Veldhoen M, Hocking R, Atkins C, Locksley RM, Stockinger B.
TGF␤ in the context of an inflammatory cytokine milieu supports
de novo differentiation of IL-17-producing T cells. Immunity
2006;24:179–89.
Bettelli E, Carrier Y, Gao W, Korn T, Storm TB, Oukka M, et al.
Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 2006;441:235–8.
Batten M, Li J, Yi S, Kljavin NM, Danilenko DM, Lucas S, et al.
Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17-producing T cells. Nat
Immunol 2006;7:929–36.
Laurence A, Tato CM, Davidson TS, Kanno Y, Chen Z, Yao Z, et
al. Interleukin-2 signaling via STAT5 constrains T helper 17 cell
generation. Immunity 2007;26:371–81.
Wilson NJ, Boniface K, Chan JR, McKenzie BS, Blumenschein
WM, Matteson JD, et al. Development, cytokine profile and
function of human interleukin 17-producing helper T cells. Nat
Immunol 2007;8:950–7.
Acosta-Rodriguez EV, Napolitani G, Lanzavecchua A, Sallusto F.
Interleukins 1␤ and 6 but not transforming growth factor ␤ are
essential for the differentiation of interleukin 17-producing human
T helper cells. Nat Immunol 2007;8:942–9.
Chen Z, Tato CM, Muul L, Laurence A, O’Shea JJ. Distinct
regulation of interleukin-17 in human T helper lymphocytes.
Arthritis Rheum 2007;56:2936–46.
Hoeve MA, Savage ND, de Boer T, Langenberg DM, de Waal
Malefyt R, Ottenhoff TH, et al. Divergent effects of IL-12 and
IL-23 on the production of IL-17 by human T cells. Eur J Immunol
2006;36:661–70.
Amadi-Obi A, Yu CR, Liu X, Mahdi RM, Clarke GL, Nussenblatt
RB, et al. TH17 cells contribute to uveitis and scleritis and are
expanded by IL-2 and inhibited by IL-27/STAT1. Nat Med 2007;
13:711–8.
Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, et al. The American Rheumatism Association 1987
revised criteria for the classification of rheumatoid arthritis.
Arthritis Rheum 1988;31:315–24.
Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleu-
1608
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
kin-17 family and IL-17 receptors. Cytokine Growth Factor Rev
2003;14:155–74.
Yamaguchi Y, Fujio K, Shoda H, Okamoto A, Tsuno NH,
Takahashi K, et al. IL-17B and IL-17C are associated with TNF-␣
production and contribute to the exacerbation of inflammatory
arthritis. J Immunol 2007;179:7128–36.
Starnes T, Broxmeyer HE, Robertson MJ, Hromas R. IL-17D, a
novel member of the IL-17 family, stimulates cytokine production
and inhibits hemopoiesis. J Immunol 2002;169:642–6.
Fort MM, Cheung J, Yen D, Li J, Zurawski SM, Lo S, et al. IL-25
induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in
vivo. Immunity 2001;15:985–95.
Yao Z, Painter SL, Fanslow WC, Ulrich D, Macduff BM, Spriggs
MK, et al. Human IL-17: a novel cytokine derived from T cells.
J Immunol 1995;155:5483–6.
Jovanovic DV, Di Battista JA, Martel-Pelletier J, Jolicoeur FC, He
Y, Zhang M, et al. IL-17 stimulates the production and expression
of proinflammatory cytokines, IL-␤ and TNF-␣ by human macrophages. J Immunol 1998;160:3513–21.
Koshy PJ, Henderson N, Logan C, Life PF, Cawston TE, Rowan
AD. Interleukin 17 induces cartilage collagen breakdown: novel
synergistic effects in combination with proinflammatory cytokines.
Ann Rheum Dis 2002;61:704–13.
Kotake S, Udagawa N, Takahashi N, Matsuzaki K, Itoh K,
Ishiyama S, et al. IL-17 in synovial fluids from patients with
rheumatoid arthritis is a potent stimulator of osteoclastogenesis.
J Clin Invest 1999;103:1345–52.
Chabaud M, Lubberts E, Joosten L, van den Berg W, Miossec P.
IL-17 derived from juxta-articular bone and synovium contributes
to joint degradation in rheumatoid arthritis. Arthritis Res 2001;3:
168–77.
Lubberts E, van den Bersselaar L, Oppers-Walgreen B, Schwarzenberger P, Coenen-de Roo CJ, Kolls JK, et al. IL-17 promotes
bone erosion in murine collagen-induced arthritis through loss of
the receptor activator of NF-␬B ligand/osteoprotegerin balance.
J Immunol 2003;170:2655–62.
Lubberts E, Koenders MI, Oppers-Walgreen B, van den Bersselaar L, Coenen-de Roo CJ, Joosten LA, et al. Treatment with a
neutralizing anti-murine interleukin-17 antibody after the onset of
collagen-induced arthritis reduces joint inflammation, cartilage
destruction, and bone erosion. Arthritis Rheum 2004;50:650–9.
Koenders MI, Lubberts E, Oppers-Walgreen B, van der Bersselaar
L, Helsen MM, Di Padova FE, et al. Blocking of interleukin-17
during reactivation of experimental arthritis prevents joint inflammation and bone erosion by decreasing RANKL and interleukin-1.
Am J Pathol 2005;167:141–9.
Kirkham BW, Lassere MN, Edmonds JP, Juhasz KM, Bird PA,
Lee CS, et al. Synovial membrane cytokine expression is predictive
of joint damage progression in rheumatoid arthritis: a two-year
prospective study (the DAMAGE Study Cohort). Arthritis Rheum
2006;54:1122–31.
Highton J, Hung N, Hessian P, Wilsher M. Pulmonary rheumatoid
nodules demonstrating features usually associated with rheumatoid synovial membrane. Rheumatology (Oxford) 2007;46:811–4.
Murphy C, Langrish C, Chen Y, Blumenschein W, McClanahan T,
Kastelein R, et al. Divergent pro- and anti-inflammatory roles for
STAMP ET AL
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
IL-23 and IL-12 in joint autoimmune inflammation. J Exp Med
2003;198:1951–7.
Kim HR, Cho ML, Kim KW, Juhn JY, Hwang SY, Yoon CH, et al.
Up-regulation of IL-23p19 expression in rheumatoid arthritis
synovial fibroblasts by IL-17 through PI3-kinase-, NF-␬B- and p38
MAPK-dependent signalling pathways. Rheumatology (Oxford)
2007;46:57–64.
Chu CQ, Swart D, Alcorn D, Tocker J, Elkon KB. Interferon-␥
regulates susceptibility to collagen-induced arthritis through suppression of interleukin-17. Arthritis Rheum 2007;56:1145–51.
Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly
MJ, et al. A genome-wide association study identifies IL23R as an
inflammatory bowel disease gene. Science 2006;314:1461–3.
Orozco G, Rueda B, Robledo G, Garcia A, Martin J. Investigation
of the IL23R gene in Spanish rheumatoid arthritis cohort. Hum
Immunol 2007;68:681–4.
Farago B, Magyari L, Safrany E, Csongei V, Jaromi L, Horvatovich K, et al. Functional variants of interleukin-23 receptor gene
confer risk for rheumatoid arthritis but not for systemic sclerosis.
Ann Rheum Dis 2008;67:248–50.
Wikaningrum R, Highton J, Parker A, Coleman M, Hessian PA,
Roberts-Thomson PJ, et al. Pathogenic mechanisms in the rheumatoid nodule: comparison of proinflammatory cytokine production and cell adhesion molecule expression in rheumatoid nodules
and synovial membranes from the same patient. Arthritis Rheum
1998;41:1783–97.
Baeten D, De Keyser F, Veys EM, Theate Y, Houssiau FA, Durez
P. Tumor necrosis factor ␣ independent disease mechanisms in
rheumatoid arthritis: a histopathological study on the effect of
infliximab on rheumatoid nodules. Ann Rheum Dis 2004;63:
489–93.
Elewaut D, De Keyser F, De Wever N, Baeten D, Van Damme N,
Verbruggen G, et al. A comparative phenotypical analysis of
rheumatoid nodules and rheumatoid synovium with special reference to adhesion molecules and activation markers. Ann Rheum
Dis 1998;57:480–6.
De Keyser F, Elewaut D, Overmeer-Graus JP, van den Broek P,
Rijnders AW, Veys EM. Dominant T cell receptor rearrangements
in IL-2 expanded lymphocytes from rheumatoid nodules suggest
antigen driven T cell activation in situ. J Rheumatol 1997;24:
1685–9.
Sarkar S, Tesmer LA, Hindnavis V, Endres JL, Fox DA. Interleukin-17 as a molecular target in immune-mediated arthritis: immunoregulatory properties of genetically modified murine dendritic
cells that secrete interleukin-4. Arthritis Rheum 2007;56:89–100.
Yoshimura T, Takeda A, Hamano S, Miyazaki Y, Kinjyo I,
Ishibashi T, et al. Two-sided roles of IL-27: induction of Th1
differentiation on naive CD4⫹ T cells versus suppression of
proinflammatory cytokine production including IL-23-induced
IL-17 on activated CD4⫹ T cells partially through STAT3-dependent mechanism. J Immunol 2006;177:5377–85.
Thakker P, Leach MW, Kuang W, Benoit SE, Leonard JP,
Marusic S. IL-23 is critical in the induction but not in the effector
phase of experimental autoimmune encephalomyelitis. J Immunol
2007;178:2589–98.
Документ
Категория
Без категории
Просмотров
0
Размер файла
174 Кб
Теги
subsets, 17a, membraneabsence, nodule, different, interleukin, synovial, rheumatoid, cells
1/--страниц
Пожаловаться на содержимое документа