close

Вход

Забыли?

вход по аккаунту

?

Differential recognition of heat-shock protein dnaJderived epitopes by effector and Treg cells leads to modulation of inflammation in juvenile idiopathic arthritis.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 56, No. 5, May 2007, pp 1648–1657
DOI 10.1002/art.22567
© 2007, American College of Rheumatology
Differential Recognition of Heat-Shock Protein dnaJ–Derived
Epitopes by Effector and Treg Cells Leads to Modulation of
Inflammation in Juvenile Idiopathic Arthritis
Margherita Massa,1 Maristella Passalia,1 Silvia Magni Manzoni,2 Rita Campanelli,1
Laura Ciardelli,2 Gisella Puga Yung,3 Sylvia Kamphuis,4 Angela Pistorio,5 Valentina Meli,6
Alessandro Sette,7 Berent Prakken,4 Alberto Martini,8 and Salvatore Albani9
Objective. To identify epitopes on Escherichia coli
heat-shock protein (HSP) dnaJ or on homologous human HSP dnaJ involved in the induction/modulation of
autoimmune inflammation in patients with oligoarticular juvenile idiopathic arthritis (JIA).
Methods. We used a proliferation assay and cytokine production to evaluate the immune responses of
synovial fluid mononuclear cells (SFMCs) to pan–
HLA–DR binder peptides derived from either homologous or nonhomologous regions on bacterial and human
HSP dnaJ. Cytofluorometric analysis was performed in
order to phenotype and sort Treg cells. Sorted cells were
then analyzed for the expression of the forkhead box P3
(FoxP3) transcription factor, and their regulatory capacity was tested in coculture assays.
Results. T cell responses to E coli HSP dnaJ–
derived peptides were eminently proinflammatory. Conversely, peptides derived from human HSP dnaJ induced interleukin-10 (IL-10) production from SFMCs of
patients with oligoarticular JIA. A positive correlation
was found between disease with a better prognosis
(persistent oligoarticular JIA) and recognition of 3
human HSP dnaJ–derived peptides. The recognition of
the human peptide H134–148 also induced a significantly greater amount of IL-10 in patients with persistent oligoarticular JIA than in those with extended
oligoarticular JIA (P ⴝ 0.0012). Incubation of SFMCs
from patients with persistent oligoarticular JIA with
this human epitope increased the percentage of Treg
cells and FoxP3 expression. It also induced the recovery
of suppressor activity by Treg cells.
Conclusion. This is the first description of a
self-regulating immune modulator circuit active during
autoimmune inflammation through recognition of HSP
epitopes with different functional properties. These
epitopes induce T cells with regulatory function. Such
induction correlates with disease severity and prognosis.
Supported by “Ricerca Corrente” grants from the IRCCS
Policlinico San Matteo, Pavia, Italy.
1
Margherita Massa, PhD, Maristella Passalia, PhD, Rita
Campanelli, PhD: Fondazione IRCCS Policlinico San Matteo, Pavia,
Italy, and EUREKA Institute for Translational Medicine, Siracusa,
Italy; 2Silvia Magni Manzoni, MD, Laura Ciardelli, PhD: Fondazione
IRCCS Policlinico San Matteo, Pavia, Italy; 3Gisella Puga Yung, PhD:
University of California, San Diego, La Jolla, California, and
EUREKA Institute for Translational Medicine, Siracusa, Italy; 4Sylvia
Kamphuis, MD, Berent Prakken, MD, PhD: University Medical
Center Utrecht, Utrecht, The Netherlands, and EUREKA Institute
for Translational Medicine, Siracusa, Italy; 5Angela Pistorio, MD,
PhD: IRCCS G. Gaslini, Genoa, Italy; 6Valentina Meli: Androclus
Therapeutics, Milan, Italy, and EUREKA Institute for Translational
Medicine, Siracusa, Italy; 7Alessandro Sette, PhD: La Jolla Institute
for Allergy and Immunology, La Jolla, California; 8Alberto Martini,
MD: IRCCS G. Gaslini, University of Genoa, Genoa, Italy, and
EUREKA Institute for Translational Medicine, Siracusa, Italy; 9Salvatore Albani, MD, PhD: University of California, San Diego, La Jolla,
California, Androclus Therapeutics, Milan, Italy, and EUREKA Institute for Translational Medicine, Siracusa, Italy.
Drs. Prakken and Albani are coinventors of concepts and
sequences, patents for which are owned by University of California,
San Diego.
Address correspondence and reprint requests to Salvatore
Albani, MD, PhD, University of California at San Diego, Departments
of Medicine and Pediatrics, 9500 Gilman Drive, La Jolla, CA 920930731. E-mail: salbani@ucsd.edu.
Submitted for publication December 20, 2005; accepted in
revised form January 24, 2007.
Oligoarticular juvenile idiopathic arthritis (JIA)
is an example of a human autoimmune disease in which
2 subsets, each with a distinct prognosis, are present
(1,2). The extended form is characterized by progressive
involvement of multiple joints, with chronic erosive
disease and a worse prognosis than the self-limiting form
(persistent oligoarticular JIA). Since the clinical picture
is most likely affected by the underlying immune pro1648
EPITOPE-SPECIFIC REGULATION OF HUMAN ARTHRITIS
1649
cesses, oligoarticular JIA may represent a useful model
for studying naturally occurring mechanisms of antigenspecific, T cell–mediated immune modulation (3–7).
One of the fundamental limitations encountered
to date in studies focused on the role played by T cells in
human autoimmunity is that, by analogy with animal
models, research has often identified the antigen with
the trigger. This approach has generated a significant
amount of elegant but somewhat inconclusive data. The
search for the elusive trigger of human autoimmunity
could perhaps be refocused on antigens which participate in the mechanisms that are relevant to the perpetuation and modulation of autoimmune inflammation
without necessarily being their trigger. This would increase the likelihood for the mechanism to be functionally relevant.
Heat-shock proteins (HSPs) are among the few
families of proteins which fit all these criteria. HSPs are
molecular chaperones that are highly conserved during
evolution. At times of cellular stress, including infection
and chronic inflammation, the expression of HSPs is
up-regulated (8). It could be argued that HSPs are
recognized as one of the first danger signals, and as such,
they usually evoke a strong inflammatory response.
Control of such responses is usually achieved through
various, still poorly characterized mechanisms, which
may be impaired in autoimmunity. Interestingly, it has
recently been shown (9) that immunization of mice with
HSP dnaJ leads to restoration of Treg cell activity, thus
raising questions related to the nature of the epitope
involved and to the mechanisms responsible for this
effect in human autoimmunity.
We and others have previously shown that recognition of HSPs can lead to T cell responses that are
immunologically relevant in autoimmune diseases (10–
17). Attempts have been made to correlate such responses with the clinical picture. Such analyses did not
lead to conclusive results, since often, whole proteins
rather than individual epitopes were used. Identification
of the appropriate epitopes is a crucial step in dissecting
the molecular mechanisms of inflammation with particular focus on the identification of antigen-driven Treg
cells (9,10,18–20). These cells play a central role in
modulating antigen-specific responses and may be
strongly implicated in the natural mechanisms controlling inflammation (21–24).
We studied T cell responses to epitopes derived
from homologous and nonhomologous regions of Escherichia coli and human HSP dnaJ. In order to simplify
the identification of the relevant epitopes among the
myriad of candidates, we used a computer algorithm to
scan human and bacterial dnaJ sequences for peptides
bearing pan–HLA–DR binding motifs (25). We then
tested the candidates for immunogenicity in patients
with oligoarticular JIA and in appropriate controls. We
associated the clinical picture with the quality of immune reactivity to individual peptides. We also evaluated the possible effect of recognition of these epitopes
on T cells with a regulatory phenotype.
PATIENTS AND METHODS
Patients and controls. Peripheral blood mononuclear
cells (PBMCs) and/or synovial fluid mononuclear cells
(SFMCs) were obtained from 45 patients (mean age 11 years,
range 3–22 years) fulfilling the criteria for the diagnosis of JIA
(26). Seven patients had systemic JIA, 7 had polyarticular JIA,
and 31 had oligoarticular JIA. All patients with oligoarticular
JIA were antinuclear antibody positive. Patients with
enthesitis-related HLA–B27–positive (by serologic typing) JIA
or rheumatoid factor–positive (by standard latex test) polyarticular JIA were not included in the study. At the time of
sampling, all patients had active disease, defined according to
the presence of synovitis upon examination; the extent of joint
involvement was measured as the number of joints with active
arthritis.
Patients with oligoarticular JIA were divided into 2
groups according to their disease course: those with the
persistent form (n ⫽ 16), in which the disease remained limited
to ⱕ4 joints, and those with the extended form (n ⫽ 15), in
which the disease extended to involve ⱖ5 joints. Patients with
persistent oligoarticular JIA had a stable form of the disease,
as determined by at least a 1-year period of observation.
Among patients with oligoarticular JIA, 4 received no treatment and all others were receiving nonsteroidal antiinflammatory drugs. Four of the patients with extended oligoarticular
JIA were also receiving methotrexate. None of the patients was
treated with cyclosporin A.
For controls, we used PBMCs from 10 age-matched
healthy subjects who were hospitalized for minor surgical
procedures. SF samples were collected at the time of intraarticular steroid injection. The outcome of the intraarticular
injection was evaluated as the number of months of complete
clinical response (i.e., no evidence of synovitis clinically) of the
injected joint (27). Patients were routinely assessed every 3
months, or earlier if requested by parents because of disease
worsening.
Consent. The study was approved by the Institutional
Ethical Committee. Permission for drawing of extra blood
during routine venipuncture was obtained from the parents of
all enrolled children.
Antigens. Recombinant E coli HSP dnaJ (rdnaJ;
Stressgen, Victoria, British Columbia, Canada) and 3 human
HSP dnaJ (HSJ1, HDJ1, HDJ2) were used to identify class II
major histocompatibility complex binder peptides.
Identification of putative epitopes. Sequence homologies among E coli HSP dnaJ and the human homologs HSJ1,
HDJ1, or HDJ2 were obtained by nonredundant scanning of
the National Center for Biotechnology Information database
using BLASTA and FASTA software. Prediction of HLA class
1650
Figure 1. Top, Codes and amino acid sequences of Escherichia coli
heat-shock protein (HSP) dnaJ–derived peptides and their human
homologs. HSJ1, HDJ1, and HDJ2 are 3 human HSP dnaJ. Bottom,
Codes and amino acid sequences of uniquely human peptides.
II universal major binding motifs was performed using a
computerized prediction of peptide binding motifs to individual HLA-derived alleles based on the BIMAS site (online at
www.bimas.dcrt.nih.gov) or on pan–HLA class II binding
motifs based on published algorithms (provided by AS).
The N-terminal region of E coli and of human HSP
dnaJ isoforms presents homologous sequences. No sequence
homology is present in the C-terminal region. Three sets of
peptides were used: 1) bacterial peptides derived from both
N-terminal and C-terminal regions of E coli HSP dnaJ (indicated in Figure 1 as amino acid sequences with the prefix B);
2) human peptides homologous to bacterial peptides derived
from the N-terminal region of HSJ1, HDJ1, or HDJ2 dnaJ
isoforms (indicated in Figure 1 as amino acid sequences with
the prefix H); and 3) uniquely human peptides derived from
HSJ1 and HDJ2 C-terminal regions (Figure 1). For an unrelated control peptide, we tested the 15-mer peptide pan–
HLA–DR negative (AJAAAATLKAA) (J stands for cyclohexyl alanine).
MASSA ET AL
Proliferation assay. PBMCs or SFMCs, obtained by
Lymphoprep density-gradient centrifugation (Nycomed
Pharma, Oslo, Norway), were washed twice and suspended in
RPMI 1640 supplemented with 10% human type AB serum
(Sigma, St. Louis, MO), 2 mM L-glutamine (Euroclone, Wetherby, UK), and 50 ␮g/ml gentamicin (Gibco, Grand Island, NY).
PBMCs and SFMCs were cultured in triplicate in flatbottomed 96-well plates (Costar, Cambridge, MA) at 3 ⫻
105/well, with or without 10 ␮g/ml of antigen (rdnaJ), and were
incubated for 96 hours at 37°C in 5% CO2. During the last 16
hours, 3H-thymidine was added to each well. The results are
expressed as a stimulation index (mean counts per minute of
cultures with antigen/mean cpm of cultures without antigen).
Generation of short-term peptide-specific T cell line.
SFMCs (3 ⫻ 106) were cultured in 24-well plates (Costar) in
the presence of 10 ␮g/ml of rdnaJ at 37°C in 5% CO2. On day
3, cells were counted and aliquots of 3 ⫻ 105 cells were
incubated in 96-well plates with 2 ⫻ 105 irradiated (3,500 rads)
autologous SFMCs and 20 ␮g/ml of control peptide, peptides
derived from E coli HSP dnaJ, or human HSJ1, HDJ1, or
HDJ2. All experiments were set up in triplicate. Cells were
cultured for 96 hours at 37°C in 5% CO2; during the last 16
hours, 3H-thymidine was added to each well.
Cytokine measurement. Supernatants of SFMCs were
collected after 72 hours of incubation with or without bacterial
or human peptides. Supernatants, which had been stored at
⫺20°C, were used in commercially available solid-phase enzyme immunoassays for interleukin-10 (IL-10) (R&D Systems,
Minneapolis, MN), interferon-␥ (IFN␥) (Bender MedSystems,
Vienna, Austria), or IL-4 (Ultrasensitive kit; BioSource International, Camarillo, CA).
Cytofluorometric analysis. Freshly isolated SFMCs
(5 ⫻ 105) were stained with peridinin chlorophyll protein–
conjugated anti-CD4 (BD PharMingen, San Diego, CA) and
allophycocyanin-conjugated anti-CD25 (BD PharMingen) at
4°C for 30 minutes. The intracellular staining was performed
with a Cytofix/Cytoperm kit (BD PharMingen) using
phycoerythrin-conjugated anti–CTLA-4 (20 ␮l; BD PharMingen) and fluorescein isothiocyanate–conjugated anti–
IL-10 (ImmunoKontact, AMS Biotechnology, Abingdon, UK).
The same procedure was performed following a 72-hour
culture of SFMCs in flat-bottomed 96-well plates in the
presence of medium, the human peptide H134–148 (20 ␮g/ml),
or the bacterial peptide B174–188 (20 ␮g/ml). Four hours
before beginning the staining procedure, brefeldin A (10
␮g/ml) was added to each well.
The samples were run on a flow cytometer (FACSCalibur; Becton Dickinson, San Jose, CA), collecting data for 2 ⫻
105 cells, and analyzed using CellQuest software (BD Biosciences, San Jose, CA). CD4⫹ cells with a high degree of
CD25 fluorescence intensity (fluorescence intensity ⬎102)
(region R2 [see below]) were gated and analyzed for CTLA-4
expression. CD4⫹,CD25⫹high,CTLA-4⫹ cells were then gated
and evaluated for intracellular IL-10. The specific percentage
of positive cells was calculated by subtracting the values
obtained with medium.
RNA extraction, preamplification, and complementary
DNA (cDNA) synthesis. Total RNA was isolated from
CD4⫹,CD25⫹high and CD4⫹,CD25dim cells sorted (FACSVantage; Becton Dickinson) from freshly isolated SFMCs
using RNeasy Micro columns (Qiagen, Valencia, CA) accord-
EPITOPE-SPECIFIC REGULATION OF HUMAN ARTHRITIS
ing to the manufacturer’s instructions, adding carrier RNA at
the initial step. RNA was eluted with 14 ␮l RNase-free water.
Six microliters of RNA was preamplified using MessageAmp
aRNA kit (Ambion, Austin, TX). The same procedure was
performed with 5 ⫻ 105 SFMCs cultured for 72 hours in
flat-bottomed 96-well plates with the human peptide H134–
148 (20 ␮g/ml) or the bacterial peptide B174–188 (20 ␮g/ml).
CD4⫹,CD25⫹high and CD4⫹,CD25dim SFMCs were sorted at
the end of the culture.
Nine microliters of the amplified RNA was used for
cDNA synthesis. The oligo(dT)12-18 (Invitrogen, Carlsbad,
CA) primed first-strand cDNA synthesis was carried out in 20
␮l with ImProm II reverse transcriptase (Promega, Madison,
WI) according to the manufacturer’s instructions (Technical
Manual 236).
Real-time polymerase chain reaction (PCR). TaqMan
probes and primers were designed with Primer Express software (PE Applied Biosystems, Foster City, CA). Probes and
primers were as follows: for the forkhead box P3 (FoxP3)
transcription factor, forward primer 5⬘-TCACCTACGCCACGCTCAT-3⬘, reverse primer 5⬘-TCATTGAGTGTCCGCTGCTT-3⬘, probe 5⬘-JOE/TGGGCCATCCTGGAGGCTCCA/3BHQ1-3⬘; and for GAPDH, forward primer
5⬘-CCACCCATGGCAAATTCC-3⬘, reverse primer 5⬘TGGGATTTCCATTGATGACAAG-3⬘, probe 5⬘-FAM/
TGGCACCGTCAAGGCTGAGAACG/3BHQ-3⬘. The PCR
reactions were carried out using TaqMan universal PCR
master mix (PE Applied Biosystems) with 900 nM oligonucleotide primers (IDT Inc., Coralville, IA), 200 nM fluorogenic
probe (IDT Inc.), and 5 ␮l of undiluted cDNA. For the final
detection, the ABI Prism 7000 sequence detector (Applied
Biosystems, Foster City, CA) was programmed to an initial
step of 2 minutes at 50°C and 10 minutes at 95°C, followed by
45 thermal cycles of 15 seconds at 95°C and 1 minute at 60°C.
Each measurement was carried out in duplicate. Calculations
were done by the relative standard curve method, and results
are expressed as an induction index (in arbitrary units), using
the unstimulated condition in each cell population as a reference.
Coculture experiments. SFMCs (3 ⫻ 106) were cultured in 24-well plates in the presence of the human peptide
H134–148 (20 ␮g/ml) at 37°C in 5% CO2 for 72 hours.
CD4⫹,CD25⫺ and CD4⫹,CD25⫹high SF T cells were sorted
by a FACSVantage fluorescence-activated cell sorter (FACS).
FACS reanalysis of an aliquot of sorted cells showed that the
purity was 95% on average. FACS-sorted CD4⫹,CD25⫺ T
cells (1.6 ⫻ 103) were cultured with soluble anti-CD3 (OKT-3,
30 ng/ml), the human peptide H134–148 (20 ␮g/ml), or the E
coli HSP dnaJ–derived peptide B174–188 (20 ␮g/ml) in plates
with 96 U-bottomed wells; similarly, 1.6 ⫻ 103 FACS-sorted
CD4⫹,CD25⫹high T cells were cultured with soluble anti-CD3.
FACS-sorted CD4⫹,CD25⫺ T cells (1.6 ⫻ 103) were
cultured in the presence of 1.6 ⫻ 10 3 FACS-sorted
CD4⫹,CD25⫹high T cells with soluble anti-CD3, the human
peptide H134–148, or the E coli HSP dnaJ–derived peptide
B174–188 in U-bottomed 96-well plates. For a control,
CD4⫹,CD25⫺ T cells were cocultured with CD4⫹,CD25⫺ T
cells at the same ratio. Autologous irradiated (3,500 rads)
PBMCs (6 ⫻ 104) were added to each well as antigenpresenting cells. The cells were incubated at 37°C for 6 days,
1651
Figure 2. Proliferation of peripheral blood mononuclear cells
(PBMCs) or synovial fluid mononuclear cells (SFMCs) from healthy
controls (Ctrl) or from patients with systemic (Syst), polyarticular
(Poly), or oligoarticular (Oligo) juvenile idiopathic arthritis (JIA) in
response to recombinant Escherichia coli heat-shock protein dnaJ.
Results are expressed as the stimulation index (SI). Values are the
mean and SEM. P ⫽ 0.01 for SFMCs versus PBMCs in patients with
oligoarticular JIA.
the last 16 hours in the presence of 3H-thymidine. The
suppressive activity of CD4⫹,CD25⫹ cells is expressed as the
percentage of inhibition of the proliferation of CD4⫹,CD25⫺
cells cultured with soluble anti-CD3, the bacterial peptide, or
the human peptide (mean 3H-thymidine incorporation [cpm]
of triplicate wells).
Statistical analysis. Data were analyzed using the
nonparametric analysis of variance (Kruskal-Wallis test) and
Duncan’s test as a post hoc test. The Mann-Whitney U test for
unpaired samples was used where indicated. Correlations
between variables were performed by means of the nonparametric Spearman’s correlation coefficient. P values less than
0.05 were considered significant.
RESULTS
Immune responses to recombinant E coli HSP
dnaJ found in SFMCs of patients with oligoarticular
JIA. Proliferative responses of SFMCs from patients
with oligoarticular JIA to recombinant E coli HSP dnaJ
(rdnaJ) showed an SI ⬎3 in 24 of 31 patients (range
2.1–26.5) and were significantly higher (P ⫽ 0.01) than
those of the corresponding PBMCs. In contrast, SFMCs
from patients with systemic or polyarticular JIA showed
negligible responses that were not different from those
obtained with PBMCs (Figure 2). In addition, SFMCs
from patients with oligoarticular JIA cultured with rdnaJ
led to a percentage of activated CD3⫹,CD69⫹ T cells
significantly higher than that found in PBMCs (mean ⫾
SEM 5.7 ⫾ 1.0% versus 0.8 ⫾ 0.3%; P ⫽ 0.0002).
1652
Induction by E coli HSP dnaJ–derived peptides
of proinflammatory T cell responses in SFMCs of
patients with oligoarticular JIA. SFMCs from patients
with oligoarticular JIA were incubated with pan–
HLA–DR binder peptides derived from either the
N-terminal region (presenting sequence homology with
human dnaJ isoforms) or the C-terminal region (presenting no sequence homology with human dnaJ isoforms) of E coli HSP dnaJ, to be tested as T cell antigens
(indicated as amino acid sequences with the prefix B in
Figure 1). SFMCs showed proliferative responses significantly higher (P ⬍ 0.03) than those obtained with the
control peptide (pan–HLA–DR negative) following incubation with 2 N-terminal (B22–36, B174–188) and 2
C-terminal (B61–75, B268–282) E coli HSP dnaJ–
derived peptides (Figure 3A).
SFMCs of patients with systemic or polyarticular
JIA, tested as disease controls, showed negligible proliferative responses to bacterial peptides (Figure 3A). No
significant differences in T cell reactivity were found
among groups of patients undergoing different therapeutic regimens (data not shown).
The reactivity of SFMCs from patients with oligoarticular JIA to 3 of the 4 antigenic bacterial peptides
was associated with a culture supernatant production of
IFN␥ significantly higher than that with the pan–HLA–
DR–negative control peptide (Figure 3B), while IL-4
and IL-10 were not detectable (data not shown). The
supernatant production of IFN␥, IL-4, or IL-10 in the
presence of all the other peptides tested for the induction of proliferative responses was comparable with that
obtained with the control peptide.
Human HSP dnaJ–derived peptides as a possible
mechanism of naturally occurring immunomodulation
in SFMCs of patients with oligoarticular JIA. We
evaluated the reactivity of SFMCs from patients with
oligoarticular JIA to pan–HLA–DR binder human peptide homologs to the bacterial peptides B22–36 (H20–
34, H21–35, and H23–37) (Figure 1) and B174–188
(H164–178, H167–181, and H176–190) (Figure 1) and to
peptides derived from the C-terminal region of human
HSP HSJ1 and HDJ2 presenting no sequence homology
with E coli HSP dnaJ (Figure 1). All of the human
peptides triggered cell proliferation and IFN␥ production that were not significantly different from those
obtained in response to the pan–HLA–DR–negative
control peptide (data not shown).
In contrast to the results obtained with bacterial
peptides, SFMCs from patients with oligoarticular JIA
(n ⫽ 31) cultured with human peptides, homologous or
not to bacterial peptides, produced detectable amounts
MASSA ET AL
Figure 3. A, Proliferative responses of SFMCs from patients with
oligoarticular JIA (n ⫽ 31) or systemic/polyarticular JIA (n ⫽ 7 each)
in the presence of control peptide (panDR⫺) or Escherichia coli
heat-shock protein (HSP) dnaJ–derived peptides. Results are expressed as the SI. Values are the mean and SEM. ⴱ ⫽ P ⬍ 0.03 versus
control peptide. B, Interferon-␥ (IFN␥) production in supernatants of
SFMCs from patients with oligoarticular JIA (n ⫽ 31) in the presence
of control peptide or of E coli HSP dnaJ–derived peptides. Values are
the mean and SEM. See Patients and Methods and Figure 1 for
description of peptides. See Figure 2 for other definitions.
of IL-10 (range 12–74 pg/ml) in a proportion that varied
from 5% to 37% and that was higher than that obtained
with the control peptide (⬍3.8 pg/ml). These data
suggest that human-derived peptides trigger qualitatively different T cell responses that may modulate the
inflammatory activity in patients with oligoarticular JIA.
IL-4 was undetectable (data not shown).
We tested a limited number of patients with
systemic JIA (n ⫽ 2) and polyarticular JIA (n ⫽ 3);
proliferative responses to human peptides were lower
than those obtained with the control pan–HLA–DR–
negative peptide. In addition, cytokine production
(IFN␥, IL-4, and IL-10) in response to human peptides
EPITOPE-SPECIFIC REGULATION OF HUMAN ARTHRITIS
Figure 4. A, Proliferation of SFMCs from 16 patients with persistent
oligoarticular JIA (open bars) or from 15 patients with extended
oligoarticular JIA (shaded bars) cultured with the H167–181, H176–
190, or H134–148 human peptides. Results are expressed as the SI.
Values are the mean and SEM. B, Evaluation of SFMC interleukin-10
(IL-10) production in culture supernatants. Values are the mean and
SEM. P values shown are for patients with persistent oligoarticular JIA
versus patients with extended oligoarticular JIA, by Mann-Whitney U
test. See Patients and Methods and Figure 1 for description of
peptides. See Figure 2 for other definitions.
from patients with either polyarticular or systemic JIA
was always below the detection limit of the assays
performed.
Association of immunomodulation by self
epitopes with disease severity. To explore the possible
association between reactivity to human HSP dnaJ–
derived peptides and clinical features, patients were
divided according to their disease course into those with
persistent (n ⫽ 16) and those with extended (n ⫽ 15)
oligoarticular JIA (see Patients and Methods). As shown
in Figure 4A, we found that the proliferative responses
of SFMCs from patients with persistent oligoarticular
1653
JIA were significantly higher than those obtained with
SFMCs from patients with extended oligoarticular JIA
following incubation with peptide H167–181 or peptide
H176–190, both homologs of the E coli HSP dnaJ–
derived peptide B174–188.
Similar results were obtained when the uniquely
human peptide H134–148 was used (Figure 4A); in
addition, IL-10 production in supernatants from SFMCs
stimulated with the H134–148 peptide, but not with the
H167–181 or H176–190 peptides, was significantly
higher (P ⫽ 0.0012) in patients with persistent oligoarticular JIA than in those with extended oligoarticular
JIA (Figure 4B), indicating an important qualitative
difference in T cell recognition of this peptide in persistent versus extended oligoarticular JIA. In order to
further analyze possible associations with a more benign
disease, we also considered the duration of the clinical
remission in the studied joint following intraarticular
administration of steroids as a measure of the degree of
inflammatory activity in individual joints. We found that
IL-10 production in response to the human peptide
H134–148 was significantly directly correlated with this
parameter (␳ ⫽ 0.537, P ⫽ 0.026; n ⫽ 14). The production of IFN␥ in culture supernatants of SFMCs stimulated with human peptides was comparable in patients
with persistent or extended oligoarticular JIA (data not
shown).
Expansion of SF Treg cells in patients with
persistent oligoarticular JIA resulting from recognition
of the H134–148 peptide. To determine whether the
immune responses of SFMCs to the human peptide
H134–148 might be related to modulation of autoimmune inflammation through the induction of Treg
cells, SFMCs from 10 patients with persistent oligoarticular JIA were tested before and after 3-day in vitro
culture with medium or the human peptide H134–148.
B174–188 peptide, derived from E coli HSP dnaJ, was
used as control. By cytofluorometric analysis (for 1
representative patient) (Figure 5A), CD4⫹ cells were
gated according to the high degree of CD25 fluorescence intensity (region R2). CD4⫹,CD25⫹high cells
were then analyzed for CTLA-4 and IL-10 coexpression.
The percentage of CD4⫹,CD25⫹high,CTLA-4⫹,IL-10⫹
cells following incubation with the H134–148 peptide
was significantly higher than that found following incubation with the B174–188 peptide (P ⬍ 0.05) and
increased with respect to that found in unstimulated
cells (P ⫽ 0.05) (Figure 5B).
To further corroborate the concept that recognition of H134–148 may affect Treg cell function, we
1654
MASSA ET AL
function. CD4⫹,CD25⫹high and CD4⫹,CD25⫹dim
SFMCs (regions R2 and R1, respectively, in Figure 5A)
were sorted and assessed for the expression of FoxP3 by
quantitative PCR as unstimulated cells and after incubation with the human H134–148 peptide, or after
incubation with the bacterial B174–188 peptide used as
control. Increased amounts of FoxP3 messenger RNA
(mRNA) were found in CD4⫹,CD25⫹high cells incubated with the H134–148 peptide compared with cells
incubated with the E coli HSP dnaJ–derived B174–188
(control) peptide or compared with unstimulated
CD4⫹,CD25⫹high cells (Figure 5C).
Figure 5. A, Representative analysis of SFMCs (from 1 patient) cultured
with H134–148 human peptide. SFMCs stained with anti-CD4 and
anti-CD25 monoclonal antibodies were gated according to a high CD25
fluorescence intensity (region R2). B, Unstimulated CD4⫹,CD25⫹
SFMCs gated in region R2 were analyzed for the coexpression of CTLA-4
and intracellular interleukin-10 (IL-10). The same analysis was performed
on these cells after a 3-day incubation with the bacterial peptide B174–188
or the human peptide H134–148. Results were obtained from 10 patients
with persistent oligoarticular JIA. Values are the mean and SEM. C,
CD4⫹,CD25⫹dim (region R1 in A) and CD4⫹,CD25⫹high (region R2 in
A) SFMCs were sorted and analyzed for FoxP3 transcription factor
expression in unstimulated cells and following 3 days of incubation with
the bacterial heat-shock protein dnaJ B174–188 or the human peptide
H134–148. Results are expressed as threshold cycle values which were
normalized to GAPDH expression. The induction index (in arbitrary units
[AU]) is the result of the normalization process. Values are the mean and
SEM. See Patients and Methods and Figure 1 for description of peptides.
See Figure 2 for other definitions.
tested in SFMCs from 8 patients whether in vitro
exposure of SFMCs to H134–148 peptide would induce
FoxP3 expression as an indication of restored Treg cell
Figure 6. A, Proliferative responses of sorted CD4⫹,CD25⫺ (Figure
5A, upper left quadrant) SF T cells from 6 patients with persistent
oligoarticular JIA to soluble anti-CD3 (OKT3), the bacterial peptide
B174–188, or the human peptide H134–148. Proliferative responses of
sorted CD4⫹,CD25⫹high SF T cells (Figure 5A, region R2) to soluble
anti-CD3 (OKT3) are also shown. Results are expressed as 3Hthymidine incorporation. Values are the mean and SEM. B,
CD4⫹,CD25⫺ and CD4⫹,CD25⫹high T cells were sorted from SFMCs
after in vitro culture with the H134–148 human peptide. The sorted cell
subsets were cocultured (at a ratio of 1:1) in the presence of soluble
anti-CD3, Escherichia coli heat-shock protein dnaJ–derived B174–188
peptide, the human H134–148 peptide, or both the human H134–148
peptide and soluble anti-CD3. Results of coculture experiments are
expressed as the percentage of inhibition with respect to the culture of
CD4⫹,CD25⫺ cells with anti-CD3, the bacterial peptide, or the human
peptide. Values are the mean and SEM. See Patients and Methods and
Figure 1 for description of peptides. See Figure 2 for other definitions.
EPITOPE-SPECIFIC REGULATION OF HUMAN ARTHRITIS
1655
Functional CD4ⴙ,CD25ⴙhigh Treg cells induced
by H134–148 peptide in SFMCs of patients with persistent oligoarticular JIA. SFMCs from 6 patients with
persistent oligoarticular JIA were cultured with the
H134–148 peptide. CD4⫹,CD25⫺ T cells (upper left
quadrant in Figure 5A) and CD4⫹,CD25⫹high T cells
(region R2 in Figure 5A) were then sorted. The proliferative responses of the CD4⫹,CD25⫺ T cells cultured
with soluble anti-CD3, B174–188, or H134–148 as well
as those of the CD4⫹,CD25⫹high T cells incubated with
soluble anti-CD3 are shown in Figure 6A.
CD4⫹,CD25⫺ T cells were then cultured in the presence of CD4⫹,CD25ⴙhigh T cells (at a 1:1 ratio) and
soluble anti-CD3, B174–188 peptide, or H134–148 peptide. As shown in Figure 6B, CD4⫹,CD25⫹high SF T
cells did not suppress the proliferation of CD4⫹,CD25⫺
T cells stimulated with soluble anti-CD3 or B174–188
peptide. In contrast, when the coculture experiments
were performed with the H134 –148 peptide,
CD4⫹,CD25⫹ high T cells were able to suppress
CD4⫹,CD25⫺ responder T cells (44% mean inhibition). Suppression by CD4⫹,CD25⫹high SF T cells was
also found when CD4⫹,CD25⫺ T cells were stimulated
with soluble anti-CD3 in the presence of H134–148
peptide, which induced a 40% mean inhibition of the
proliferation obtained in cocultures stimulated with soluble anti-CD3 alone. Due to a limited number of
CD4⫹,CD25⫹high cells, we were not able to evaluate the
effect of a control peptide (i.e., B174–188) on the
response to anti-CD3.
This last peptide induced significantly greater IL-10
production in SFMCs from patients with persistent
oligoarticular JIA than in those from patients with
extended oligoarticular JIA, and this production was
significantly correlated with the duration of the clinical
remission in the single joints evaluated, thus suggesting
a protective role for such responses. Interestingly, in
vitro exposure of SFMCs from patients with persistent
oligoarticular JIA to H134–148 peptide induced a percentage of CD4⫹,CD25⫹high T cells coexpressing
CTLA-4 and IL-10 higher than that obtained in SFMCs
incubated with the bacterial peptide B174–188 and
higher than that obtained in unstimulated SFMCs. Similarly, sorted CD4⫹,CD25⫹high T cells showed higher
amounts of FoxP3 mRNA following culture with the
H134–148 peptide than following culture with the B174–
188 peptide, or compared with unstimulated cells. This
translated functionally into restoration of the ability of
these T cells to suppress effector T cell proliferation in
vitro.
Altogether, these data indicate a dichotomy in
the quality of immune responses to different epitopes
from the same protein. Recognition of epitopes derived
from bacterial HSP dnaJ is associated with an inflammatory phenotype. Conversely, T cell recognition of self
peptides is associated with immune mechanisms with
regulatory function, including the presence of T cells
with the regulatory functional phenotype. These responses are significantly augmented in patients with a
more benign form of oligoarticular JIA, thus suggesting
a direct role in modulation of autoimmune inflammation.
Recently, a number of regulatory pathways have
been described in oligoarticular JIA (7,10,19,20). Many
studies suggest that induction of Treg cells is one of the
host’s natural mechanisms for controlling immune responses (i.e., inflammatory responses) (21–24). This
observation was substantiated in animal models showing
that the inhibition of adjuvant-induced arthritis is mediated by IL-10–driven regulatory cells induced through
the nasal administration of a peptide analog of an
arthritis-related Hsp60 T cell epitope (25). In addition,
prevention of collagen-induced arthritis, mediated by
mucosal administration of E coli heat-labile enterotoxin,
involves the enhanced activity of a population of splenic
CD4⫹,CD25⫹ Treg cells (28). De Kleer et al (29)
showed that patients with persistent oligoarticular JIA
had an increased number of CD4⫹,CD25⫹high SFMCs
compared with patients with extended oligoarticular
JIA. This cell population was characterized by the
expression of IL-10 and FoxP3 and by an actual suppressive function on CD4⫹,CD25⫺ cells stimulated with
DISCUSSION
We found that T cell responses to bacterial
epitopes were eminently proinflammatory in nature.
When we investigated responses to human peptides that
were or were not homologous to bacterial peptides,
proliferative responses were associated with the production of IL-10, indicating that human-derived peptides
trigger T cell responses that are qualitatively different
from those induced by bacterial peptides. The relative
balance between these mechanisms may modulate the
inflammatory activity and may be related to distinct
clinical features in patients with oligoarticular JIA.
In fact, when patients with oligoarticular JIA
were stratified based on their clinical characteristics and
prognosis, we found that patients with persistent oligoarticular JIA had significantly greater immune responses
than did patients with extended oligoarticular JIA to 2
human peptides homologous to bacterial peptide B174–
188 as well as to the uniquely human peptide H134–148.
1656
OKT-3, therefore suggesting that CD4⫹,CD25⫹ cells
may play an active role in the self-limiting and remitting
character of persistent oligoarticular JIA.
These previous findings are fully consistent with
our data, which show that the H134–148 self peptide
incubated with SFMCs from patients with persistent
oligoarticular JIA, in addition to inducing the production of IL-10, induces an increase in the percentage of
CD4⫹,CD25⫹high,CTLA-4⫹,IL-10⫹ cells and in their
levels of FoxP3 mRNA. After stimulation with H134–
148, these sorted cells performed an efficient suppression function when cocultured with autologous
CD4⫹,CD25⫺ SFMCs, while their functional regulatory capacity was totally abrogated when parallel experiments were performed with an E coli HSP dnaJ–derived
peptide (B174–188), suggesting that the regulatory function of this cell population is enhanced or restored by
availability of H134–148 peptide. As long as H134–148
peptide is available, such regulatory function is not
limited to the same antigen; therefore, T cell clones with
disparate specificity could be affected, as suggested in a
different system by Thornton and Shevach (30). Interestingly, using a murine model, Nishikawa et al (9) have
shown that immunization with dnaJ restores T regulatory activity, thus raising fundamental questions regarding the nature and the mechanism of action of the
epitopes involved. Our research contributes by specifically addressing these questions while transferring the
work from murine models to human disease.
To the best of our knowledge, this is the first
study that identifies a self peptide able to enhance the
function of Treg cells obtained from the inflamed joints
of patients with a self-remitting form of arthritis. Although the CD4⫹,CD25⫹high Treg cells clearly could
not prevent the development of the disease, they may
contribute to reversing ongoing inflammation. According to this mechanism, patients with persistent oligoarticular JIA may have partially maintained the Treg cell
function in response to the H134–148 self peptide in the
joint, where it is overexpressed during inflammation; this
may result in the self-remitting course of the disease.
This aspect may be exploited for therapeutic purposes
(31). Indeed, we have recently shown in a phase I/IIa
epitope-specific immunomodulation clinical trial in patients with rheumatoid arthritis that restoration of Treg
cell activity is one of the main outcomes of treatmentinduced immune deviation (12).
In conclusion, these data in a naturally remitting/
relapsing human autoimmune disease suggest that differential recognition of epitopes from human and bacterial HSPs may be a natural mechanism for amplifying
MASSA ET AL
and subsequently down-regulating inflammation. This
regulation may be impaired in autoimmunity and may
contribute to perpetuation of the inflammatory damage.
We have therefore identified a potential natural molecular regulator of inflammation that may be shared
among various diseases and that we intend to exploit in
future studies with the objective of identifying novel
agents for immune therapy of diseases with a welldefined inflammatory component.
AUTHOR CONTRIBUTIONS
Dr. Albani had full access to all of the data in the study and
takes responsibility for the integrity of the data and the accuracy of the
data analysis.
Study design. Massa, Prakken, Albani.
Acquisition of data. Massa, Passalia, Campanelli, Ciardelli, Yung,
Kamphuis, Meli.
Analysis and interpretation of data. Massa, Passalia, Manzoni, Pistorio, Prakken, Martini, Albani.
Manuscript preparation. Massa, Campanelli, Sette, Prakken, Martini,
Albani.
Statistical analysis. Pistorio.
REFERENCES
1. Albani S, Ravelli A, Massa M, De Benedetti F, Andree G, Roudier
J, et al. Immune responses to the Escherichia coli dnaJ heat shock
protein in juvenile rheumatoid arthritis and their correlation with
disease activity. J Pediatr 1994;124:561–5.
2. Albani S, Keystone EC, Nelson JL, Ollier WE, La Cava A,
Montemayor AC, et al. Positive selection in autoimmunity: abnormal immune responses to a bacterial dnaJ antigenic determinant
in patients with early rheumatoid arthritis. Nat Med 1995;5:
448–52.
3. Albani S. Infection and molecular mimicry in autoimmune diseases of childhood. Clin Exp Rheumatol 1994;12 Suppl 10:S35–41.
4. Prakken BJ, van der Zee R, Anderton SM, van Kooten P, Kuis W,
van Eden W. Tolerance to an arthritogenic T-cell epitope of
HSP65 and the regulation of experimental arthritis. Ann N Y Acad
Sci 1996;778:425–6.
5. Raz I, Elias D, Avron A, Tamir M, Metzger M, Cohen IR.
Beta-cell function in new-onset type 1 diabetes and immunomodulation with heat-shock protein peptide (DiaPep277): a randomized, double-blind, phase II trial. Lancet 2002;358:1749–53.
6. Anderton SM, Wraith DC. Selection and fine-tuning of the
autoimmune T-cell repertoire. Nat Rev Immunol 2002;2:487–98.
7. De Kleer IM, Kamphuis SM, Rijkers GT, Scholtens L, Gordon G,
de Jager W, et al. The spontaneous remission of juvenile idiopathic
arthritis is characterized by CD30⫹ T cells directed to human
heat-shock protein 60 capable of producing the regulatory cytokine interleukin-10. Arthritis Rheum 2003;48:2001–10.
8. Prakken B, Kuis W, van Eden W, Albani S. Heat shock proteins in
juvenile idiopathic arthritis: keys for understanding remitting
arthritis and candidate antigens for immune therapy. Curr Rheumatol Rep 2002;4:466–73.
9. Nishikawa H, Kato T, Tawara I, Saito K, Ikeda H, Kuribayashi K,
et al. Definition of target antigens for naturally occurring CD4
CD25 regulatory T cells. J Exp Med 2005;201:681–6.
10. Kamphuis S, Kuis W, de Jager W, Teklenburg G, Massa M,
Gordon G, et al. Tolerogenic immune responses to novel T-cell
epitopes from heat-shock protein 60 in juvenile idiopathic arthritis. Lancet 2005;366:50–6.
EPITOPE-SPECIFIC REGULATION OF HUMAN ARTHRITIS
1657
11. Lee L, Buckley C, Blades MC, Panayi G, George AJ, Pitzalis C.
Identification of synovium-specific homing peptides by in vivo
phage display selection. Arthritis Rheum 2002;46:2109–20.
12. Prakken BJ, Samodal R, Le TD, Giannoni F, Yung GP, Scavulli J,
et al. Epitope-specific immunotherapy induces immune deviation
of proinflammatory T cells in rheumatoid arthritis. Proc Natl Acad
Sci U S A 2004;101:4228–33.
13. Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings
MK. Type 1 T regulatory cells. Immunol Rev 2001;182:68–79.
14. O’Garra A, Vieira P. Regulatory T cells and mechanisms of
immune system control. Nat Med 2004;10:801–5.
15. Von Boehmer H. Mechanisms of suppression by suppressor T
cells. Nat Immunol 2005;6:338–44.
16. Belkaid Y, Rouse BT. Natural regulatory T cells in infectious
disease. Nat Immunol 2005;6:353–60.
17. Alexander J, Sidney J, Southwood S, Ruppert J, Oseroff C,
Maewal A, et al. Development of high potency universal DRrestricted helper epitopes by modification of high affinity DRblocking peptide. Immunity 1994;1:751–61.
18. Schett G, Tohidast-Akrad M, Steiner G, Smolen J. The stressed
synovium. Arthritis Res 2001;3:80–6.
19. Gattorno M, Prigione I, Vignola S, Falcini F, Chiesa S, Moranti F,
et al. Levels of soluble CD27 in sera and synovial fluid and its
expression on memory T cells in patients with juvenile idiopathic
arthritides. Clin Exp Rheumatol 2002;20:863–6.
20. Murray KJ, Grom AA, Thompson SD, Lieuwen D, Passo MH,
Glass DN. Contrasting cytokine profiles in the synovium of
different forms of juvenile rheumatoid arthritis and juvenile
spondyloarthropathy: prominence of interleukin 4 in restricted
disease. J Rheumatol 1998;25:1388–98.
21. Coutinho A, Hori S, Carvalho T, Caramalho I, Demengeot J.
Regulatory T cells: the physiology of autoreactivity in dominant
tolerance and quality control of immune responses. Immunol Rev
2001;182:89–98.
22. Read S, Malmstrom V, Powrie F. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of
CD4⫹CD25⫹ regulatory cells that control intestinal inflammation.
J Exp Med 2000;192:295–302.
Maloy KJ, Salaun L, Cahill R, Dougan G, Saunders NJ, Powrie
F. CD4⫹CD25⫹ T cells suppress innate immune pathology
through cytokine-dependent mechanisms. J Exp Med 2003;197:
111–9.
Murphy TJ, Choileain NN, Zang Y, Mannick JA, Lederer JA.
CD4⫹CD25⫹ regulatory T cells control innate immune reactivity
after injury. J Immunol 2005;174:2957–63.
Prakken BJ, Roord S, van Kooten PJ, Wagenaar JP, van Eden W,
Albani S, et al. Inhibition of adjuvant-induced arthritis by
interleukin-10–driven regulatory cells induced via nasal administration of a peptide analog of an arthritis-related heat-shock
protein 60 T cell epitope. Arthritis Rheum 2002;46:1937–46.
Petty RE, Southwood TR, Baum J, Bhettay E, Glass DN, Manners
P, et al. Revision of the proposed classification criteria for juvenile
idiopathic arthritis: Durban, 1997. J Rheumatol 1998;25:1991–4.
Ravelli A, Magni-Manzoni S, Viola S, Pistorio A, Ruperto N,
Martini A. Factors affecting the efficacy of intraarticular corticosteroid injection of knees in juvenile idiopathic arthritis. J Rheumatol 2001;28:2100–2.
Luross JA, Heaton T, Hirst TR, Day MJ, Williams NA. Escherichia coli heat-labile enterotoxin B subunit prevents autoimmune
arthritis through induction of regulatory CD4⫹ T cells. Arthritis
Rheum 2002;46:1671–82.
De Kleer IM, Wedderburn LR, Taams LS, Patel A, Varsani H,
Klein M, et al. CD4⫹CD25bright regulatory T cells actively regulate
inflammation in the joints of patients with the remitting form of
juvenile idiopathic arthritis. J Immunol 2004;172:6435–43.
Thornton AM, Shevach EM. Suppressor effector function of
CD4⫹CD25⫹ immunoregulatory T cells is antigen nonspecific.
J Immunol 2000;164:183–90.
Fisson S, Djelti F, Trenado A, Billiard F, Liblau R, Klatzmann D,
et al. Therapeutic potential of self-antigen-specific CD4⫹CD25⫹
regulatory T cells selected in vitro from a polyclonal repertoire.
Eur J Immunol 2006;36:817–27.
23.
24.
25.
26.
27.
28.
29.
30.
31.
Документ
Категория
Без категории
Просмотров
3
Размер файла
217 Кб
Теги
effector, epitopes, recognition, treg, shock, modulation, cells, idiopathic, inflammation, heat, protein, differential, arthritis, dnajderived, juvenile, leads
1/--страниц
Пожаловаться на содержимое документа