close

Вход

Забыли?

вход по аккаунту

?

Genomic organization of the para-sodium channel ╬▒-subunit genes from the pyrethroid-resistant and -susceptible strains of the diamondback moth.

код для вставкиСкачать
Archives of Insect Biochemistry and Physiology 69:1–12 (2008)
Genomic Organization of the Para-Sodium Channel
α-Subunit Genes From the Pyrethroid-Resistant and
-Susceptible Strains of the Diamondback Moth
Shoji Sonoda,1* Yoshitaka Tsukahara,1 Muhammad Ashfaq,1,2 and Hisaaki Tsumuki1
We examined the genomic organization of the para-sodium channel α-subunit gene of the diamondback moth, Plutella
xylostella (L.). The nucleotide sequence contained 34 putative exons, which covered almost the entire coding region of the
gene producing 1,889 amino acid residues. Deduced amino acid identity to the hscp locus of Heliothis virescens was 84%.
Comparison of deduced amino acid sequences of the permethrin-resistant and -susceptible strains showed two substitutions
other than kdr and super-kdr-like substitutions. They were Ala to Thr (A1060T) and Pro to Ser (P1836S) at the linker region of
the domains II–III and the carboxyl terminus, respectively. Furthermore, we developed PCR amplification protocols for the
rapid detection of both substitutions. Arch. Insect Biochem. Physiol. 69:1–12, 2008. © 2008 Wiley-Liss, Inc.
KEYWORDS: diamondback moth; Plutella xylostella; pyrethroid; sodium channel
INTRODUCTION
The intensive use of pyrethroids for insect pest
control has engendered a worldwide emergence of
resistant insects (Soderlund and Knipple, 2003). A
major mechanism that confers resistance to pyrethroids is nerve insensitivity. This type of resistance
was first reported in the knockdown resistance
(kdr) strain of the housefly, Musca domestica
(Busvine, 1951). The more acute type of nerve insensitivity, termed super-kdr, was also identified in
M. domestica (Sawicki, 1978).
The primary target of pyrethroids in insects is
the voltage-sensitive para-sodium channel of the
nerve membrane. The para-sodium channel is a large
glycoprotein and the major engine of nerve action
1
Research Institute for Bioresources, Okayama University, Okayama, Japan
2
National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan
potentials. Pyrethroids alter the gating kinetics of
the channel by slowing both activation and inactivation, resulting in repetitive discharges that quickly
lead to nervous exhaustion, paralysis, and death
(Narahashi, 2000). The major structural subunit of
the channel, α-subunit, is composed of four homologous domains (I to IV), each of which contains six transmembrane segments (S1 to S6) (Noda
et al., 1984). Molecular analysis of the nucleotide
sequences encoding the para-sodium channel from
M. domestica and the German cockroach, Blatella
germanica (Miyazaki et al., 1996; Williamson et al.,
1996) revealed a genetic linkage between nerve-insensitive resistance and amino acid substitutions in
domain II of the channel. The first substitution from
Leu to Phe (L1014F) at domain IIS6 transmembrane
Contract grant sponsor: Japan Society for the Promotion of Science (JSPS); Contract grant number: 19580055; Contract grant sponsor:
Ohara Foundation.
*Correspondence to: Shoji Sonoda, Research Institute for Bioresources, Okayama University; Kurashiki, Okayama 710-0046, Japan.
E-mail: sonodas@rib.okayama-u.ac.jp
Received 5 March 2007; Accepted 21 February 2008
© 2008 Wiley-Liss, Inc.
DOI: 10.1002/arch.20246
Published online in Wiley InterScience (www.interscience.wiley.com)
2
Sonoda et al.
segment was found in the kdr strains of M. domestica
and B. germanica. The second substitution (M918T)
was identified within the domain IIS4-IIS5 in the
super-kdr strain of M. domestica (Williamson et al.,
1996). These substitutions have subsequently been
reported in a wide range of insect species. In addition to these substitutions, a number of substitutions outside of domain II have also been reported
(Soderlund and Knipple, 2003).
The diamondback moth (DBM), Plutella xylostella, is a major pest of brassicas worldwide
(Talekar and Shelton, 1993). The pyrethroid resistance in DBM is conferred by decreased sensitivity
at the site of action in the nerve system (Hama et
al., 1987). Schuler et al. (1998) identified two
amino acid substitutions in the domain II of the
para-sodium channel of the pyrethroid-resistant
DBM strain. The first substitution at the domain
IIS6 was exactly the same with L1014F. The second
substitution (Thr to Ile) at the domain IIS5, denoted as T929I, was located 11 amino acids downstream from M918T.
In a previous study, we established a fenvalerateresistant (FR) strain by selection of the non-selected
(NS) strain with the LD50 equivalent doses of
fenvalerate and then compared the nucleotide sequences corresponding to the domain IIS4-IIS6
with those of the NS strain. As a result, it was found
that the frequencies of both L1014F and T929I were
increased in the FR strain (Tsukahara et al. 2003).
In the present study, we determined genomic DNA
sequences covering almost the entire coding regions of the para-sodium channel genes from the
permethrin-resistant (PR) and -susceptible (SS)
strains to further investigate the molecular basis
of resistance. In addition, we report amino acid
substitutions other than L1014F and T929I found
in the PR strain and a protocol for PCR analysis to
detect the relevant substitutions.
MATERIALS AND METHODS
Insects
Table 1 lists the strains used in this study. The
PR and SS strains have been described previously
(Sonoda et al., 2006). The SS strain was obtained
from Sumitomo Chemical Co. Ltd., Osaka, Japan,
in 2004. The SS strain was collected at Katano City,
Osaka Prefecture, to initiate a laboratory culture
in 1970 and has been maintained without insecticide selection. The PR strain was selected from the
NS strain (Tsukahara et al., 2003) by dipping the
4th instar larvae into 100 ppm (agriculturally recommended dose) of permethrin for several generations. Since then, it has been maintained with
400 ppm of permethrin. The respective LD50 values of the 4th instar larvae in the SS and PR strains
were 5.8 and 4,530.7 ppm. The resistance level of
the PR strain was estimated as about 780-fold
higher than that of the SS strain (Table 1).
The other permethrin-resistant (Iwaoka) and
-susceptible (Hiratsuka) strains were described previously by Sonoda and Tsumuki (2005). The
Hirastuka strain was collected at Hiratsuka City,
Kanagawa Prefecture, to initiate a laboratory culture and has been maintained without insecticide
selection. The Iwaoka strain was collected at Kobe
City, Hyogo Prefecture, to initiate a laboratory culture. It was selected with permethrin and chlorfluazuron in the laboratory. The resistance levels of
the Iwaoka strain to permethrin and chlorfluazuron
were estimated to be about 200- and 50-fold higher
than those of the Hiratsuka strain, respectively. Using established PCR amplification of specific allele (PASA) protocols (Kwon et al., 2004), it was
confirmed that L1014F and T929I are encoded in
Iwaoka strain (Sonoda, unpublished data). By contrast, no such mutations were observed in Hira-
TABLE 1. The Diamondback Moth Strains Used in This Study
Strain
SS
PR
Hiratsuka
Iwaoka
Characteristic
Susceptible
Permethrin-selected (780-fold)
Susceptible
Chlorfluazuron-selected (50-fold to the Hitarsuka strain) and
permethrin-selected (200-fold to the Hiratsuka strain)
Source
Katano City, Osaka
From the non-selected strain (Tsukahara et al., 2003)
Hiratsuka City, Kanagawa
Kobe City, Hyogo
Archives of Insect Biochemistry and Physiology
September 2008
Sodium Channel Gene From P. xylostella
tsuka strain (Sonoda, unpublished data). Insects
were maintained with radish seedlings at 25°C under a long photoperiod (16L:8D).
Reverse Transcription Polymerase
Chain Reaction (RT-PCR)
Total RNA was extracted from adults (10 inds.)
of the SS and PR strains as described in Tsukahara
et al. (2003). First-strand cDNA was synthesized
from 0.5 µg of total RNA at 42°C for 90 min with
oligo dT-adaptor primer (Takara Bio Inc., Ohtsu,
Japan) using ReverTra Ace (Toyobo Co. Ltd., Osaka,
Japan). PCR was performed using gene specific and
degenerate primers designed based on the nucleotide sequences of the para-sodium channel gene
from DBM (GenBank/EMBL/DDBJ accession nos.
AB074147 and AB074148), the tobacco budworm
Heliothis virescens (accession no. AF072493), B.
germanica (accession no. U73583), M. domenstica
(accession no. U38814), and the fruit fly Drosophila melanogaster (accession no. M32078). The
nucleotide sequences of the primers are outlined
in Table 2. We amplified seven fragments covering
the domains IS1-IVS6 (Fig. 1). Fragments D (1,644
bp) and E (1,862 bp) were amplified with the
primer sets, NaI-5′-2/Na3′-4 and DIIS4-5′/DIII-IV3′, respectively. Fragments A (195 bp), B (504 bp),
C (456 bp), F (529 bp), and G (733 bp) were amplified with the primer sets, Na-ATG/NaI-3′-4, I5′-3/NaI-3′-3, I-5′-2/IS6-3′, IV-5′-1/NaIV-3′-c, and
NaIV-5′-4/invIV-3′-1, respectively.
The PCR conditions were 1 cycle of 3 min at
94°C, followed by 40 cycles of 30 s at 94°C, 1 min
at 48°C (for degenerate primers) or 55°C (for gene
specific primers) and 2 min at 72°C, finishing with
a final extension at 72°C for 7 min. The PCR-amplified fragments were size-fractionated on 1.0%
agarose gel and DNA bands with expected sizes
were recovered and subcloned into pGEM-T Easy
vector (Promega Corp., Madison, WI) following the
manufacturer’s instructions.
Genomic DNA PCR
Genomic DNA was extracted from the SS and
PR strains as described by Sonoda and Tsumuki
Archives of Insect Biochemistry and Physiology September 2008
3
(2005). Gene-specific primers shown in Table 2
were designed based on the cDNA sequences. Thirteen (1 to 5, 6b, 7b, and 8 to 13) and twelve (1 to
3, 4/5, 6a, 7a, and 8 to 13) fragments were amplified for the SS and PR strains, respectively. Fragments 4, 5, 4/5, 6b, 7a, 7b, 10, 11, 12, and 13 were
amplified with the primer sets Na060831-1/I-3′-5,
Na060831-2/NaI-5′-2-r, Na060831-1/NaI-5′-2-r,
sumi-VII/VIII-5′/sumiVII-3′, NaI-5′-2/NaVI-3′-2, delI-II-5′/NaVI-3′-2, NaIV-5′-1/NaIV-3′-1, del-I-II-3′-r/
II-III-1/3-1-3′, II-III-1/3-2-5′/NaIV-3′-c, and IV-5′1/invIV-3′-1, respectively.
Fragments 1, 2, 3, 6a, 8, and 9 were amplified
using LA PCR in vitro cloning kit (Takara Bio Inc.).
Genomic DNA (1 µg) digested with BamHI, EcoRI,
HindIII, PstI, SalI, and XbaI were ligated with the
respective cassette using T4 DNA ligase (Takara Bio
Inc.). PCR was performed using the reverse primer
and C1 primer (primer sequence included in each
cassette). Subsequently, nested PCR was performed
with the upstream reverse primer and C2 primer
(primer sequence included in each cassette). The
reverse primers used for amplification of fragments
1, 2, 3, 6a, 8, and 9 were Na060922-2, Na0608313, I-3′-5, NaVII-3′-1, NaV-3′-1, and del-I-II-3′, respectively (Table 2). The upstream reverse primers,
Na060922-1, Na060831-4, NaI-3′-4, NaVII-3′-2,
NaV-3′-2, and NaI-3′-2 were used for amplification
of fragments 1, 2, 3, 6a, 8, and 9, respectively
(Table 2).
The PCR conditions were 1 cycle of 3 min at
94°C, followed by 40 cycles of 30 s at 94°C, 1 min
at 60°C, and 3 min at 72°C, finishing with a final
extension at 72°C for 7 min. The purified DNA
fragments were subcloned into pGEM-T Easy
(Promega Corp.) as described above.
Nucleotide Sequencing
Nucleotide sequences were determined using a
dye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) and a DNA sequencer (3100
Avant Genetic Analyzer; Applied Biosystems). The
nucleotide and deduced amino acid sequences were
analyzed using Genetyx-Mac Ver. 10.1 (Software Development Co. Ltd., Tokyo, Japan). More than three
independently isolated clones were sequenced.
4
Sonoda et al.
TABLE 2. Primers Used in This Study
Fragment
A
B
C
D
E
F
G
1
2
3
4
5
4/5
6a
7a
6b
7b
8
9
10
11
12
13
T1060
A1060
S1836
P1836
Forward primer
1st
2nd
1st
2nd
1st
2nd
1st
2nd
1st
2nd
1st
2nd
Reverse primer
Na-ATG ATGWCMGARGAYTYSGACTCGAT
I-5′-3 GATGACGAGGACGARGAYGAAGGTC
I-5′-2 TGGAAYTGGCTKGACTTCGTAGTWAT
NaI-5′-2 CGATACATTCGGTTGGGCGTTTCTGTCAGC
DIIS4-5′ CGTGGATCACGTGGACCGCTTCCCGGACGG
IV-5′-1 GGTTGGCCGACAGCCGATAAGAG
NaIV-5′-4 CTATTCTCAGTTTGGTGTTGAGCG
C1 GTACATATTGTCGTTAGAACGCGTAATACGACTCA
C2 CGTTAGAACGCGTAATACGACTCACTATAGGGAGA
C1
C2
C1
C2
Na060831-1 CCAGGTTCGATATGAGGACG
Na060831-2 GTAGTCGTAAGCAGGGGTAG
Na060831-1
C1
C2
NaI-5′-2
sumi-VII/VIII-5′ CGTGTGTTTGCAAGGTTACGGG
del-I-II-5′ GAGCCCCAGCTTCTCCTGTCAGAGC
C1
C2
C1
C2
NaIV-5′-1 CACTCAGACCAAATGGAAGG
del-I-II-3′-r GTACAGACGACGCTGGCAAAGTACTG
II-III-1/3-2-5′ CATTACAGGATGATGATACAATTAGTC
IV-5′-1
Na-frag2-5′-R CGGCACGGATCTAGAAGACA
Na-frag2-5′-S CGGCACGGATCTAGAAGACG
Na-frag3-5′-R GATCTGGCAGCGCTTCGACT
Na-frag3-5′-S GATCTGGCAGCGCTTCGACC
PASA Protocol for Detection of A1060T
and P1836S Mutations
Genomic DNA for PASA was extracted individually from 21, 20, and 26 adults of the PR, SS, and
Hiratsuka strains, respectively, using DNA extraction buffer (10 mM Tris-HCl pH 7.5, 0.1 M NaCl,
1 mM EDTA, 0.3% SDS) as described in Sambrook
et al. (1989). Information on primers used for
PASA is provided in Table 2. The PASA primer sets
were designed to amplify 469-bp and 208-bp allele-specific genomic DNA fragments depending on
the presence or absence of A1060T and P1836S,
respectively.
For detection of A1060T, PCR reaction mixture
(50 µl) contained 0.2-µM primers (Na-frag2-5′-R
and Na-frag2-3′ for T1060, Na-frag2-5′-S, and Nafrag2-3′ for A1060) (Table 2), 100 µM dNTPs, 2.5
NaI-3′-4 GAAGGAGCCCTGCATGCGCACGGGC
NaI-3′-3 CAACGCTCGGAGCACTCTGAAGG
IS6-3′ GGCGGAAAGCTGACAGAAACGCCC
Na3′-4 GACGACGGTGGCCAAGAAGAAGGGGATAC
DIII-IV-3′ CGAATACTATCGCTTGTGGACGCCACTTCG
NaIV-3′-c CCACACGAAGCAGTGTCGGTGACACG
invIV-3′-1 CTTGCGCGCGAAGAAGTCCTTGGTG
Na060922-2 CCATCACGTACCTCGCCTTC
Na060922-1 CTTCGATAGCGGCCAGAGAC
Na060831-3 GCTGCCATGTAATGATGCTG
Na060831-4 AGCACAAGCCTAGACATTCC
I-3′-5 CCAACATCCAGAGTGCGTCGGTTGCC
NaI-3′-4
I-3′-5 CCAACATCCAGAGTGCGTCGGTTGCC
NaI-5′-2-r GCTGACAGAAACGCCCAACCGAATGTATCG
NaI-5′-2-r
NaVII-3′-1 CCACGAAGAACAACACGTGC
NaVII-3′-2 CCCAATAATCCTGCGTCATG
NaVI-3′-2 ACTAATGGTCATACATACTG
sumi-VII-3′ GCGTATTGTCGTCCTGGTTG
NaVI-3′-2
NaV-3′-1 AAGGATAGAAGGCGTTGCTC
NaV-3′-2 CTAAGCTGCCTGCAGGCAATAC
del-I-II-3′ CAGTACTTTGCCAGCGTCGTCTGTAC
NaI-3′-2 CTAAGGGTTTCCGATCCGCGCCCGG
NaIV-3′-1 GATTCTATGAAGGGGTTGTC
II-III-1/3-1-3′ CTTTGAACGATCTAATCTTATGACTACCG
NaIV-3′-c
invIV-3′-1
Na-frag2-3′ GTCTATCGTGTCAGCTGAACC
Na-frag2-3′
invIV-3′-1
invIV-3′-1
mM MgCl2, 0.5 U of Taq polymerase, and 0.5 µg
of the genomic DNA. PCR reaction mixture for detection of P1836S was the same, except primers
(Na-frag3-5′-R and invIV-3′-1 for S1836, Na-frag35′-S, and invIV-3′-1 for P1836) and the concentration of MgCl2 (0.5 mM). PCR conditions were 1
cycle of 3 min at 94°C, followed by 35 cycles of
30 s at 94°C and 2 min at 68°C, finishing with a
final extension at 68°C for 7 min.
RESULTS
Cloning and Sequence Comparisons
Seven cDNA fragments, covering the domains
IS1–IVS6 (Fig. 1A), were generated from total RNA
of the SS and PR strains by PCR using degenerate
and gene specific primers. The locations of ampliArchives of Insect Biochemistry and Physiology
September 2008
Sodium Channel Gene From P. xylostella
5
Fig. 1. Schematic representation of the para-sodium channel (A) and cloning strategies for the cDNA (B) and genomic (C) sequences. The positions of amino acid
substitutions identified in the permethrin-resistant (PR)
strain are indicated by the stars. Closed boxes in A denote transmembrane segments within four homologous
domains I–IV of the sodium channel. Open bars in B and
C show cDNA and genomic sequences determined in the
present study, respectively. The location and length of the
cDNA and genomic fragments amplified in the present
study are shown by closed bars.
fied cDNA fragments are shown in Figure 1B. Use
of conventional 3′-RACE method to amplify the
3′ end of the cDNA was not successful.
Thirteen and twelve fragments were amplified
by PCR from genomic DNA of the SS and PR
strains, respectively (Fig. 1C). Our attempts to obtain the 3′ portion of the genomic sequence were
also unsuccessful.
Comparison of the genomic sequences to the
cDNA sequences showed the presence of 34 ex-
ons, including four mutually exclusive exons, over
22 kb of the partial genomic sequences for both
strains (Table 3). The genomic sequences contained
5,669 bp of open reading frame (ORF), which encoded a putative protein of 1,889 amino acids (accession nos. AB265177 and AB265178 for the SS
and PR strains, respectively). The deduced amino
acid sequences from the PR strain had 84% identity with hscp, a sodium channel α-subunit gene,
of H. virescens (Park et al., 1999) (Fig. 2).
Archives of Insect Biochemistry and Physiology September 2008
6
Sonoda et al.
TABLE 3. Comparison of Exons and Introns From the PermethrinResistant (PR) and -Susceptible (SS) Strains
Exon
Size
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18a
18b
19
20
21
22
23
24
25
26a
26b
27
28
29
30
31
32
PR
SS
147
33
156
206
129
92
213
58
145
165
300
245
22
109
66
278
174
163
163
188
205
162
134
142
257
174
123
123
123
195
246
271
305
>443
147
33
156
206
129
92
213
58
145
165
300
245
22
109
66
278
174
163
163
188
205
162
134
142
257
174
123
123
123
195
246
271
305
>443
Intron
Size
Homology
(%)
99.3
100
100
100
100
98.9
99.1
100
97.2
97.0
96.3
98.4
100
100
100
100
100
100
99.4
98.9
100
98.1
99.3
100
98.1
99.4
100
100
98.4
97.9
98.8
97.8
95.4
98.6
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18a
18b
19
20
21
22
23
24
25
26a
26b
27
28
29
30
31
PR
SS
239
1,635
449
683
334
251
236
88
193
79
2,656
270
89
75
1,418
76
455
657
955
110
1,171
60
84
90
86
222
1,088
877
608
357
187
90
181
233
1,775
233
677
326
254
208
88
218
178
2,640
270
88
75
1,413
76
466
658
951
110
1,195
60
84
95
86
223
1,092
872
477
352
178
86
186
Homology
(%)
92.9
66.0
76.9
95.2
94.0
69.8
75.2
80.7
79.7
55.0
97.1
99.6
98.9
100
96.5
100
95.1
99.8
99.4
99.1
89.5
98.3
97.6
90.5
95.3
98.2
99.0
95.5
69.9
62.2
80.3
84.6
79.4
Genome Structure
There were 33 introns ranging from 60 to
2,656 bp in the genomic sequence determined
(Table 3). Most of the ends of the introns were
defined by the GT (donor)-AG (acceptor) rule
(Breathnach et al., 1978), with the exception of
donor (TG) and acceptor (GC) sequences for intron 12 (data not shown). In comparison to exons, the size and homology of introns diverged
between the SS and PR strains, suggesting that the
genomic DNA environments are different between
both strains (Table 3). To our knowledge, this is the
first genomic comparison of the para-sodium channel sequences covering almost the entire region using pyrethroid-resistant and -susceptible strains.
In the present study, exon 2, portions of exons
11 and 12, and the 5′ portion of exon 16 were
found to be optionally included in the para-sodium
channel (optional exons) (Fig. 3A). The 5′ portion
of exon 21 was optional in DBM (Wang et al., unpublished data) (accession no. AF273105). Presence of the optional exon was confirmed in the
present study (Fig. 3A). Furthermore, we found that
the 5′ portion of exon 22 is also optional (Fig. 3A).
Exons 26a and 26b were mutually exclusive exons
and revealed 66.1 and 63.4% identity at the nucleotide and amino acid levels, respectively (Fig. 3B).
Differences in Amino Acid Sequences
between the PR and SS Strains
Deduced amino acid sequences of the para-sodium channel genes were compared between the
PR and SS strains. In the PR strain, susceptible
(Thr) and resistant (Ile) amino acids were encoded
at the T877I site (formerly denoted as T929I according to the numbering in D. melanogaster) in
exons 18a and 18b, respectively, but in the SS strain
only Thr was encoded at the site in both exons
(Sonoda et al., 2006). The PR and SS strains encoded resistant (Phe) and susceptible (Leu) amino
acids at the L962F site (formerly denoted as L1014F
according to the numbering in D. melanogaster) in
exon 19, respectively (Sonoda et al., 2006).
In addition to the T877I and L962F sites, we
identified differences at four amino acid positions
between the SS and PR strains; they were T474A,
A500V, A1060T, and P1836S (Figs. 2 and 4). In
another permethrin-susceptible (Hiratsuka) strain,
T474A and A500V were found, but not A1060T and
P1836S (data not shown). Thus, A1060T and
P1836S were specifically detected in the PR strain.
A1060 in the linker region between the domains
II–III is conserved at the corresponding position
in the para-sodium channel from an insecticidesusceptible strain of H. virescens (Fig. 4A) (Park et
al., 1999) (accession no. AF072493). In the other
insect species, Gly was conserved at the homologous amino acid positions (Fig. 4A).
P1836 in the carboxyl terminus is conserved at
the corresponding positions in the para-sodium
Archives of Insect Biochemistry and Physiology
September 2008
Sodium Channel Gene From P. xylostella
7
Fig. 2. Alignment of the deduced amino acid sequences
of the para-sodium channel genes from the permethrinresistant strain of Plutella xylostella (Px) and Heliothis
virescens (Hv) (AF072493; Park et al., 1999). Amino acid
sequences encoded by alternative exons 18b and 26b are
shown in Px. Identical residues are represented by a dot.
The gap introduced to preserve alignment is indicated by
a dash. Closed and open triangles denote intron positions
and polymorphism between the permethrin-resistant and
-susceptible strains of P. xylostella. Underlined sequences
indicate transmembrane segments.
channels from H. virescens (Park et al., 1999) (accession no. AF072493), B. germanica (Dong, 1997)
(accession no. U73583), M. domestica (Knipple et
al., 1994) (accession no. U38814), D. melanogaster
(Loughney et al., 1989) (accession no. M32078),
the human head louse, Pediculus capitis (Lee et al.,
2003) (accession nos. AY191155-AY191157), the
varroa mite, Varroa destructor (Wang et al., 2003)
(accession no. AY259834), the cattle tick, Boophilus microplus (He et al., 1999) (accession no.
AF134216), the squid, Loligo opalescens (Rosenthal
and Gilly, 1993) (accession no. L19979), and the
Archives of Insect Biochemistry and Physiology September 2008
8
Sonoda et al.
Fig. 3. Alignments of the
nucleotide and amino acid sequences for optional exons
(A) and mutually exclusive
exons 26a and 26b (B). Dots
represent identical nucleotides or amino acid residues.
human brain (Ahmed et al., 1992) (accession no.
M94055) (Fig. 4B).
Frequency of A1060T and P1836S in the
Susceptible and Resistant Strains
We examined the frequencies of A1060T and
P1836S using the PR, SS, and Hiratsuka strains.
PASA was carried out using genomic DNA individually isolated from the three strains. T1060 and
S1836 were detected with 100% frequencies in all
21 individuals from the PR strain tested (Fig. 5).
By contrast, A1060 and P1836 were detected in all
20 and 26 individuals from the SS and Hiratsuka
strains, respectively (Fig. 5). cDNAs were individually prepared from 15 and 6 adults from Iwaoka
(permethrin-resistant) and Hiratsuka strains, respectively, and were used to amplify fragments E
and G by PCR (Fig. 1B). Amplified DNA fragments
were subcloned and three clones from each cDNA
preparation were sequenced. In Iwaoka strain, a
total of 45 clones sequenced showed T1060 and
S1836 (data not shown). On the other hand, a total of 18 clones from Hiratsuka strain showed
A1060 and P1836 (data not shown). Population
surveys of DBM in the fields to monitor the frequency of the substitutions may be valuable as part
of insecticide resistance management.
DISCUSSION
Different forms of the para-sodium channel are
generated by alternative splicing (Loughney et al.,
1989). In DBM, alternative splicing of mutually
exclusive exons 18a and 18b (formerly denoted as
A1 and A2), corresponding to the mutually exclusive exons c and d in D. melanogaster and M. domestica, and exons 17a and 17b in H. virescens,
respectively, was described previously (Sonoda et
al., 2006). In addition, in the present study, we
Archives of Insect Biochemistry and Physiology
September 2008
Sodium Channel Gene From P. xylostella
Fig. 4. Alignments of the para-sodium channel amino
acid sequences of the II–III linker (A) and the carboxyl
terminus (B) regions from various species. Identical amino
acids are represented by a dot. The amino acid substitutions found in the permethrin-resistant (PR) strain are indicated by a triangle. Reference for comparison sequences
are: permethrin-susceptible strain (SS), Heliothis virescens
(Hv) (AF072493; Park et al., 1999), Haematobia irritans
(Hi) (U83873; Guerrero et al., 1997), Blatella germanica
Fig. 5. PCR amplification for the detection of A1060T
and P1836S. Characteristic amplification patterns (469
and 208 bp for the A1060T and P1836S, respectively) of
the permethrin-resistant (PR) and -susceptible (SS and
Hiratsuka) strains using allele-specific combinations of
primer. R, resistant allele-specific primer; S, susceptible
allele-specific primer.
Archives of Insect Biochemistry and Physiology September 2008
9
(Bg) (U73583; Dong, 1997), Musca domestica (Md)
(U38814; Knipple et al., 1994), Drosophila melanogaster
(Dm) (M32078; Loughney et al., 1989), Pediculus capitis
(Pc) (AY191156; Lee et al., 2003), Verroa destructor (Vd)
(AY259834; Wang et al., 2003), Boophilus microplus (Bm)
(AF134216; He et al., 1999), the squid (Lo) (L19979;
Rosenthal and Gilly, 1993), and the human brain (Hs)
(M94055; Ahmed et al., 1992).
identified five optional exons (exon 2, portions of
exons 11 and 12, the 5′ portion of exon 16, the 5′
portion of exon 21, and the 5′ portion of exon 22)
and two mutually exclusive exons (exons 26a and
26b). A total of nine alternatively spliced exons
has been reported in D. melanogaster, with seven
optional exons (a, i, b, e, f, j, and h) and two mutually exclusive exons (c and d) (Loughney et al.,
1989; Thackeray and Ganetzky, 1994; O’Dowd et
al., 1995). In addition to the nine exons, two additional mutually exclusive exons (k and l) were
reported in M. domestica (Lee et al., 2002). In H.
virescens, five optional exons and two mutually exclusive exons were identified (Park et al., 1999).
Exon 2, portions of exons 11 and 12, and the 5′
portion of exon 16 correspond to exon 2 in H.
virescens (Park et al., 1999), exons a and b in D.
melanogaster (Thackeray and Ganetzky, 1994), and
M. domestica (Lee et al., 2002), respectively. Exons
10
Sonoda et al.
26a and 26b correspond to exons k and l in M.
domestica (Lee et al., 2002) and exons G2 and G1
in B. germanica (Tan et al., 2002). In V. destructor,
exon 3, corresponding to exon 26a or exon 26b, is
optional (Wang et al., 2003).
Although the splice sites are highly conserved
among insect species, the frequency of exon usage
can be quite different (Dong, 2007). More than
60% of the transcripts in M. domstica contained
exon b, but less than 20% of the transcripts contained the corresponding exon in B. germanica
(Dong, 2007). Both exon and intron sequences
may be involved in the regulation of alternative
splicing (Thackeray and Ganetzky, 1995). Tan et
al. (2002) reported that alternative splicing generates splicing variants with different sensitivity to
pyrethroid in B. germanica. The channel variant
containing a mutually exclusive exon G2 was 100fold less sensitive to deltamethrin than the one
containing exon G1 (Tan et al., 2002). At present,
we have no information on sensitivity of the
spliced variants to pyrethroid in DBM.
In the comparison of deduced amino acid sequences between the SS and PR strains, we found
two amino acid substitutions, A1060T and P1836S,
at the linker region of the domains II–III and the
carboxyl terminus, respectively. Several amino acid
substitutions located in the linker regions connecting sodium channel domains are significant for the
nerve insensitivity pyrethroid resistance. Head et
al. (1998) identified amino acid substitutions
(D1561V and E1565G) associated with the pyrethroid resistance at the III–IV linker in both H.
virescens and the cotton bollworm Helicoverpa
armigera. Amino acid substitution (L1770P) in the
III–IV linker was identified in pyrethroid-resistant
V. destructor (Wang et al., 2003). In B. germanica,
amino acid substitutions in the I–II linker (E434K
and C764K) greatly enhanced the ability of a
known kdr-type substitution to reduce sodium
channel sensitivity to pyrethroid (Liu et al., 2000,
2002; Tan et al., 2002). However, no substitution
in the II–III linker region has been reported as a
putative resistance-conferring substitution to date.
Amino acid sequences in the carboxyl terminus
are highly conserved among diverse animal spe-
cies, suggesting a functional significance. In B.
germanica, amino acid substitution from P to L
(P1880L), located at the carboxyl terminus, is associated with a very high level of pyrethroid resistance (Liu et al., 2000). P1836S observed in the
PR strain is located just 20 amino acids upstream
from the corresponding position of P1880L in the
kdr strains of B. germanica (Fig. 4B). At present, it
is unclear if A1060T and P1836S are involved in
the pyrethroid resistance in DBM. Characterization
of these substitutions using an in vivo expression
system, such as the Xenopus oocyte system, remains
to elucidate the relative importance of the substitutions on the channel properties and sensitivity
to pyrethroid insecticides.
ACKNOWLEDGMENTS
This study was supported in part by a Grant-inAid for Scientific Research (C) from the Japan Society for the Promotion of Science (JSPS) (No.
19580055). M. Ashfaq thanks JSPS for the award of
Postdoctoral Fellowship for Foreign Researchers.
LITERATURE CITED
Ahmed CM, Ware DH, Lee SC, Patten CD, Ferrer-Montiel AV,
Schinder AF, McPherson JD, Wagner-McPherson CB,
Wasmuth JJ, Evans GA, Montal M. 1992. Primary structure, chromosomal localization, and functional expression
of a voltage-gated sodium channel from human brain. Proc
Natl Acad Sci USA 89:8220–8224.
Breathnach R, Benoist C, O’Hare K, Gannon F, Chambon P.
1978. Ovalbumin gene: evidence for a leader sequence in
mRNA and DNA sequences at the exon-intron boundaries.
Proc Natl Acad Sci USA 75:4853–4857.
Busvine JR. 1951. Mechanism of resistance to insecticide in
houseflies. Nature 168:193–195.
Dong K. 1997. A single amino acid change in the para sodium channel protein is associated with knockdown-resistance (kdr) to pyrethroid insecticides in German
cockroach. Insect Biochem Mol Biol 27:93–100.
Dong K. 2007. Insect sodium channels and insecticide resistance. Invert Neurosci 7:17–30.
Archives of Insect Biochemistry and Physiology
September 2008
Sodium Channel Gene From P. xylostella
Guerrero FD, Jamroz RC, Kammlah D, Kunz SE.1997. Toxicological and molecular characterization of pyrethroid-resistant horn flies, Haematobia irritans: Identification of kdr
and super-kdr point mutations. Insect Biochem Mol Biol
27:745–755.
Hama H, Kono Y, Sato Y. 1987. Decreased sensitivity of central nerve to fenvalerate in the pyrethroid-resistant diamondback moth, Plutella xylostella LINNE (Lepidoptera:
Yponomeutidae). Appl Entomol Zool 22:176–180.
He H, Chen AC, Davey RB, Ivie GW, George JE. 1999. Identification of a point mutation in the para-type sodium channel gene from a pyrethroid-resistant cattle tick. Biochem
Biophy Res Commu 261:558–561.
Head DJ, McCaffery AR, Callaghan A. 1998. Novel mutations
in the para-homologous sodium channel gene associated
with phenotypic expression of nerve insensitivity resistance
to pyrethroids in Heliothine Lepidoptera. Insect Mol Biol
7:191–196.
Knipple DC, Doyle KE, Marsella-Herrick PA, Soderlund DM.
1994. Tight genetic linkage between the kdr insecticide resistance trait and a voltage-sensitive sodium channel gene
in the house fly. Proc Natl Acad Sci USA 91:2483–2487.
Kwon DH, Choi BR, Park HM, Lee SH, Miyata T, Clark JM,
Lee SH. 2004. Knockdown resistance allele frequency in
field populations of Plutella xylostella in Korea. Pestic
Biochem Physiol 80:21–30.
Lee SH, Ingles PJ, Knipple DC, Soderlund DM. 2002. Developmental regulation of alternative exon usage in the
housefly Vssc1 sodium channel gene, Invert. Neurosci
4:125–133.
Lee SH, Gao J-R, Yoon KS, Mumcuoglu KY, Taplin D, Edman
JD, Lee MT, Clark JM. 2003. Sodium channel mutations
associated with knockdown resistance in the human head
louse, Pediculus capitis (De Geer). Pestic Biochem Physiol
75:79–91.
Liu Z, Valles SM, Dong K, 2000. Novel point mutations in
the German cockroach para sodium channel gene are associated with knockdown resistance (kdr) to pyrethroid
insecticides. Insect Biochem Mol Biol 30:991–997.
Liu Z, Tan J, Valles SM, Dong K. 2002. Synergistic interaction
between two cockroach sodium channel mutations and a
tobacco budworm sodium channel mutation in reducing
channel sensitivity to a pyrethroid insecticide. Insect
Biochem Mol Biol 32:397–404.
Archives of Insect Biochemistry and Physiology September 2008
11
Loughney K, Dreber R, Ganetzky B. 1989. Molecular analysis
of the para locus, a sodium channel gene in Drosophila.
Cell 58:1143–1154.
Miyazaki M, Ohyama K, Dunlap DY, Matsumura F. 1996.
Cloning and sequencing of the para-type sodium channel
gene from susceptible and kdr-resistant German cockroaches (Blattella germanica) and house fly (Musca domestica). Mol Gen Genet 252:61–68.
Narahashi T. 2000. Neuroreceptors and ion channels as the
basis for drug action: past, present and future. J Pharmacol
Exp Ther 294:1–26.
Noda M, Shimizu S, Tanabe T, Takai T, Kayano T, Ikeda T,
Takahashi H, Nakayama H, Kanaoka Y, Minamino N,
Kangawa K, Matsuo H, Raftery MA, Hirose T, Inayama S,
Hayashida H, Miyata T, Numa S. 1984. Primary structure
of Electrophorus electricus sodium channel deduced from
cDNA sequence. Nature 312:121–127
O’Dowd DK, Gee JR, Smith MA. 1995. Sodium current density correlates with expression of specific alternatively
spliced sodium channel mRNAs in single neurons. J
Neurosci 15:4005–4012.
Park Y, Taylor MFJ, Feyereisen R. 1999. Voltage-gated sodium
channel genes hscp and hDSC1 of Heliothis virescens F. genomic organization. Insect Mol Biol 8:161-170.
Rosenthal JJ, Gilly WF. 1993. Amino acid sequence of a putative sodium channel expressed in the giant axon of the
squid Loligo opalescens. Proc Natl Acad Sci USA 90:1002610030.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning:
a laboratory manual. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory.
Sawicki RM. 1978. Unusual response of DDT-resistant houseflies to carbinol analogues of DDT. Nature 275:443–444.
Schuler TH, Martinez-Torres D, Thompson AJ, Denholm I,
Devonshire AL, Duce IR, Williamson MD. 1998. Toxicological, electrophysiological, and molecular characterisation of knockdown resistance to pyrethroid insecticides
in the diamondback moth, Plutella xylostella (L.). Pestic
Biochem Physiol 59:169–182.
Soderlund DM, Knipple DC. 2003. The molecular biology of
knockdown resistance to pyrethroid insecticides. Insect
Biochem Mol Biol 33:563–577.
12
Sonoda et al.
Sonoda S, Tsumuki H. 2005. Studies on glutathione S-transferase gene involved in chlorfluazuron resistance of the
diamondback moth, Plutella xylostella L. (Lepidoptera:
Yponomeutidae). Pestic Biochem Physiol 82:94–101.
Sonoda S, Igaki C, Ashfaq M, Tsumuki H. 2006. Pyrethroidresistant diamondback moth expresses alternatively spliced
sodium channel transcripts with and without T929I mutation. Insect Biochem Mol Biol 36:904–910.
Talekar NS, Shelton AM. 1993. Biology, ecology, and management of the diamondback moth. Ann Rev Entomol
38:275–301.
Tan J, Liu Z, Tsai T-D, Valles SM, Goldin AL, Dong K. 2002.
Novel sodium channel gene mutations in Blattella germanica reduce the sensitivity of expressed channels to deltamethrin. Insect Biochem Mol Biol 32:445–454.
Thackeray JR, Ganetzky B. 1994. Developmentally regulated
alternative splicing generates a complex array of Droso-
phila para sodium channel isoforms. J Neurosci 14:2569–
2578.
Thackeray JR, Ganetzky B. 1995. Conserved alternative splicing patterns and splicing signals in the Drosophila sodium
channel gene para. Genetics 141:203–214.
Tsukahara Y, Sonoda S, Fujiwara Y, Nakasuji F, Tsumuki H.
2003. Molecular analysis of the para-sodium channel gene
in the pyrethroid-resistant diamondback moth, Plutella
xylostella (Lepidoptera: Yponomeutidae). Appl Entomol
Zool 38:23–29.
Wang R, Huang ZY, Dong K. 2003. Molecular characterization
of an arachnid sodium channel gene from the varroa mite
(Varroa destructor). Insect Biochem Mol Biol 33:733–739.
Williamson MS, Martinez-Torres D, Hick CA, Devonshire A.L.
1996. Identification of mutations in the housefly para-type
sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Mol Gen Genet
252:51–60.
Archives of Insect Biochemistry and Physiology
September 2008
Документ
Категория
Без категории
Просмотров
1
Размер файла
210 Кб
Теги
channel, sodium, subunit, pyrethroids, strains, susceptible, para, resistance, moth, diamondback, genes, organization, genomics
1/--страниц
Пожаловаться на содержимое документа