close

Вход

Забыли?

вход по аккаунту

?

Linkage and interaction of loci on 1q23 and 16q12 may contribute to susceptibility to systemic lupus erythematosus.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 46, No. 11, November 2002, pp 2928–2936
DOI 10.1002/art.10590
© 2002, American College of Rheumatology
Linkage and Interaction of Loci on 1q23 and 16q12 May
Contribute to Susceptibility to Systemic Lupus Erythematosus
Betty P. Tsao,1 Rita M. Cantor,1 Jennifer M. Grossman,1 Sung K. Kim,1 Noel Strong,1
Chak S. Lau,2 Chung-Jen Chen,3 Nan Shen,4 Ellen M. Ginzler,5 Rose Goldstein,6
Kenneth C. Kalunian,1 Frank C. Arnett,7 Daniel J. Wallace,8 and Bevra H. Hahn1
P ⴝ 0.005 to P not significant). Evidence for linkage to
1q23 and 16q12 was stronger in 68 non-Caucasian
affected sibpairs than in 77 Caucasian affected sibpairs.
Exclusion mapping ruled out linkage at 14q21-23 (␭s
[sib recurrence risk or genotypic risk ratio] ⴝ 1.8).
Because the pericentromeric region of chromosome 16
has been identified by genome scans in several autoimmune diseases, we postulated that it might harbor an
autoimmune modifier gene. To explore this possibility,
we tested for an interaction between 16q12 and 1q23,
and between 16q12 and 20p12. Haplotype sharing at
1q23 increased concomitantly with increased haplotype
sharing at 16q12 (P ⴝ 0.008 by nonparametric
Jonckheere-Terpstra exact statistical test). No evidence
supporting an interaction between 16q12 and 20p12 was
observed. Analysis of sibpairs sharing 2 alleles at 16q12
also showed increased allele sharing at 1q23 (MAS from
0.56 to 0.65).
Conclusion. These data support the presence of
SLE susceptibility genes at 1q23 and 16q12, particularly
in non-Caucasians. The skewed distribution of haplotypes suggests that genetic interaction of these two loci
may affect SLE susceptibility.
Objective. Six recent genome scans of different
systemic lupus erythematosus (SLE) multiplex family
cohorts showed multiple putative susceptibility loci. In
the present study, we examined 4 previously identified
loci to replicate findings of significant linkage to 1q23
and 16q12, and to support findings of suggestive linkage
to 14q21-23 and 20p12 in a cohort of 115 multiethnic
nuclear families containing 145 SLE-affected sibpairs.
Methods. Model-free, multipoint linkage analyses
(SIBPAL2, SAGE version 4.0) and exclusion mapping
(GeneHunter) were performed.
Results. Linkages to 1q23 (peak at D1S2675,
mean allele sharing [MAS] 0.56; P ⴝ 0.003) and to
16q12 (peaks between D16S753 and D16S757, MAS 0.57;
P ⴝ 0.003) were confirmed, but linkage evidence at
20p12 was weak and inconsistent (MAS 0.52–0.56; from
Supported in part by grants from the NIH (AR-43814 and
AI-45916), the Southern California Chapter of the Arthritis Foundation, the Paxson Family Foundation, The RGK Foundation (Austin,
TX), and the Arthritis Society (Canada). The results of sibpair linkage
analyses were obtained by using program package SAGE supported by
USPHS resource grant P41-RR-03655 from the Division of Research
Resources.
1
Betty P. Tsao, PhD, Rita M. Cantor, PhD, Jennifer M.
Grossman, MD, Sung K. Kim, BS, Noel Strong, BS, Kenneth C.
Kalunian, MD, Bevra H. Hahn, MD: University of California, Los
Angeles; 2Chak S. Lau, MD: University of Hong Kong, Hong Kong;
3
Chung-Jen Chen, MD: Kaohsiung Medical University, Kaohsiung,
Taiwan, Republic of China; 4Nan Shen, MD: Shanghai Institute of
Rheumatology, Ren Ji Hospital, Shanghai Second Medical University,
Shanghai, China; 5Ellen M. Ginzler, MD: State University of New
York Health Science Center, Brooklyn; 6Rose Goldstein, MD: University of Ottawa, and the Ottawa Hospital Research Institute, Ottawa,
Ontario, Canada; 7Frank C. Arnett, MD: University of Texas Health
Science Center, Houston; 8Daniel J. Wallace, MD: Cedars-Sinai
Research Institute, Los Angeles, California.
Address correspondence and reprint requests to Betty P.
Tsao, PhD, Division of Rheumatology, Department of Medicine,
Rehabilitation Center, Room 32–59, 1000 Veteran Avenue, UCLA
School of Medicine, Los Angeles, CA 90095-1670. E-mail:
BTsao@mednet.ucla.edu.
Submitted for publication January 16, 2002; accepted in
revised form July 15, 2002.
The prevalence of systemic lupus erythematosus
(SLE) in the general US population is ⬃1 in 2,000, but
it varies among racial and ethnic groups (e.g., it is more
prevalent in Hispanics and African Americans) (1,2). In
contrast, a familial prevalence of 10–12% has been
documented using surveys of several hundred SLE patients who reported having at least one first-degree
relative with the disease (3,4). The prevalence of SLE is
estimated to be 2.6–3.9% in the first-degree relatives of
SLE probands compared with 0.3–0.4% in relatives of
matched controls (5–7). The concordance rate in
monozygotic twins (24–56%) is ⬃10 times the rate in
dizygotic twins or in siblings (2–5%) (1,8,9). The risk of
2928
SLE SUSCEPTIBILITY GENES AT 1q23 AND 16q12
developing disease in siblings of SLE patients (␭s [sib
recurrence risk or genotypic risk ratio]) has been estimated to be 20 times higher than that in the general
population, which is similar to the risk observed in other
autoimmune diseases, such as type 1 diabetes and
multiple sclerosis (10). Similar to many autoimmune
diseases, SLE is likely to be a multifactorial disorder in
which complex interactions between multiple genetic
and environmental factors are involved (11,12).
Numerous population-based studies have shown
that SLE is associated with many genetic factors, including polymorphic alleles of certain major histocompatibility complex class II genes, Fc␥ receptors, mannosebinding ligand, interleukin-6 (IL-6), IL-10, and tumor
necrosis factor ␣, as well as with deficiencies in complement components (C1q, C2, and C4) (11). Recently, 3
targeted genome scans (13–15) and 6 complete genome
scans (16–21) using multiple cohorts mapped many
chromosomal regions that are likely to contain SLE
susceptibility genes. Using Lander and Kruglyak’s criteria for interpretation of linkage statistics (22), 6 loci
(1q23 [18], 1q41-42 [14,18], 2q35-37 [20], 4p16-15.2 [21],
6p11-21 [16,17], and 16q12 [16,17]) reached the threshold for significant linkage to SLE (a logarithm of odds
[LOD] score of 3.3 or 3.6, depending on linkage methods), and ⬎20 loci showed suggestive linkage (an LOD
score of 1.9 or 2.2). Using Lander and Kruglyak’s
guidelines for reporting confirmed linkage (P ⫽ 0.01 in
an independent cohort) (22), confirmation of significant
linkage was established for 5 loci: 1q41-42 (15,17), 1q23
(19), 2q35-37 (21), 4p16-15.2 (21), and 6p11-21 (21).
Because of the large number of markers tested in
whole genome scans, a replication of linkage results in
an independent collection of families provides important
evidence for a true susceptibility locus, and thus warrants subsequent fine-mapping studies for gene discovery. We chose to investigate 4 loci identified in such
studies to extend suggestive linkage of 14q21-23 and
20p12 to SLE (16) and to seek further support for and/or
confirmation of significant linkage to 1q23 and 16q12
(18). Using our independent cohort of 115 nuclear
families containing 145 affected sibpairs, we confirmed
linkage to SLE susceptibility at 1q23 and 16q12, observed weak evidence for linkage at 20p12, and excluded
linkage at 14q21-23 of a gene conferring a genotypic risk
ratio of 1.8. Because 16q12 has been mapped in genome
scans of several autoimmune diseases, including Crohn’s
disease (23–25), psoriasis (26), Blau syndrome (27), and
rheumatoid arthritis (28,29), we postulated that it might
harbor a gene modifying multiple autoimmune pheno-
2929
types. Here we report statistical evidence supporting an
interaction between 1q23 and 16q12.
SUBJECTS AND METHODS
SLE families. This study was approved by the Human
Subjects Protection Committee of the University of California,
Los Angeles. Multiplex families were recruited by ascertaining
ⱖ2 members with SLE, all available parents, and other siblings
of nuclear families. The study cohort consisted of 115 nuclear
families containing 145 SLE-affected sibpairs, in which 103
families had 2 affected sibs, 10 families had 3 affected sibs, and
2 families had 4 affected sibs. Confirmation of the classification
of patients as having SLE (fulfillment of at least 4 of the 11
criteria recommended by the American College of Rheumatology [ACR] [30,31]) was performed as described previously
(14).
DNA preparations. DNA was isolated from blood
mononuclear cells by the standard protocol. Buccal mucosa
swipes were also used as the source for DNA in cases where
obtaining blood samples was difficult. A swipe was obtained
after 6 gentle brushings inside each cheek of a participant with
a cytobrush (Medscand, Hollywood, FL). Each cytobrush with
buccal mucosa cells was submerged in 1 ml of lysis buffer
(0.32M sucrose, 10 mM Tris HCl [pH 7.5], 5 mM MgCl2, and
1% Triton X-100) and shaken for 30 minutes at room temperature. Following removal of the cytobrush, mucosa cells were
pelleted and incubated with 200 ␮l Chelex (Bio-Rad, Hercules,
CA) solution (10% Chelex, 10 mM Tris HCl [pH 8.3], and 50
mM KCl) at 100°C for 15 minutes. Subsequently, the Chelex
mixture was removed after centrifugation, and the supernatant containing DNA was used for genotyping microsatellite
markers.
Genotyping. Microsatellite markers at or near each
potential SLE susceptibility locus were selected based on 1)
their usage in the previous studies and 2) their genetic map
positions (online at http://www.marshmed.org/genetics/) and
their physical map positions (online at http://
genome.cse.ucsc.edu and http://www.ensembl.org). A candidate gene at 1q23, SLAM, which maps physically ⬃150-kb
centromeric to the marker D1S484, was genotyped using
primers flanking an intronic AT repeat. We designed the
forward primer (CCTGACCAAAGCCTCTTATTT) and the
reverse primer (TCTTTGAGTCATGGGCTCCT) based on
the DNA sequence from clone RP11-404F10 on chromosome
1q23.1-24.1 (GenBank GenInfo Identifier 7161187). A candidate gene at 14q21-23, ESR2, contains a dinucleotide CA
repeat with high heterozygosity (0.93) (32). The map position
of ESR2 was obtained from the database of the National
Center for Biotechnology Information (online at http://
www.ncbi.nlm.nih.gov/genemap/).
Fluorescent primers were purchased from Applied
Biosystems (Foster City, CA). Optimized primers of the same
color were placed in the 5-␮l reaction mixture containing 0.1
␮M of each primer, 40 ng of genomic DNA, 20 mM Tris HCl
(pH 8.4), 2.5 mM MgCl2, 50 mM KCl, 0.2 units of Platinum Taq
DNA polymerase (Gibco BRL, Baltimore, MD), and 250 ␮M
dNTP. The polymerase chain reaction condition for microsatellite polymorphisms was 95°C for 2 minutes, 11 cycles of 94°C
for 30 seconds, and 66°C for 15 seconds (and 1°C lower for
2930
TSAO ET AL
each subsequent cycle), followed by 30 cycles at 94°C for 30
seconds, 55°C for 15 seconds, and 72°C for 30 seconds, with a
final extension at 72°C for 10 minutes. The amplified products
were pooled and electrophoresed in 4.25% polyacrylamide
sequencing gels (Gibco BRL) for 2 hours at 3 kV using an ABI
377 DNA sequencer (Applied Biosystems). The gel data were
analyzed by using GeneScan version 3.1 for sizing amplified
products and Genotyper version 2.5 for allele assignment.
Statistical analysis. Model-free multipoint linkage analysis was performed by scanning 2-cM increments to evaluate
evidence for linkage by estimating marker allele sharing in 145
SLE-affected sibpairs, using the SIBPAL2 program of SAGE
Version 4.0 (33). Variance component regression analysis was
conducted on the identical-by-descent (ibd) sharing estimates
for each of the 414 total sibpairs (including 145 pairs with both
sibs affected, 204 disease-discordant sibpairs, and 65 unaffected sibpairs) and on the mean corrected values of the
sibpair trait differences (sibs were coded 0 for unaffected and
1 for affected) using the same program. Empirical P values
were computed by simulation. A lack of evidence for linkage at
all tested markers within 14q21-23 in the current cohort was
followed by exclusion mapping using the GeneHunter software
package (34).
Multiple closely spaced markers in both the 1q and 16p
regions showed evidence of linkage to SLE. To investigate
whether there might be an interaction between genes at these
loci, we first haplotyped 3 markers in each region to improve
their informativeness. Haplotypes were inferred using the
principle of parsimony. We then categorized each sibpair by
the number of haplotypes shared ibd (0, 1, or 2) in the two
regions to obtain a 3 ⫻ 3 table, ordered in 2 directions. The
Jonckheere-Terpstra statistic (35) was used to evaluate
whether there were differences among the distributions of
allele sharing in the chromosome 1 region when stratified into
those sibpairs sharing 0, 1, or 2 haplotypes ibd in the chromosome 16 region. This nonparametric statistic tests for a shift in
ordered distributions (sharing 0, 1, or 2 haplotypes at chromosome 1) when stratified by ordered categories (sharing 0, 1, or
2 haplotypes at chromosome 16). The analysis was conducted
using StatXact software (36), and an exact P value was
generated.
RESULTS
A total of 115 nuclear families were included in
this study (62 Caucasian, 22 Asian, 17 Hispanic, 13
African American, and 1 of mixed ethnic origin). There
were 463 subjects from these families: 132 parents (12
SLE-affected individuals), 244 SLE-affected siblings,
and 87 SLE-unaffected siblings. Thus, a total of 256 SLE
patients were included in this cohort; their demographic
characteristics and major clinical manifestations are
reported in Table 1. Ethnic variations in the clinical
manifestations and genetics of SLE have been well
recognized. We combined all of the non-Caucasian
patients into 1 group for comparisons with Caucasian
patients because of the small numbers of patients from
Table 1. Major demographic characteristics and clinical features of
the 256 patients with systemic lupus erythematosus (SLE) in the
current cohort*
Caucasians
(n ⫽ 137)
Age at diagnosis
mean ⫾ SD (range) years
Duration of disease
mean ⫾ SD years
Sex ratio, F:M
Laboratory/clinical features
ANA positive
Arthritis
Skin involvement
Hematologic disorders
Thrombocytopenia
Anti-dsDNA positive
Renal disease
Pleuritis
Pericarditis
Vasculitis
Psychosis/seizures
Secondary APS
Medication history
Corticosteroids
Antimalarials
Cytotoxic drugs
Non-Caucasians
(n ⫽ 119)
31 ⫾ 12 (5–62)
30 ⫾ 13 (6–73)
13 ⫾ 10
10 ⫾ 9
7.6:1
7.5:1
95
84
85
58
16
55
35
39
16
9
17
12
100
85
72†
72†
21
71†
39
30
19
13
5†
9
82
63
44
80
60
49
* Except where indicated otherwise, values are the percentage of
patients with a given characteristic. ANA ⫽ antinuclear antibody;
anti-dsDNA ⫽ anti–double-stranded DNA; APS ⫽ antiphospholipid
syndrome.
† P ⬍ 0.0002–0.0007 versus Caucasian SLE patients, using contingency
table for comparisons (not corrected for nonindependence of family
members or for multiple testing).
each minority group. Comparisons of 137 Caucasian
SLE patients from 62 families with 119 non-Caucasian
patients from 53 families showed no differences in age at
diagnosis, duration of disease, sex ratio, and medication
history. Among 12 laboratory/clinical features (mainly
ACR criteria), skin involvement (malar rash, discoid
rash, or photosensitivity) and psychosis/seizures appeared more frequently in Caucasian than in nonCaucasian SLE patients (P ⬍ 0.0002 and P ⬍ 0.0004,
respectively), while hematologic disorders and anti–
double-stranded DNA (anti-dsDNA) positivity occurred
more frequently in non-Caucasian than in Caucasian
SLE patients (P ⬍ 0.0006 and P ⬍ 0.0007, respectively).
The other 8 laboratory/clinical features depicted in
Table 1 showed no differences between Caucasians and
non-Caucasians after corrections for multiple testing.
We performed model-free, multipoint linkage
analyses to investigate 4 putative SLE susceptibility loci
using markers identical to those previously shown to
have positive linkage in reported genome scans, as well
as additional flanking markers. At 14q21-23, 9 markers
SLE SUSCEPTIBILITY GENES AT 1q23 AND 16q12
Figure 1. Multipoint systemic lupus erythematosus (SLE) exclusion
map for markers at 14q21-23. The x-axis depicts relative map positions
of the tested markers. The logarithm of odds (LOD) score of ⫺2.0 at
each marker is depicted by the dotted line. A gene with ␭s ⱖ1.8 was
excluded in this analysis.
within a 28-cM region (D14S288, D14S978, D14S276,
D14S980, D14S1038, D14S290, D14S63, ESR2, and
D14S258) with intramarker distances ranging from 1 cM
to 6 cM were analyzed individually. None exhibited
significantly increased mean allele sharing (MAS) in the
affected sibpairs. Exclusion mapping using the GeneHunter program (34) indicated that this region could be
excluded with a ␭s as small as 1.8 for the entire region
(see Figure 1). Because of the important role of female
sex hormones in the pathogenesis of SLE (37), ESR2,
encoding estrogen receptor ␤, is a positional candidate
gene for SLE. The numbers of CA repeats within ESR2
tested by us have been associated with serum levels of
androgen and sex steroid hormone–binding globulin in
premenopausal women (38), but not with SLE susceptibility (39). Linkage to SLE at this marker at a ␭s of 1.5
was excluded.
We evaluated evidence for linkage to SLE of 4
markers mapped within an 8-cM interval on 20p12. The
individual MAS estimates at markers D20S162,
D20S189, D20S186, and D20S604 in 145 multiethnic
affected sibpairs were 0.56, 0.52, 0.52, and 0.55, respectively. As shown in the left panel of Figure 2A, D20S162
and D20S604 had increased MAS (P ⫽ 0.005 and P ⫽
0.03, respectively). Linkage analysis of data from all 414
sibpairs (145 affected sibpairs, 204 disease-discordant
sibpairs, and 65 unaffected sibpairs) yielded P values
2931
ranging from 0.01 to not significant (NS). These results
indicate weak evidence for linkage of 20p12 to SLE.
However, when the families were stratified by ethnicity,
a different pattern emerged. The right panel of Figure
2A depicts stronger evidence for linkage of 20p12 to
SLE in Caucasian families. D20S162 and D20S604 (at a
distance from each other of ⬃8 cM or ⬃2.5 Mb) had
increased MAS (0.61 and 0.59, respectively; P ⫽ 0.001
and P ⫽ 0.002, respectively) in 77 Caucasian affected
sibpairs, but not in 68 non-Caucasian affected sibpairs
(MAS 0.52 and 0.49, respectively; P NS at both markers). Linkage analysis of the data from all 202 Caucasian
sibpairs yielded P values ranging from 0.006 to NS, while
a similar analysis of the data from all 212 non-Caucasian
sibpairs failed to yield any evidence of linkage.
At 1q23, each of the 4 markers (D1S2635, SLAM,
D1S484, and D1S2675) within a 5-cM interval exhibited
increased MAS in 145 multiethnic affected sibpairs
(0.56, 0.55, 0.54, and 0.56, respectively), with P values
ranging from 0.003 to 0.05, as shown in the left panel of
Figure 2B. The variation in levels of significance may be
influenced by the informativeness of each marker and
the distance between the marker and the susceptibility
gene. SLAM (signaling lymphocyte activation molecule)
is a member of the CD2 subgroup of the immunoglobulin superfamily encoding a surface receptor involved in
the activation of T cells and natural killer cells (40).
When combining marker data from all sibpairs in the
pedigrees, P values of 0.001–0.01 were obtained, and
D1S2675 exhibited the best evidence, as shown in the left
panel of Figure 2B (MAS 0.56; P ⫽ 0.003). In the full
sample of 414 total sibpairs, the evidence was also
strongest for D1S2675 (P ⫽ 0.002). This marker is
physically close (⬃0.1–0.7 Mb) to linkage peaks reported in genome scans (18,21). Thus, our results support the presence of an SLE susceptibility gene or genes
in this region.
The right panel of Figure 2B indicates stronger
evidence for linkage of 1q23 to SLE in non-Caucasians
than in Caucasians. The 4 tested markers within the
5-cM region had increased MAS (0.57–0.59; P ⫽ 0.005–
0.02) using data from 68 non-Caucasian affected sibpairs, as well as P values ranging from 0.0005 to 0.004 for
a variance component regression linkage analysis of data
from a total of 212 non-Caucasian sibpairs. Similar
analyses using the data from Caucasians (77 affected
sibpairs and 202 total sibpairs) yielded MAS of 0.50–
0.55 (P NS).
At 16p11-q12, markers D16S753, D16S3136,
D16S757, and D16S415 spanning a 10-cM region each
exhibited increased MAS (0.55, 0.55, 0.53, and 0.52,
2932
TSAO ET AL
Figure 2. Linkage analyses of 3 chromosome regions: A, 20p12; B, 1q23; and C, 16p11-q12. Centimorgans and megabases are plotted on the x-axes.
On the y-axes, logarithms of P values are plotted for excessive mean allele sharing (MAS) in 145 systemic lupus erythematosus–affected sibpairs and
regression (REG) analysis in 414 sibpairs (including pairs with both sibs affected, disease-discordant sibpairs, and unaffected sibpairs) by variance
component regression linkage analyses (54). Microsatellite markers are listed below the x-axes. Values between markers were inferred at 2-cM
increments. Evidence for linkage of each chromosome region tested is presented in the left panels for the total cohort and in the right panels for
Caucasians (C) and non-Caucasians (NC).
SLE SUSCEPTIBILITY GENES AT 1q23 AND 16q12
2933
Table 2. Statistical evidence for an interaction between systemic
lupus erythematosus susceptibility loci on 1q23 and 16p11-q12*
No. of
haplotypes
shared ibd
at 16q12
locus
0
1
2
Total
No. of haplotypes shared ibd at
1q23 locus
0
1
2
Total
7 (29)
9 (16)
2 (7)
18
14 (58)
29 (50)
17 (57)
60
3 (13)
20 (34)
11 (37)
34
24 (100)
58 (100)
30 (100)
112
* Values are the number (%) of affected sibpairs in each category. The
distribution of haplotypes shared identically by descent (ibd) in the
1q23 region (defined by markers SLAM, D1S484, and D1S2675) was
stratified by the extent of ibd haplotype sharing in the 16p11-q12
region (defined by markers D16S753, D16S3136, and D16S757). The
Jonckheere-Terpstra test was conducted on data for the 112 affected
sibpairs from the 112 families that had parental haplotypes at both loci
(P ⫽ 0.008) (35,36).
respectively) in 145 multiethnic affected sibpairs. Within
this chromosomal interval, the loci at 59.8 cM and 64 cM
(between D16S753 and D16S3136 and between
D16S3136 and D16S757) both had increased MAS of
0.57 with a P value of 0.003 in 145 multiethnic affected
sibpairs, as well as P values of borderline significance
(0.045 and 0.06, respectively) in 414 total sibpairs, as
shown in the left panel of Figure 2C. As shown in the
right panel of Figure 2C, 68 non-Caucasian affected
sibpairs exhibited evidence for increased allele sharing
between markers D16S753 and D16S415 (MAS 0.54–
0.61; P ⫽ 0.001–0.07), whereas 77 Caucasian affected
sibpairs (MAS 0.49–0.55) did not. The locus at 64 cM in
the interval between D16S3136 and D16S757 exhibited
the strongest evidence for linkage within 16p11-q12 in
our multiethnic cohort (MAS 0.57; P ⫽ 0.003) and in
stratified non-Caucasians (MAS 0.62; P ⫽ 0.001). This
region maps ⬃4 cM centromeric to D16S415, and both
were at or near a putative susceptibility locus linked to
SLE in a previous genome scan (16,17). Since we
analyzed an independent cohort, linkage of 16p11-q12 to
SLE through the linkage result between markers
D16S3136 and D16S757 (P ⫽ 0.003 in 145 multiethnic
affected sibpairs or P ⫽ 0.001 in 68 non-Caucasian
affected sibpairs) was confirmed.
Since the 16q12 region has also been mapped in
other autoimmune diseases (23–29), we considered the
possibility that it may contain an immunoregulatory
gene that can interact with other susceptibility loci
influencing the expression of multiple autoimmune phenotypes. Therefore, we tested for an interaction between
16q12 and 1q23, and between 16q12 and 20p12. As
shown in Table 2, the distribution of haplotype sharing
in the 1q23 region (defined by markers SLAM, D1S484,
and D1S2675) shifted toward increased sharing as the
degree of haplotype sharing at chromosome 16 (defined
by markers D16S753, D16S3136, and D16S757) also
increased (P ⫽ 0.008 by Jonckheere-Terpstra exact
statistical test) (35,36). Stratification of this sample by
ethnicity resulted in reduced sample sizes. While the
results were weaker, a skewed distribution of haplotypes
was observed both in Caucasians and in non-Caucasians.
Results of a similar analysis of the joint haplotype
distributions of 16q12 and 20p12 were not significant. By
stratifying on families containing affected sibpairs sharing 2 parental 16q12 haplotypes, the MAS of haplotypes
defined by markers SLAM, D1S484, and D1S2675 increased to 0.65 from 0.56 in the total cohort. It appears
that both regions may harbor genes important for the
development of SLE, and that a gene in 16q12 might
facilitate the contribution of a gene in 1q23.
DISCUSSION
We investigated 4 SLE-linked loci identified by
previous genome scans. Using an independent cohort,
we confirmed linkage to SLE at 1q23 and 16q12 (Figures
2B and C), observed weak linkage at 20p12 (Figure 2A),
and ruled out linkage at 14q21-23 (Figure 1). Evidence
for linkage to SLE at 1q23 and 16q12 appears to be
stronger in non-Caucasians (46% of our patients, including Asians, Hispanics, and African Americans) compared with Caucasians (54% of our patients), while
linkage at 20p12 was stronger in Caucasians. Most
interesting is our observation of statistical evidence for
an interaction between SLE susceptibility genes at 1q23
and 16q12.
Ethnic differences in linkage might be attributed
to many factors, including genetic heterogeneity, disease
heterogeneity, and random variation. Ethnic variations
in clinical manifestations in SLE patients of Caucasian,
Hispanic, and African American origins have been
shown in several studies. Compared with Caucasian SLE
patients, non-Caucasian SLE patients meet a greater
number of ACR criteria, have more disease activity, are
younger at diagnosis, and have more frequent major
organ (renal and cardiovascular) involvement (41–43).
In our cohort, non-Caucasian patients had more frequent hematologic disorders and anti-dsDNA positivity
than did Caucasian patients (Table 1). However, clinical
features, such as thrombocytopenia and renal disease,
that have been associated with poor prognosis (44) or
more severe disease (45) had similar frequencies in our
2934
Caucasian and non-Caucasian patients. Skin involvement (malar rash, discoid rash, and photosensitivity)
occurred more frequently in Caucasian than in nonCaucasian lupus patients (P ⬍ 0.0002) (Table 1). Since
discoid lupus is more commonly seen in African American than in Caucasian SLE patients (43), we excluded
discoid rash and found a more frequent occurrence of
malar rash and photosensitivity in Caucasian than in
non-Caucasian patients (P ⬍ 0.00001). However, the
frequency of discoid lupus did not differ significantly
between Caucasian and non-Caucasian SLE patients in
this cohort. In summary, ethnic variations in clinical
manifestations between Caucasian and non-Caucasian
SLE patients may contribute to differences in evidence
for linkage of 1q23, 16p11-q12, and 20p12.
The approach of whole genome scans has been
widely used to map susceptibility genes in human complex diseases. Moser et al reported an LOD score of 3.45
at FCGR2A (mapped at 171.3 Mb) using a maximized
parametric linkage analysis of 94 multiethnic pedigrees
multiplex for SLE (18), establishing significant linkage
(22) of 1q23 to SLE. Investigators in this group subsequently extended their sample to 126 pedigrees multiplex for SLE (32% African Americans and 61% European Americans) and reported linkage at 1q22-24 (peak
at D1S1679, 170.5 Mb, with an LOD score of 2.75; P ⫽
0.009) (21). Shai et al also observed linkage to this
region in an independent sample of 80 multiplex, multiethnic pedigrees (46% Caucasians and 54% Hispanics),
reporting a P value of 0.005 at D1S484 (mapped at 161.6
Mb), at which both ethnic groups contributed equally to
evidence for linkage (19).
Our results as shown in the left panel of Figure
2B (peak at D1S2675, 170.6 Mb; P ⫽ 0.003), confirm
linkage of 1q23 to SLE in a third independent SLE
multiplex cohort. Our evidence for linkage to 1q23 is
contributed primarily by non-Caucasians (Figure 2B,
right panel), which is consistent with previous reports
that African Americans show the strongest evidence for
linkage of this region to SLE compared with European
Americans (18,21). Based on the current available results, linkage of 1q23 to SLE does not appear to be
limited to a particular ethnic group, although results are
consistently stronger in non-Caucasian (or enriched)
cohorts. The distances from D1S2675 to FCGR2A,
D1S1679, and D1S484 have been estimated to be 0.7
Mb, 0.1 Mb, and 9 Mb, respectively (based on the human
genome working draft). This region contains FCGR2A
and FCGR3A, which have been associated with SLE in
multiple populations (46–48). Interestingly, this region
is syntenic to murine SLE susceptibility loci—the NZW-
TSAO ET AL
derived Sle1b and the NZB-derived Nba2 and Lbw7
(49–51). It is unclear at present whether a common
susceptibility gene (or genes) is shared by murine and
human SLE.
The locus 16q12 also meets Lander and Kruglyak’s criterion for significant linkage in genome scans
(22). In a study of a cohort of 105 SLE-affected sibpair
families, the markers D16S3136 and D16S415 at 16q12
(mapped at 62.1 cM and 67.6 cM, respectively) had
respective LOD scores of 3.2 and 3.6, whereas the
respective LOD scores were 2.9 and 3.8 in the enlarged
cohort of 187 sibpair families (16,17). Families in both
cohorts are ⬃80% Caucasian. Support for linkage at
D16S3136 was reported by Shai et al in an independent
cohort, with a P value of 0.017 (19). Our results confirm
linkage to this region as shown in Figure 2C, in which the
MAS at 64 cM was significantly increased in 145 multiethnic affected sibpairs (0.57; P ⫽ 0.003) and in 68
non-Caucasian affected sibpairs (0.62; P ⫽ 0.001). This
linked locus is ⬃2 cM telomeric from D16S3136 and
4 cM centromeric to D16S415, which is within the
chance variation in location estimates for replication of
significant linkage results of complex traits (52). We
interpret our results as replicating the significant linkage
of 16q12 with SLE susceptibility reported by Gaffney et
al (16,17). Of note, and not previously reported, nonCaucasian affected sibpairs exhibited stronger linkage to
16q12 than did Caucasians (Figure 2C, right panel).
Linkage of 20p12 to SLE, reported by Gaffney et
al (16,17), peaked at marker D20S186 (at 32 cM), with
an LOD score of 2.62 in those investigators’ first cohort
of 105 SLE-affected sibpair families and an LOD score
of 1.77 in their combined cohort of 187 families. Shai et
al reported linkage to SLE at D20S115 (at 21 cM) in
their cohort, with a P value of 0.012. In our multipoint
linkage analysis of 145 multiethnic affected sibpairs
(Figure 2A, left panel), D20S162 (at 25 cM) showed
weak evidence for linkage, as did D20S604 (at 33 cM).
Evidence for linkage of 20p12 to SLE appears stronger
in Caucasians than in non-Caucasians (Figure 2A, right
panel), in contrast to linkage to SLE of 1q23 and 16q12
(Figures 2B and C, right panels).
Gaffney et al showed linkage to 14q21-23 in their
first cohort, with LOD scores ranging between 1.7 and
2.8 (markers D14S288, D14S276, D14S63, and D14S258)
within a 28-cM interval, but their LOD scores were not
significant in their second cohort or in the combined
cohort (16,17). The findings by Shai et al supported
linkage of this region to SLE (markers D14S63 and
D14S258 had P values of 0.04 and 0.02, respectively)
(19). Our findings (Figure 1) indicate that this region is
SLE SUSCEPTIBILITY GENES AT 1q23 AND 16q12
unlikely to harbor a major SLE susceptibility gene and
exclude linkage to SLE at ESR2 (␭s ⫽ 1.5).
Genetic analyses simultaneously considering
multiple loci may provide insights that can facilitate
identification of genes contributing to complex diseases.
The observation that 16q12 has been linked to multiple
autoimmune diseases raises the possibility of an autoimmune modifier gene in this region (23–29). Evidence
for epistasis has been shown between IBD1 and 1p for
susceptibility to inflammatory bowel disease (53) and
between 4p16-15.2 and 5p15 for SLE susceptibility (21).
As shown in Table 2, linkage at 1q23 is maximized in
pedigrees showing haplotype sharing at 16q12, and this
finding will be used to enhance our SLE gene-mapping
efforts.
ACKNOWLEDGMENTS
We thank all participating patients and their family
members, many physicians for referring patients and verifying
their diagnoses, and Louise Ozaki for her technical help in this
study.
REFERENCES
1. Hochberg MC. The epidemiology of systemic lupus erythematosus. In: Wallace DJ, Hahn BH, editors. Dubois’ lupus erythematosus. Baltimore: Williams & Wilkins; 1997. p. 49–65.
2. Kotzin BL. Systemic lupus erythematosus. Cell 1996;85:303–6.
3. Buckman KJ, Moore SK, Ebbin AJ, Cox MB, Dubois EL. Familial
systemic lupus erythematosus. Arch Intern Med 1978;138:1674–6.
4. Pistiner M, Wallace DJ, Nessim S, Metzger AL, Klinenberg JR.
Lupus erythematosus in the 1980s: a survey of 570 patients. Semin
Arthritis Rheum 1991;21:55–64.
5. Beckmann RP, Mizzen LA, Welch WJ. Interaction of hsp70 with
newly synthesized proteins: implications for protein folding and
assembly. Science 1990;248:850–4.
6. Hochberg MC. The application of genetic epidemiology to systemic lupus erythematosus. J Rheumatol 1987;14:867–9.
7. Lawrence JS, Martins CL, Drake GL. A family survey of lupus
erythematosus. 1. Heritability. J Rheumatol 1987;14:913–21.
8. Block SR, Winfield JB, Lockshin MD, D’Angelo WA, Christian
CL. Studies of twins with SLE: a review of the literature and
presentation of 12 additional sets. Am J Med 1979;59:533–52.
9. Deapen D, Escalante A, Weinrib L, Horwitz D, Bachman B,
Roy-Burman P, et al. A revised estimate of twin concordance in
systemic lupus erythematosus. Arthritis Rheum 1992;35:311–8.
10. Vyse TJ, Kotzin BL. Genetic basis of systemic lupus erythematosus. Curr Opin Immunol 1996;8:843–51.
11. Tsao BP. The genetics of human lupus. In: Wallace DJ, Hahn BH,
editors. Dubois’ lupus erythematosus. Philadelphia: Lippincott
Williams & Wilkins; 2002. p. 97–120.
12. Cooper GS, Dooley MA, Treadwell EL, St. Clair EW, Parks CG,
Gilkeson GS. Hormonal, environmental, and infectious risk factors for developing systemic lupus erythematosus. Arthritis
Rheum 1998;41:1714–24.
13. Tsao BP, Cantor RM, Kalunian KC, Chen CJ, Badsha H, Singh R,
et al. Evidence for linkage of a candidate chromosome 1 region to
human systemic lupus erythematosus. J Clin Invest 1997;99:
725–31.
2935
14. Tsao BP, Cantor RM, Grossman JM, Shen N, Teophilov NT,
Wallace DJ, et al. PARP alleles within the linked chromosomal
region are associated with systemic lupus erythematosus. J Clin
Invest 1999;103:1135–40.
15. Moser KL, Gray-McGuire C, Kelly J, Asundi N, Yu H, Bruner
GR, et al. Confirmation of genetic linkage between human
systemic lupus erythematosus and chromosome 1q41. Arthritis
Rheum 1999;42:1902–7.
16. Gaffney PM, Kearns GM, Shark KB, Ortmann WA, Selby SA,
Malmgren ML, et al. A genome-wide search for susceptibility
genes in human systemic lupus erythematosus sib-pair families.
Proc Natl Acad Sci U S A 1998;95:14875–9.
17. Gaffney PM, Ortmann WA, Selby SA, Shark KB, Ockenden TC,
Rohlf KE, et al. Genome screening in human systemic lupus
erythematosus: results from a second Minnesota cohort and
combined analyses of 187 sib-pair families. Am J Hum Genet
2000;66:547–56.
18. Moser KL, Neas BR, Salmon JE, Yu H, Gray-McGuire C, Asundi
N, et al. Genome scan of human systemic lupus erythematosus:
evidence for linkage on chromosome 1q in African-American
pedigrees. Proc Natl Acad Sci U S A 1998;95:14869–74.
19. Shai R, Quismorio FP Jr, Li L, Kwon OJ, Morrison J, Wallace DJ,
et al. Genome-wide screen for systemic lupus erythematosus
susceptibility genes in multiplex families. Hum Mol Genet 1999;
8:639–44.
20. Lindqvist AK, Steinsson K, Johanneson B, Kristjansdottir H,
Arnasson A, Grondal G, et al. A susceptibility locus for human
systemic lupus erythematosus (hSLE1) on chromosome 2q. J
Autoimmun 2000;14:169–78.
21. Gray-McGuire C, Moser KL, Gaffney PM, Kelly J, Yu H, Olson
JM, et al. Genome scan of human systemic lupus erythematosus by
regression modeling: evidence of linkage and epistasis at 4p1615.2. Am J Hum Genet 2000;67:1460–9.
22. Lander ES, Kruglyak L. Genetic dissection of complex traits:
guidelines for interpreting and reporting linkage results. Nat
Genet 1995;11:241–7.
23. Curran ME, Lau KF, Hampe J, Schreiber S, Bridger S, Macpherson AJ, et al. Genetic analysis of inflammatory bowel disease in a
large European cohort supports linkage to chromosomes 12 and
16. Gastroenterology 1998;115:1066–71.
24. Hampe J, Schreiber S, Shaw SH, Lau KF, Bridger S, Macpherson
AJ, et al. A genomewide analysis provides evidence for novel
linkages in inflammatory bowel disease in a large European
cohort. Am J Hum Genet 1999;64:808–16.
25. Hugot JP, Laurent-Puig P, Gower-Rousseau C, Olson JM, Lee JC,
Beaugerie L, et al. Mapping of a susceptibility locus for Crohn’s
disease on chromosome 16. Nature 1996;379:821–3.
26. Nair RP, Henseler T, Jenisch S, Stuart P, Bichakjian CK, Lenk W,
et al. Evidence for two psoriasis susceptibility loci (HLA and 17q)
and two novel candidate regions (16q and 20p) by genome-wide
scan. Hum Mol Genet 1997;6:1349–56.
27. Tromp G, Kuivaniemi H, Raphael S, Ala-Kokko L, Christiano A,
Considine E, et al. Genetic linkage of familial granulomatous
inflammatory arthritis, skin rash, and uveitis to chromosome 16.
Am J Hum Genet 1996;59:1097–107.
28. Cornelis F, Faure S, Martinez M, Prud’homme JF, Fritz P, Dib C,
et al. New susceptibility locus for rheumatoid arthritis suggested by
a genome-wide linkage study. Proc Natl Acad Sci U S A 1998;95:
10746–50.
29. Jawaheer D, Seldin MF, Amos CI, Chen WV, Shigeta R, Monteiro
J, et al. A genomewide screen in multiplex rheumatoid arthritis
families suggests genetic overlap with other autoimmune diseases.
Am J Hum Genet 2001;68:927–36.
30. Hochberg MC. Updating the American College of Rheumatology
revised criteria for the classification of systemic lupus erythematosus [letter]. Arthritis Rheum 1997;40:1725.
31. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield
2936
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
NF, et al. The 1982 revised criteria for the classification of systemic
lupus erythematosus. Arthritis Rheum 1982;25:1271–7.
Tsukamoto K, Inoue S, Hosoi T, Orimo H, Emi M. Isolation and
radiation hybrid mapping of dinucleotide repeat polymorphism at
the human estrogen receptor beta locus. J Hum Genet 1998;43:
73–4.
Department of epidemiology and biostatistics, Case Western
Reserve University. Statistical analysis for genetic epidemiology
(SAGE). Cleveland: Case Western Reserve University; 2000.
Kruglyak L, Lander ES. Parametric and nonparametric linkage
analysis: a unified multipoint approach. Am J Hum Genet 1996;
58:1347–63.
Hodges JL, Lehmann EL. Nonparametric statistical methods. New
York: John Wiley & Sons; 1963.
Cytel Software Corporation. StatXact 3 for Windows. Cambridge
(MA): Cytel Corporation; 2000.
Walker SE. The importance of sex hormones in systemic lupus
erythematosus. In: Wallace DJ, Hahn BH, editors. Dubois’ lupus
erythematosus. Philadelphia: Lippincott Williams & Wilkins;
2002. p. 307–18.
Westberg L, Baghaei F, Rosmond R, Hellstrand M, Landen M,
Jansson M, et al. Polymorphisms of the androgen receptor gene
and the estrogen receptor beta gene are associated with androgen
levels in women. J Clin Endocrinol Metab 2001;86:2562–8.
Chang M, Lubahn DB, Hoffman RW. DNA microsatellite markers for estrogen receptor-beta are not associated with systemic
lupus erythematosus. J Rheumatol 2001;28:924–5.
Tangye SG, Phillips JH, Lanier LL. The CD2-subset of the Ig
superfamily of cell surface molecules: receptor-ligand pairs expressed by NK cells and other immune cells. Semin Immunol
2000;12:149–57.
Alarcon GS, Friedman AW, Straaton KV, Moulds JM, Lisse J,
Bastian JM, et al, LUMINA Study Group. Lupus in Minority
populations: Nature vs. Nurture. Systemic lupus erythematosus in
three ethnic groups III. A comparison of characteristics early in
the natural history of the LUMINA cohort. Lupus 1999;8:197–209.
Alarcon GS, McGwin G Jr, Petri M, Reveille JD, RamseyGoldman R, Kimberly RP. Baseline characteristics of a multiethnic lupus cohort: PROFILE. Lupus 2002;11:95–101.
Cooper GS, Parks CG, Treadwell EL, St. Clair EW, Gilkeson GS,
Cohen PL, et al. Differences by race, sex and age in the clinical and
immunologic features of recently diagnosed systemic lupus ery-
TSAO ET AL
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
thematosus patients in the southeastern United States. Lupus
2002;11:161–7.
Reveille JD, Bartolucci A, Alarcón GS. Prognosis in systemic
lupus erythematosus: negative impact of increasing age at onset,
black race, and thrombocytopenia, as well as causes of death.
Arthritis Rheum 1990;33:37–48.
Gladman DD, Goldsmith CH, Urowitz MB, Bacon P, Fortin P,
Ginzler E, et al. The Systemic Lupus International Collaborating
Clinics/American College of Rheumatology (SLICC/ACR) Damage Index for systemic lupus erythematosus international comparison. J Rheumatol 2000;27:373–6.
Salmon JE, Millard S, Schachter LA, Arnett FC, Ginzler EM,
Gourley MF, et al. Fc gamma RIIA alleles are heritable risk
factors for lupus nephritis in African Americans. J Clin Invest
1996;97:1348–54.
Wu J, Edberg JC, Redecha PB, Bansal V, Guyre PM, Coleman K,
et al. A novel polymorphism of FcgRIIIa (CD16) alters receptor
function and predisposes to autoimmune disease. J Clin Invest
1997;100:1059–70.
Tsao BP. Lupus susceptibility genes on human chromosome 1. Int
Rev Immunol 2000;19:319–34.
Morel L, Blenman KR, Croker BP, Wakeland EK. The major
murine systemic lupus erythematosus susceptibility locus, Sle1, is a
cluster of functionally related genes. Proc Natl Acad Sci U S A
2001;98:1787–92.
Vyse TJ, Rozzo SJ, Drake CG, Izui S, Kotzin BL. Control of
multiple autoantibodies linked with a lupus nephritis susceptibility
locus in New Zealand Black mice. J Immunol 1997;158:5566–74.
Kono DH, Burlingame RW, Owens DG, Kuramochi A, Baldera
RS, Balomenos D, et al. Lupus susceptibility loci in New Zealand
mice. Proc Natl Acad Sci U S A 1994;91:10168–72.
Roberts SB, MacLean CJ, Neale MC, Eaves LJ, Kendler KS.
Replication of linkage studies of complex traits: an examination of
variation in location estimates. Am J Hum Genet 1999;65:876–84.
Cho JH, Nicolae DL, Gold LH, Fields CT, LaBuda MC, Rohal
PM, et al. Identification of novel susceptibility loci for inflammatory bowel disease on chromosomes 1p, 3q, and 4q: evidence for
epistasis between 1p and IBD1. Proc Natl Acad Sci U S A
1998;95:7502–7.
Elston RC, Buxbaum S, Jacobs KB, Olson JM. Haseman and
Elston revisited. Genet Epidemiol 2000;19:1–17.
Документ
Категория
Без категории
Просмотров
0
Размер файла
160 Кб
Теги
linkage, contributes, lupus, interactions, may, 16q12, loci, 1q23, systemic, erythematosus, susceptibility
1/--страниц
Пожаловаться на содержимое документа