close

Вход

Забыли?

вход по аккаунту

?

Severity of murine collagen-induced arthritis correlates with increased CYP7B activityEnhancement of dehydroepiandrosterone metabolism by interleukin-1.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 50, No. 10, October 2004, pp 3346–3353
DOI 10.1002/art.20509
© 2004, American College of Rheumatology
Severity of Murine Collagen-Induced Arthritis
Correlates With Increased CYP7B Activity
Enhancement of Dehydroepiandrosterone Metabolism by Interleukin-1␤
John Dulos, Evert Verbraak, Wilma M. Bagchus, Annemieke M. H. Boots, and Allard Kaptein
sulted in a dose-dependent increase in 7␣-OH-DHEA
formation. In addition, IL-1␤ enhanced CYP7B mRNA
and CYP7B protein levels in FLS.
Conclusion. Disease progression in CIA is correlated with enhanced CYP7B activity, which leads to
locally enhanced 7␣-OH-DHEA levels. Elevated IL-1␤
levels within the arthritic joint may regulate this increase in CYP7B activity.
Objective. The endogenous steroid dehydroepiandrosterone (DHEA) has been reported to play a role
in rheumatoid arthritis (RA). DHEA is metabolized by
the P450 enzyme CYP7B into 7␣-OH-DHEA, which has
immunostimulating properties. This study was undertaken to investigate the putative role of CYP7B in
arthritis using murine collagen-induced arthritis (CIA),
an interleukin-1␤ (IL-1␤)–dependent model.
Methods. DBA/1J mice were immunized and administered a booster with type II collagen. The presence
of 7␣-OH-DHEA was determined in both arthritic and
nonarthritic joints and the serum of CIA mice by
radioimmunoassay. CYP7B messenger RNA (mRNA)
expression was analyzed in synovial biopsy samples, and
in fibroblast-like synoviocytes (FLS) isolated from these
synovial biopsy samples, by reverse transcriptase–
polymerase chain reaction (RT-PCR). In addition, the
regulatory role of IL-1␤ on CYP7B activity in FLS was
determined using RT-PCR, Western blotting, and highperformance liquid chromatography.
Results. In knee joint synovial biopsy samples
from arthritic mice, 7␣-OH-DHEA levels were 5-fold
higher than in nonarthritic mice. Elevated levels of
7␣-OH-DHEA were accompanied by an increase in
CYP7B mRNA expression and were positively correlated
with disease severity. In serum, no differences in 7␣OH-DHEA levels were observed between arthritic and
nonarthritic mice. Incubation of FLS with IL-1␤ re-
Rheumatoid arthritis (RA) is characterized by
chronic inflammation of the joints, ultimately resulting
in destruction of cartilage and bone. The pathogenesis of
RA is still unknown. Mediators of the endocrine system,
such as dehydroepiandrosterone (DHEA), androgen,
estrogen, and glucocorticoids, are all known to influence
the disease process in RA (1–3). Among these endocrine
mediators, DHEA and its sulfate form, DHEAS, are the
most abundant prohormones formed in vivo (4) and can
be found in blood and synovial fluid (2).
Both immunosuppressive (5–7) and immunostimulating (8–10) properties have been described for
DHEA. The immunosuppressive effects may be explained by the conversion of DHEA into androgens
and/or estrogens (1,2,11). The described immunostimulating effects of DHEA may be due to the conversion of
DHEA into 7␣-OH-DHEA (9,12). Recent data suggest
that 7␣-OH-DHEA acts as an antiglucocorticoid that
can block the glucocorticoid-induced immunosuppression (13,14). It has been suggested that in inflammatory
diseases the local balance between DHEA metabolites
and endogenous glucocorticoids is disturbed (14). To
date, 3 P450 7␣-hydroxylase isoenzymes are known,
CYP7A, CYP39A, and CYP7B. CYP7A (15) is expressed in the liver and CYP39A1 (16) is expressed in
the brain; both are involved in the elimination of cholesterol. CYP7B is not restricted to the liver or the brain
John Dulos, MSc, Evert Verbraak, BSc, Wilma M. Bagchus,
PhD, Annemieke M. H. Boots, PhD, Allard Kaptein, PhD: Organon
NV, Oss, The Netherlands.
Address correspondence and reprint requests to John Dulos,
MSc, Department of Pharmacology, Section AutoImmunity, Organon
NV, p.b. 20, Oss 5340 BH, The Netherlands. E-mail: John.Dulos@
organon.com.
Submitted for publication March 9, 2004; accepted in revised
form June 4, 2004.
3346
CORRELATION OF CIA WITH CYP7B ACTIVITY
and is expressed in various tissues and cells, including
the thymus and lymphocytes (17). The DHEA metabolite 7␣-OH-DHEA and, to a lesser extent, 7␤-OHDHEA are formed by the activity of the cytochrome
P450 enzyme CYP7B (18–20). We propose that enhanced CYP7B activity, resulting in enhanced levels of
7␣-OH-DHEA, might play a proinflammatory role in
the disease process. Increased CYP7B activity is thought
to result in increased 7␣-OH-DHEA levels but may also
result in a decline in DHEA levels as observed in
inflammatory diseases such as RA (11,21,22).
To investigate the possible involvement of
CYP7B in the arthritis process, the murine collageninduced arthritis (CIA) model was studied. First, we
determined the level of 7␣-OH-DHEA in both serum
and arthritic joints of mice with CIA. Second, expression
levels of CYP7B (responsible for the conversion of
DHEA into 7␣-OH-DHEA) were studied in synovial
biopsy samples from mice with CIA and in fibroblastlike synoviocytes (FLS) derived from these biopsy samples. Third, regulatory properties of the proinflammatory cytokine interleukin-1␤ (IL-1␤) were studied with
respect to the regulation of expression of CYP7B messenger RNA (mRNA) and CYP7B protein in FLS.
MATERIALS AND METHODS
Murine CIA. Male DBA1/J mice were obtained from
Bomholtgård (Ry, Denmark). Animals were routinely maintained at 23°C with water and food provided ad libitum. Mice
were immunized at the base of the tail on day 0 (at the age of
8 weeks) with 100 ␮g bovine type II collagen (CII) in Freund’s
complete adjuvant enriched with 2 mg/ml Mycobacterium tuberculosis H37Ra. On day 21, the animals were administered a
booster with an intraperitoneal injection of 100 ␮g CII dissolved in saline. Animals were euthanized and at the end of the
experiment (days 35–47), knee synovial biopsy samples, hind
paws, and serum samples were obtained as previously described (23). For histopathologic analysis, knee joints and knee
synovial biopsy samples were fixed in 4% formaldehyde and
processed further, as previously described (23). Knee joints
were also used for radiographic analysis, as previously described (23). To analyze 7␣- and 7␤-OH-DHEA levels by
radioimmunoassay (RIA), individual hind paws (with the skin
intact) and pooled knee synovial biopsy samples were isolated
(23), frozen in liquid nitrogen, and stored at ⫺70°C.
Detection of 7␣- and 7␤-OH-DHEA levels by RIA. To
determine 7␣- and 7␤-OH-DHEA levels in hind paws and
knee synovial biopsy samples, an RIA was performed using
antiserum against 7␣-OH-DHEA and 7␤-OH-DHEA. These
metabolites are formed by the activity of the CYP7B enzyme.
The RIA was performed at the Institute of Endocrinology at
Prague (Czech Republic) in cooperation with Dr. R. Hampl
(24). After pulverization in a microdismembrator, the hind
paws and knee synovial biopsy tissue powder were weighed and
ultrapure water (Milli-Q; Millipore, Bedford, MA) was added.
3347
Levels of 7␣-OH-DHEA and 7␤-OH-DHEA were measured
by RIA in extracts of hind paws from 3 animals, pooled knee
joint synovial biopsy samples (30 joints) with an arthritis score
of 0 (103 mg total weight), pooled knee joint biopsy samples
(30 joints) with an arthritis score of 1–2 (116 mg total weight),
and serum extracts from 3 animals, as previously described
(24). Extraction was carried out using diethyl ether. Diethyl
ether extracts containing 7␣-OH-DHEA and 7␤-OH-DHEA
were evaporated with nitrogen, and the dry residue was
dissolved in assay buffer and measured by RIA, as previously
described (24).
FLS isolation from CIA joints, culturing, and IL-1␤
incubation. Knee joint biopsy samples were isolated from mice
with severe arthritis, as previously described (23). The synovial
tissue biopsy samples were digested with collagenase, and the
mixture of cells was filtered through a fine sieve (200 ␮m;
NPBI, Amsterdam, The Netherlands). After overnight culturing, nonadherent lymphoid cells were removed and adherent
FLS were cultured in medium (Dulbecco’s modified Eagle’s
medium–Ham’s F-12 plus 10% fetal calf serum [FCS]; Life
Technologies, Breda, The Netherlands). Adherent FLS between passages 3 and 8 were used. Adherent FLS were
harvested with 0.05% trypsin/EDTA (Flow, Irvine, UK). FLS
(1 ⫻ 105) were cultured in the presence or absence of IL-1␤
and cycloheximide in X-Vivo 15 medium (BioWhittaker Europe, Verviers, Belgium). FLS were also used for total RNA or
protein isolation or to determine CYP7B activity by measuring
7␣-OH-DHEA by high-performance liquid chromatography
(HPLC).
CYP7B activity in FLS. FLS derived and cultured by
CIA were incubated for 24 hours with IL-1␤ and 1,2,6,7-3HDHEA (1 ⫻ 10⫺8M; NEN Life Science Products, Boston, MA)
in X-Vivo 15 medium. Steroid-containing medium (1 ml) was
collected and passed over a C-18 SPE cartridge (Sopachem,
Woerden, The Netherlands) to determine the conversion of
1,2,6,7-3H-DHEA into 3H-labeled 7␣-OH-DHEA, representing CYP7B activity. Steroids were eluted from the column with
300 ␮l methanol. Next, 3H-labeled 7␣-OH-DHEA and 3HDHEA were measured by HPLC. The amount of 7␣-OHDHEA is expressed as the percentage of 3H-labeled 7␣-OHDHEA of the total amount of 3H-label measured. Recoveries
after extraction were in the range of 85–95%. Identification of
7␣-OH-DHEA was confirmed by gas chromatography mass
spectrometry (data not shown).
Western blotting for CYP7B in FLS microsomes. FLS
were collected in ice-cold phosphate buffered saline containing
1 mM EDTA and protease inhibitors (Roche, Almere, The
Netherlands). Homogenization was carried out at 4°C with 10
strokes in a Potter-Elvehjem homogenizer (New Brunswig,
Nijmegen, The Netherlands) set at 600 revolutions per minute.
The homogenate was centrifuged at 800g for 10 minutes, after
which the supernatant was used. With supernatant, a second
centrifugation for 20 minutes at 11,000g (4°C) was performed
to remove cell debris, nuclei, and mitochondria. The last
supernatant was centrifuged at 150,000g for 60 minutes. The
microsomal pellet was suspended in buffer containing 0.1M
sodium pyrophosphate and 1 mM EDTA (pH 7.4). The
amount of protein was determined by bicinchoninic acid
(BCA) assay, and the microsomal fraction was stored at ⫺70°C
until further use. Amido black staining was performed as an
extra control, in addition to the BCA assay, to determine the
3348
amount of protein loaded. Microsomal lysate (5 ␮g protein)
was fractionated on Tris-buffered 10% polyacrylamide ready
gel (Bio-Rad, Veenendaal, The Netherlands) and transferred
to a polyvinylidene difluoride membrane (Bio-Rad). Membranes were blocked with blocking buffer (1 gm/liter bovine
serum albumin, 1% FCS, 5% Tween 20, 1 mole/liter NaCl in
100 mmoles/liter Tris HCl, pH 7.4) for 30 minutes and
incubated overnight (4°C) with a polyclonal rabbit anti-mouse
CYP7B antibody. Detection was performed by chemiluminescence following anti-rabbit peroxidase incubation. The antibody used was raised by us against a peptide sequence from
mouse CYP7B (amino acids 266–281). The peptide used was
identical to the peptide used by Schwarz et al for antibody
generation (20).
CYP7B and IL-1␤ mRNA levels. To investigate the
presence of CYP7B and IL-1␤ mRNA in synovial biopsy
samples, total RNA was isolated in RNAzol (Campro,
Veenendaal, The Netherlands). FLS were lysed in RNAzol
(1 ⫻ 106 cells per 1 ml RNAzol) and the suspension was then
collected by scraping the bottom of the plate. RNA was
isolated by chloroform and water separation. Synthesis of
complementary DNA (cDNA) was carried out according to
the manufacturer’s protocol using random hexa primers (Pharmacia, Piscataway, NJ) and reverse transcriptase (Superscript
RT; Pharmacia). Semiquantitative RT–polymerase chain reaction (PCR) was performed by removing aliquots (20 ␮l) of the
PCR product after 25, 30, and 35 cycles. The PCR product was
analyzed on 1.5% agarose gel for 1 hour at 180V. As primers,
the following were used: for GAPDH, CCCTTCATTGACCTCAACTACATGG (forward) and GGTCCACCACCCTGTTGCTGTAGCC (reverse); for mouse CYP7B,
GCCCTCTTTCCTCCACTCA (forward) and TGAGCTTCTCCAAGATTTTGC (reverse); for mouse IL-1 ␤ ,
GCAACTGTTCCTGAACTCA (forward) and CTCGGAGCCTGTAGTGCAG (reverse).
RESULTS
Arthritis score. To investigate the role of CYP7B
in arthritis, the CIA model in DBA/1J mice was used.
Eighty-five percent of the DBA/1J mice developed CIA
after immunization and booster with bovine CII.
To quantify the severity of knee joint inflammation, an arthritis scoring system for knee joints of mice
with CIA was used as previously described (25). For this
purpose, the skin was removed and the underlying tissue
of the knee was scored macroscopically. In mice with
clinical signs of arthritis (scores 1–2), both increased
swelling and newly formed blood vessels were observed
(Figures 1B and C). In addition, histologic analysis of
knee synovial biopsy samples showed no signs of inflammation in animals without clinical signs of arthritis (score
0) but did show large infiltrates of inflammatory cells in
animals with a clinical score of 1–2 (Figures 1D–F).
Increased 7␣-OH-DHEA levels in arthritic
joints. We studied 7␣- and 7␤-OH-DHEA levels in knee
synovial biopsy samples from arthritic versus nonar-
DULOS ET AL
Figure 1. Macroscopic and histopathologic scoring of arthritis. Macroscopic appearance of knee joints with no arthritis (A) and with
arthritis scores of 1 (B) and 2 (C). Synovial biopsy samples were
isolated and processed for histopathologic study. Samples exhibit no
arthritis (D), or arthritic changes scored as 1 (E) and 2 (F). Arrows in
A–C indicate the sites from which the samples shown in D–E,
respectively, were obtained.
thritic CII-immunized mice. A 5-fold increase in 7␣-OHDHEA and a 3-fold increase in 7␤-OH-DHEA levels
was observed in knee joint synovial biopsy samples from
arthritic mice versus nonarthritic mice (Figure 2). In
addition, the hind paws of arthritic mice showed a
significantly (3-fold) increased 7␣-OH-DHEA level,
whereas the level of 7␤-OH-DHEA was nearly identical
in arthritic and nonarthritic hind paws (Figure 2). Interestingly, both the 7␣-OH-DHEA and the 7␤-OHDHEA levels in the knee synovial biopsy samples were
higher than the levels in the hind paws, suggesting
enhanced CYP7B activity at the site of inflammation.
No major changes were observed when serum levels in
7␣-OH-DHEA and 7␤-OH-DHEA in arthritic mice
were compared with those of nonarthritic mice.
Enhanced CYP7B mRNA levels in knee synovial
biopsy samples. Figure 3 shows the clinical evaluation of
the hind paws from arthritic and nonarthritic mice. In
addition, radiographic and histopathologic findings in
the knee joints of arthritic versus nonarthritic mice are
shown. Swelling was evident in the hind paws of CIA
mice (Figures 3A and B) and was associated with bone
erosion in knee joints, as observed by radiographic
analysis (Figure 3D). Besides bone erosions, we found
histopathologic evidence of inflammatory infiltrates and
cartilage destruction in the knee joints of arthritic mice
(Figure 3F). As expected, inflammatory infiltrates and
cartilage destruction were absent in nonarthritic but
CII-immunized mice (Figure 3E).
To investigate whether a local increase in 7␣-OHDHEA levels resulted from an increase in CYP7B levels,
CYP7B mRNA expression levels in knee synovial biopsy
CORRELATION OF CIA WITH CYP7B ACTIVITY
3349
synovial biopsy samples from knees with different arthritis scores was used. IL-1␤ mRNA levels were measured,
in addition to CYP7B, as a reference cytokine for
inflammation in murine CIA (26). GAPDH was used as
an internal control to check for possible differences in
the amount of RNA per sample. The mRNA level of
GAPDH was compared with those of CYP7B and IL-1␤,
Figure 2. Levels of 7␣-OH-dehydroepiandrosterone (7␣-OH-DHEA)
and 7␤-OH-DHEA in serum, hind paws, and knee joint synovial biopsy
samples from arthritic and nonarthritic type II collagen (CII)–
immunized mice. DBA1/J mice were immunized on day 0 and administered a booster of CII on day 21. Levels of A, 7␣-OH-DHEA and B,
7␤-OH-DHEA were measured in extracts of hind paws from 3 animals,
pooled knee joint synovial biopsy samples, and serum extracts from 3
animals, by radioimmunoassay. Thirty biopsy samples with a knee
score of 0 (103 mg total weight) and 30 biopsy samples with a knee
score of 1–2 (116 mg total weight) were pooled. Hind paws and knee
joints of arthritic mice with a knee score of 1–2 were compared with
those of nonarthritic mice (knee score 0). The level of 7␣- and
7␤-OH-DHEA in joint synovial biopsy samples and hind paws is shown
as nM, normalized to 7␣- or 7␤-OH-DHEA concentration per 100 mg
tissue. The concentration of 7␣- and 7␤-OH-DHEA in serum is shown
as nM. Values are the mean and SEM. ⴱ ⫽ P ⬍ 0.05 versus nonarthritic
mice, by Student’s t-test.
samples from arthritic mice were compared with those
from nonarthritic mice. A marked increase of CYP7B
mRNA was found in the inflamed synovium of arthritic
mice (Figure 3H versus Figure 3G). This elevated
CYP7B mRNA level in knee synovial biopsy samples
from arthritic mice, together with increased CYP7B
activity, correlated with CIA disease progression.
Correlation of arthritis scores with increases in
synovial CYP7B and IL-1␤ mRNA expression. To investigate whether there is a relationship between the joint
score and the level of CYP7B mRNA, cDNA from
Figure 3. CYP7B mRNA expression in arthritic and nonarthritic
mice. DBA1/J mice were immunized on day 0 and administered a
booster of type II collagen on day 21. Mice were thereafter divided into
an arthritic group and a nonarthritic group. A and B, Paw swelling, C
and D, radiographic features, and E and F, histopathologic features
were assessed as described in Materials and Methods. Findings in
nonarthritic (control: score 0) mice and mice with collagen-induced
arthritis (score 2), representative of 5 independent experiments, are
shown. Arrows indicate areas of bone destruction. Inflammatory
infiltrates in synovium (S) and joint space (JS) and cartilage destruction in arthritic and nonarthritic mice were compared. Individual
synovial biopsy samples were obtained and semiquantitative polymerase chain reaction (PCR) was performed by removing aliquots (20 ␮l)
of the PCR product after increasing the number of cycles (25, 30, and
35) in which the CYP7B signal was compared with the GAPDH signal.
Boxes in E and F indicate the areas from which the biopsy samples
were obtained. Knee synovial biopsy cDNA from G, nonarthritic mice
was compared with cDNA from H, mice with severe arthritis, using
CYP7B- and GAPDH-specific primers. Reverse transcriptase–PCR
results are representative of 3 independent experiments in which, per
experiment, 1 synovial biopsy sample of score 0 and 3 synovial biopsy
samples of score 2 were used. P ⫽ patella; F ⫽ femur; Ti ⫽ tibia; Fi ⫽
fibula; C ⫽ cartilage.
3350
using the same amount of cDNA. No signal or only a
weak signal for CYP7B and IL-1␤ mRNA was observed
in nonarthritic mice (score 0) (Figure 4). When arthritis
developed, an increase in the arthritis score of the knee
joints (score 1, 1.5, 2) was associated with a gradual
increase in both CYP7B and IL-1␤ mRNA levels in the
synovium (Figure 4).
IL-1␤-induced increase of CYP7B activity. Apart
from the analysis of 7␣-OH-DHEA and CYP7B mRNA
in vivo, the presence and activity of CYP7B in cells
isolated from knee synovial biopsy samples was examined. For this purpose, FLS, which are increased in the
synovium in arthritis, were isolated from knee synovial
biopsy samples and cultured (passages 3–8) in vitro. In
addition, FLS were incubated with the cytokine IL-1␤ to
determine the effect of IL-1␤ on the activity of CYP7B
in the formation of 7␣-OH-DHEA.
The conversion of DHEA into 7␣-OH-DHEA
was observed in cultured mouse FLS. Following stimulation with IL-1␤ (1, 10, or 100 pg/ml), a dose-dependent
increase in the formation of 7␣-OH-DHEA occurred,
indicating enhanced CYP7B activity (Figure 5A). To
investigate whether the IL-1␤–dependent increase in
CYP7B activity resulted from enhanced CYP7B protein
levels in FLS, Western blot analysis (using our CYP7B
peptide–specific antibody) was carried out on the microsome fraction of FLS known to contain CYP7B. FLS
cultured without IL-1␤ showed a weak CYP7B protein
signal (Figure 5B). Consistent with the increased
CYP7B activity, IL-1␤ (100 pg/ml) stimulation of FLS
resulted in an increase in CYP7B protein (Figure 5B).
When studied at the mRNA level, IL-1␤ increased the
CYP7B transcript in a dose-dependent manner (results
not shown). Thus, the cytokine IL-1␤ dose-dependently
increased 7␣-OH-DHEA formation, which implied that
Figure 4. Correlation between knee joint score and CYP7B and
interleukin-1␤ (IL-1␤) mRNA levels in collagen-induced arthritis.
Synovial biopsy samples from 5 mice were pooled for each knee joint
score. RNA was isolated, cDNA was made, and reverse transcriptase–
polymerase chain reaction was performed with GAPDH-, CYP7B-,
and IL-1␤–specific primers, as described in Materials and Methods.
Results shown are representative of 3 experiments with 3 mice (2
synovial biopsy samples per mouse).
DULOS ET AL
Figure 5. Dose-dependent increase of CYP7B activity and CYP7B
protein expression in fibroblast-like synoviocytes (FLS) with
interleukin-1␤ (IL-1␤) treatment. Mouse knee FLS were stimulated
for 24 hours in the presence or absence of 1, 10, or 100 pg/ml IL-1␤ and
with or without 1.5 ⫻ 10⫺8M 3H-dehydroepiandrosterone (DHEA).
Supernatant and cells were processed by high-performance liquid
chromatography (A) and Western blot analysis (B), respectively.
Results in A are the mean and SEM from 2 independent experiments
done in triplicate for each condition. The percentages of 3H-labeled
7␣-OH-DHEA formed in the incubations without IL-1␤ were 2.4 ⫾ 0.6
and 8.0 ⫾ 0.6 in the 2 experiments, respectively, those in incubations
with 1 pg/ml IL-1␤ were 4.4 ⫾ 0.3 (P ⱕ 0.05) and 6.3 ⫾ 0.4 (P ⱕ 0.05),
those in incubations with 10 pg/ml were 6.2 ⫾ 0.2 (P ⱕ 0.01) and
11.1 ⫾ 2.3 (P ⱕ 0.08), and those in incubations with 100 pg/ml were
10.7 ⫾ 0.4 (P ⱕ 0.0005) and 18.1 ⫾ 0.79 (P ⱕ 0.0003) (P values versus
medium control, by Student’s t-test). Western blot analysis was performed with 5 ␮g protein of stimulated (100 pg/ml IL-1␤) and
unstimulated FLS microsomes, as described in Materials and Methods.
The apparent molecular weight of CYP7B is 58 kd (B).
IL-1␤ can enhance the expression of CYP7B at both the
mRNA and the protein levels.
Kinetics of CYP7B mRNA expression after IL-1␤
stimulation. RT-PCR experiments were performed to
investigate the kinetics of IL-1␤–induced CYP7B
mRNA levels. A weak CYP7B mRNA signal was found
CORRELATION OF CIA WITH CYP7B ACTIVITY
Figure 6. Time-dependent increase in CYP7B mRNA levels. Murine
fibroblast-like synoviocytes were left untreated or were stimulated with
interleukin-1␤ (IL-1␤; 100 pg/ml) in the presence or absence of
cycloheximide (CHX; 15 ␮g/ml). Reverse transcriptase–polymerase
chain reaction was performed with murine CYP7B- and GAPDHspecific primers (35 cycles).
in unstimulated FLS (Figure 6). Stimulation with 100
pg/ml IL-1␤ for 2 hours resulted in a strong increase in
CYP7B mRNA levels, which was maintained after the
incubation of FLS for 4, 8, and 24 hours. Using the
specified PCR amplification cycles, IL-1␤ did not affect
the GAPDH mRNA level (Figure 6).
Cycloheximide was used to analyze whether the
induction of CYP7B mRNA by IL-1␤ is dependent on
de novo protein synthesis. The results presented in
Figure 6 show that cycloheximide did not affect the
IL-1␤–induced increase in CYP7B mRNA levels in
murine FLS. Therefore, the IL-1␤–induced increase in
CYP7B production was caused by either a direct effect
of IL-1␤ on CYP7B mRNA expression or an indirect
effect dependent on a protein in the resident pool.
DISCUSSION
Our study is the first to show that the severity of
murine CIA is correlated with increased CYP7B mRNA
levels in the joint. As a result of increased CYP7B
activity in the joint, increased formation of immunostimulating 7␣-OH-DHEA was found. Moreover, IL-1␤,
an important proinflammatory cytokine in arthritis, was
found to positively regulate CYP7B activity. These
findings suggest a role for CYP7B in arthritis pathology.
Our data show a disease-dependent increase in
the amount of 7␣-OH-DHEA and, to a lesser extent,
7␤-OH-DHEA in the affected joints of arthritic mice.
The increase in 7␣-OH-DHEA proved to be a local
phenomenon since enhanced levels of 7␣-OH-DHEA
were not found in the serum of these mice. The observed
low serum and synovial biopsy levels of 7␤-OH-DHEA,
when compared with 7␣-OH-DHEA, suggest that 7␣-
3351
OH-DHEA is the main CYP7B-catalyzed metabolite
formed (18–20).
The importance of 7␣-OH-DHEA as an immunostimulating metabolite has been reported before
(9,12). Moreover, data suggest that 7␣-OH-DHEA
shows antiglucocorticoid activity (13,14,27). Chmielewski and colleagues demonstrated that dexamethasoneinduced thymocyte apoptosis was counteracted by 7␣OH-DHEA but not by 7␤-OH-DHEA (13). Recently, it
has been proposed that glucocorticoids and 7␣-OHDHEA, by virtue of the hydroxy group at positions 11␤
and 7␣, respectively, display rotational symmetry and
thus may bind to the glucocorticoid receptor (17). In
addition, it was suggested that autoimmunity could
result from elevated antiglucocorticoid 7␣-OH-DHEA
levels (14). Since antiglucocorticoid 7␣-OH-DHEA
might have stimulatory effects on the inflammatory
process, studies of the administration of 7␣-OH-DHEA
in murine arthritis are clearly needed to elucidate the
mechanism by which 7␣-OH-DHEA interferes with the
inflammatory process. In this respect, it would be of
interest to investigate whether inflammation and arthritis development are reduced in CYP7B-knockout mice
(28).
Increased levels of 7␣-OH-DHEA locally in the
arthritic joint are thought to result from a conversion of
DHEA into 7␣-OH-DHEA by increased CYP7B activity. This activity may enhance inflammation not only via
an increase in 7␣-OH-DHEA, but also via a decline in
the level of DHEA (29,30). A number of studies have
shown that, in patients with inflammatory diseases,
DHEA concentrations in serum are low (11,21,22).
The immunosuppressive effects of DHEA that
have been described could be due to the conversion of
DHEA into the steroids testosterone and/or 17-␤estradiol (1,2). The administration of DHEA seems to
be beneficial in chronic inflammatory diseases in humans and mice (5–7,11). In addition, decreased Th1
cytokine production in vitro was observed in the presence of high doses of DHEA (31). However, other
authors reported no effect on Th1 cytokines (32,33) or
observed an increase in Th1 cytokine production (8,34).
Immunosuppression was also observed following DHEA
treatment of mice with CIA (6). In these mice, both
IgG1 and IgG2a anti-CII antibodies were found to be
reduced, suggesting down-modulation of both Th1 and
Th2 responses (6).
Besides immunosuppression, several authors
have reported an immunostimulating role for DHEA in
vitro and in vivo (8–10). One explanation for the discrepancy in the immunomodulatory effects of DHEA is
3352
that the 7␣-OH-DHEA metabolite, rather than DHEA,
may be responsible for the effects observed (9,12,17). In
this respect, it is of interest that 7␣-OH-DHEA appears
to be more active than DHEA in stimulating the production of antilysozyme antibodies (9) and in counteracting
the antigen-specific induction of nasal tolerance (10).
It became clear from various studies that
fibroblast-like cells display CYP7B activity by their
ability to convert DHEA into 7␣-OH-DHEA (35–37). In
our studies, CYP7B activity and CYP7B mRNA expression were observed with FLS isolated from the arthritic
synovium. Recent studies also indicate that other cell
types, such as macrophages (38) and lymphocytes (17),
display CYP7B activity. Therefore, apart from FLS,
macrophages and lymphocytes could also be involved in
the formation of 7␣-OH-DHEA at the site of (chronic)
inflammation.
To investigate whether CYP7B is regulated by
inflammatory cytokines, the proinflammatory cytokine
IL-1␤ was used. IL-1␤ is recognized as a key cytokine in
arthritis because it is found at high levels in arthritic
synovium, and treatment of established arthritis with
anti–IL-1␤ can block inflammation and thereby cartilage
and bone destruction (26,39). Indeed, we show here that
IL-1␤ stimulates CYP7B activity, CYP7B mRNA, and
CYP7B protein levels in FLS. Our results regarding
IL-1␤ stimulation of CYP7B activity are consistent with
data from Payne et al (40) showing increased CYP7B
activity induced by IL-1␤ in ovarian cells. It is likely that
IL-1␤ is not the only mediator in inducing CYP7B
activity, because tumor necrosis factor ␣ (TNF␣) treatment also induces such activity (40).
Thus, TNF␣, which is, in addition to IL-1␤, a key
cytokine in RA, may also be involved in enhanced
formation of immunostimulating 7␣-OH-DHEA. Notably, activation of the P450 enzyme CYP7B by IL-1␤/
TNF␣ is a unique phenomenon since other P450 enzymes, such as CYP7A, CYP2C11, CYP3A2, and
CYP1A1, are down-regulated by TNF␣ (41–44). Further
research is needed to investigate whether CYP7B is
present in synoviocytes from RA patients and whether
CYP7B activity is regulated by inflammatory cytokines
such as IL-1␤ and TNF␣ in human arthritis. The CYP7B
promoter contains NF-␬B–responsive elements (45). It
is known that NF-␬B is activated by inflammatory
cytokines such as TNF␣ and IL-1␤. Studies are needed
to clarify whether increased formation of 7␣-OH-DHEA
via IL-1␤ and/or TNF␣ is regulated via the NF-␬B
pathway.
In conclusion, disease progression in CIA is
correlated with an IL-1␤–dependent increase in CYP7B
DULOS ET AL
mRNA expression and CYP7B enzyme activity, which
produce enhanced levels of 7␣-OH-DHEA. The latter
conclusion is underlined by the fact that IL-1␤ regulates
CYP7B mRNA expression in FLS, isolated from arthritic joints. More studies are needed to investigate
whether CYP7B is a relevant target for the treatment
of RA.
ACKNOWLEDGMENTS
We thank Mrs. M. van der Vleuten for generating and
characterizing the CYP7B antibody, Mrs. T. Coenen-de Roo
for radiographic analysis, and Mr. W. van der Heijden and
Mrs. N. Bisseling for photographic reproductions. Dr. L.
Joosten (University Medical Center St. Radboud, Nijmegen,
The Netherlands) is acknowledged for helping with the scoring
system for CIA knee joints. We thank Dr. A. Kavelaars and
Professor Dr. C. J. Heijnen for stimulating discussions and for
helpful suggestions regarding the manuscript.
REFERENCES
1. Straub RH, Cutolo M. Involvement of the hypothalamic–
pituitary–adrenal/gonadal axis and the peripheral nervous system
in rheumatoid arthritis: viewpoint based on a systemic pathogenetic role [review]. Arthritis Rheum 2001;44:493–507.
2. Cutolo M, Seriolo B, Villaggio B, Pizzorni C, Craviotto C, Sulli A.
Androgens and estrogens modulate the immune and inflammatory
responses in rheumatoid arthritis [review]. Ann N Y Acad Sci
2002;966:131–42.
3. Dulos GJ, Bagchus WM. Androgens indirectly accelerate thymocyte apoptosis. Int Immunopharmacol 2001;1:321–8.
4. Bradlow HL, Murphy J, Byrne JJ. Immunological properties of
dehydroepiandrosterone, its conjugates, and metabolites. Ann N Y
Acad Sci 1999;876:91–101.
5. Giltay EJ, van Schaardenburg D, Gooren LJ, von Blomberg BM,
Fonk JC, Touw DJ, et al. Effects of dehydroepiandrosterone
administration on disease activity in patients with rheumatoid
arthritis. Br J Rheumatol 1998;37:705–6.
6. Williams PJ, Jones RH, Rademacher TW. Reduction in the
incidence and severity of collagen-induced arthritis in DBA/1
mice, using exogenous dehydroepiandrosterone. Arthritis Rheum
1997;40:907–11.
7. Du C, Khalil MW, Sriram S. Administration of dehydroepiandrosterone suppresses experimental allergic encephalomyelitis in
SJL/J mice. J Immunol 2001;167:7094–101.
8. Daynes RA, Dudley DJ, Araneo BA. Regulation of murine
lymphokine production in vivo. II. Dehydroepiandrosterone is a
natural enhancer of interleukin 2 synthesis by helper T cells. Eur
J Immunol 1990;20:793–802.
9. Morfin R, Courchay G. Pregnenolone and dehydroepiandrosterone as precursors of native 7-hydroxylated metabolites which
increase the immune response in mice. J Steroid Biochem Mol
Biol 1994;50:91–100.
10. Wolvers DA, Bakker JM, Bagchus WM, Kraal G. The steroid
hormone dehydroepiandrosterone (DHEA) breaks intranasally
induced tolerance, when administered at time of systemic immunization. J Neuroimmunol 1998;89:19–25.
11. Wilder RL. Adrenal and gonadal steroid hormone deficiency in
the pathogenesis of rheumatoid arthritis. J Rheumatol 1996;44
Suppl:10–2.
12. Morfin R, Lafaye P, Cotillon AC, Nato F, Chmielewski V,
CORRELATION OF CIA WITH CYP7B ACTIVITY
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Pompon D. 7␣-hydroxy-dehydroepiandrosterone and immune response [review]. Ann N Y Acad Sci 2000;917:971–82.
Chmielewski V, Drupt F, Morfin R. Dexamethasone-induced
apoptosis of mouse thymocytes: prevention by native 7␣-hydroxysteroids. Immunol Cell Biol 2000;78:238–46.
Morfin R. Involvement of steroids and cytochromes P(450) species
in the triggering of immune defenses [review]. J Steroid Biochem
Mol Biol 2002;80:273–90.
Chiang JY. Regulation of bile acid synthesis. Front Biosci 1998;3:
D176–93.
Bjorkhem I, Eggertsen G. Genes involved in initial steps of bile
acid synthesis [review]. Curr Opin Lipidol 2001;12:97–103.
Lathe R. Steroid and sterol 7-hydroxylation: ancient pathways.
Steroids 2002;67:967–77.
Stapleton G, Steel M, Richardson M, Mason JO, Rose KA, Morris
RG, et al. A novel cytochrome P450 expressed primarily in brain.
J Biol Chem 1995;270:29739–45.
Rose KA, Stapleton G, Dott K, Kieny MP, Best R, Schwarz M, et
al. Cyp7b, a novel brain cytochrome P450, catalyzes the synthesis
of neurosteroids 7␣-hydroxy dehydroepiandrosterone and 7␣hydroxy pregnenolone. Proc Natl Acad Sci U S A 1997;94:
4925–30.
Schwarz M, Lund EG, Lathe R, Bjorkhem I, Russell DW.
Identification and characterization of a mouse oxysterol 7␣hydroxylase cDNA. J Biol Chem 1997;272:23995–4001.
Cutolo M, Sulli A, Villaggio B, Seriolo B, Accardo S. Relations
between steroid hormones and cytokines in rheumatoid arthritis
and systemic lupus erythematosus [review]. Ann Rheum Dis
1998;57:573–7.
Straub RH, Lehle K, Herfarth H, Weber M, Falk W, Preuner J, et
al. Dehydroepiandrosterone in relation to other adrenal hormones
during an acute inflammatory stressful disease state compared
with chronic inflammatory disease: role of interleukin-6 and
tumour necrosis factor. Eur J Endocrinol 2002;146:365–74.
Lubberts E, Joosten LA, Oppers B, van den Bersselaar L,
Coenen-de Roo CJ, Kolls JK, et al. IL-1-independent role of IL-17
in synovial inflammation and joint destruction during collageninduced arthritis. J Immunol 2001;167:1004–13.
Lapcik O, Hampl R, Hill M, Starka L. Immunoassay of 7-hydroxysteroids. 2. Radioimmunoassay of 7␣-hydroxy-dehydroepiandrosterone. J Steroid Biochem Mol Biol 1999;71:231–7.
Van Meurs JB, van Lent PL, Joosten LA, van der Kraan PM, van
den Berg WB. Quantification of mRNA levels in joint capsule and
articular cartilage of the murine knee joint by RT-PCR: kinetics of
stromelysin and IL-1 mRNA levels during arthritis. Rheumatol Int
1997;16:197–205.
Joosten LA, Helsen MM, Saxne T, van de Loo FA, Heinegard D,
van den Berg WB. IL-1 ␣␤ blockade prevents cartilage and bone
destruction in murine type II collagen-induced arthritis, whereas
TNF-␣ blockade only ameliorates joint inflammation. J Immunol
1999;163:5049–55.
Sterzl I, Hampl R, Sterzl J, Votruba J, Starka L. 7␤-OH-DHEA
counteracts dexamethasone induced suppression of primary immune response in murine splenocytes. J Steroid Biochem Mol Biol
1999;71:133–7.
Li-Hawkins J, Lund EG, Turley SD, Russell DW. Disruption of
the oxysterol 7␣-hydroxylase gene in mice. J Biol Chem 2000;275:
16536–42.
Belanger A, Candas B, Dupont A, Cusan L, Diamond P, Gomez
JL, et al. Changes in serum concentrations of conjugated and
unconjugated steroids in 40- to 80-year-old men. J Clin Endocrinol
Metab 1994;79:1086–90.
3353
30. Corsini E, Lucchi L, Meroni M, Racchi M, Solerte B, Fioravanti
M, et al. In vivo dehydroepiandrosterone restores age-associated
defects in the protein kinase C signal transduction pathway and
related functional responses. J Immunol 2002;168:1753–8.
31. Du C, Guan Q, Khalil MW, Sriram S. Stimulation of Th2 response
by high doses of dehydroepiandrosterone in KLH-primed splenocytes. Exp Biol Med (Maywood) 2001;226:1051–60.
32. MacPhee IA, Turner DR, Oliveira DB. The role of endogenous
steroid hormones in the generation of T helper 2-mediated
autoimmunity in mercuric chloride-treated Brown-Norway rats.
Immunology 2000;99:141–6.
33. Moynihan JA, Callahan TA, Kelley SP, Campbell LM. Adrenal
hormone modulation of type 1 and type 2 cytokine production by
spleen cells: dexamethasone and dehydroepiandrosterone suppress interleukin-2, interleukin-4, and interferon-␥ production in
vitro. Cell Immunol 1998;184:58–64.
34. Suzuki T, Suzuki N, Daynes RA, Engleman EG. Dehydroepiandrosterone enhances IL2 production and cytotoxic effector
function of human T cells. Clin Immunol Immunopathol 1991;61:
202–11.
35. Rose K, Allan A, Gauldie S, Stapleton G, Dobbie L, Dott K, et al.
Neurosteroid hydroxylase CYP7B: vivid reporter activity in dentate gyrus of gene-targeted mice and abolition of a widespread
pathway of steroid and oxysterol hydroxylation. J Biol Chem
2001;276:23937–44.
36. Khalil MW, Strutt B, Vachon D, Killinger DW. Metabolism of
dehydroepiandrosterone by cultured human adipose stromal cells:
identification of 7␣-hydroxydehydroepiandrosterone as a major
metabolite using high performance liquid chromatography and
mass spectrometry. J Steroid Biochem Mol Biol 1993;46:585–95.
37. Zhang J, Larsson O, Sjovall J. 7␣-hydroxylation of 25-hydroxycholesterol and 27-hydroxycholesterol in human fibroblasts. Biochim
Biophys Acta 1995;1256:353–9.
38. Schmidt M, Kreutz M, Loffler G, Scholmerich J, Straub RH.
Conversion of dehydroepiandrosterone to downstream steroid
hormones in macrophages. J Endocrinol 2000;164:161–9.
39. Dayer JM, Feige U, Edwards CK III, Burger D. Anti-interleukin-1
therapy in rheumatic diseases [review]. Curr Opin Rheumatol
2001;13:170–6.
40. Payne DW, Shackleton C, Toms H, Ben-Shlomo I, Kol S, deMoura M, et al. A novel nonhepatic hydroxycholesterol 7␣hydroxylase that is markedly stimulated by interleukin-1␤: characterization in the immature rat ovary. J Biol Chem 1995;270:
18888–96.
41. Feingold KR, Spady DK, Pollock AS, Moser AH, Grunfeld C.
Endotoxin, TNF, and IL-1 decrease cholesterol 7␣-hydroxylase
mRNA levels and activity. J Lipid Res 1996;37:223–8.
42. Nadin L, Butler AM, Farrell GC, Murray M. Pretranslational
down-regulation of cytochromes P450 2C11 and 3A2 in male rat
liver by tumor necrosis factor ␣. Gastroenterology 1995;109:
198–205.
43. Paton TE, Renton KW. Cytokine-mediated down-regulation of
CYP1A1 in Hepa1 cells. Biochem Pharmacol 1998;55:1791–6.
44. Zhao Y, Nichols JE, Valdez R, Mendelson CR, Simpson ER.
Tumor necrosis factor-␣ stimulates aromatase gene expression in
human adipose stromal cells through use of an activating protein-1
binding site upstream of promoter 1.4. Mol Endocrinol 1996;10:
1350–7.
45. Wu Z, Martin KO, Javitt NB, Chiang JY. Structure and functions
of human oxysterol 7␣-hydroxylase cDNAs and gene CYP7B1. J
Lipid Res 1999;40:2195–203.
Документ
Категория
Без категории
Просмотров
3
Размер файла
220 Кб
Теги
increase, induced, metabolico, correlates, murine, severity, arthritis, dehydroepiandrosterone, interleukin, activityenhancement, collagen, cyp7b
1/--страниц
Пожаловаться на содержимое документа