Triptolide an active component of the Chinese herbal remedy Tripterygium wilfordii Hook F inhibits production of nitric oxide by decreasing inducible nitric oxide synthase gene transcription.

ARTHRITIS & RHEUMATISM
Vol. 50, No. 9, September 2004, pp 2995–3003
DOI 10.1002/art.20459
© 2004, American College of Rheumatology
Triptolide, an Active Component of the Chinese Herbal
Remedy Tripterygium wilfordii Hook F, Inhibits Production of
Nitric Oxide by Decreasing Inducible Nitric Oxide Synthase
Gene Transcription
B. Wang, L. Ma, X. Tao, and P. E. Lipsky
administration of the EA extract (52.3% and 59.8% of
control, respectively, at one-eighth of the dose that is
lethal for 50% of the animals [LD50] and 21.0% and
38.1% of control, respectively, at one-fourth the LD50).
Moreover, the EA extract and triptolide significantly
inhibited NO production in vitro in activated peritoneal
macrophages, which reflected a decreased level of iNOS
mRNA. Finally, triptolide inhibited promoter activity of
the iNOS gene and induction of the activity of the
regulator of iNOS transcription, Oct-1.
Conclusion. The EA extract of TWHF and triptolide inhibit transcription of the iNOS gene. This may
contribute to the antiinflammatory effects of this traditional herbal remedy.
Objective. The ethyl acetate (EA) extract of
Tripterygium wilfordii Hook F (TWHF) and its major
active component, triptolide, have been reported to be
effective in the treatment of rheumatoid arthritis and
other autoimmune inflammatory diseases. Nitric oxide
(NO) has been recognized as an important mediator of
inflammation. This study was therefore undertaken to
examine the effects of the EA extract and triptolide on
the production of NO and inducible NO synthase
(iNOS) gene expression and transcription in vivo and in
vitro.
Methods. Peritoneal macrophages from
C57BL/6J mice treated orally with the EA extract of
TWHF were assayed for NO production and iNOS
messenger RNA (mRNA) expression by reverse
transcriptase–polymerase chain reaction. The murine
fibroblast cell line NIH3T3 was also assessed for NO
production and iNOS mRNA expression, as well as for
iNOS promoter activation, Oct-1 nuclear binding capacity, and Oct-1 protein content by transient transfection,
electrophoretic mobility shift assay, and immunoblotting, respectively.
Results. NO production and iNOS mRNA expression by macrophages from C57BL/6J mice immunized
with trinitrophenyl–bovine serum albumin in Freund’s
complete adjuvant were significantly inhibited by oral
Tripterygium wilfordii Hook F (TWHF) has been
used as an herbal remedy to treat arthritis and other
autoimmune inflammatory disorders for several centuries in China. The ethyl acetate (EA) extract is one of
the most popular preparations of TWHF because it
causes fewer adverse effects than cruder preparations
(1,2). Both phase I and phase II studies of the EA
extract of TWHF in rheumatoid arthritis (RA) patients
showed that it appeared to be safe and clinically beneficial (3,4). Previous studies showed that the antiinflammatory and immunosuppressive effects of the EA extract could be accounted for by the content of specific
diterpenoids, including triptolide and tripdiolide (5,6).
Recently, it has been reported that the EA extract of
TWHF inhibited prostaglandin E2 production by in vitro
lipopolysaccharide (LPS)–stimulated human monocytes
and synovial fibroblasts derived from RA patients and by
carrageenan-induced air pouch lining cells in rats (7,8).
However, the precise mechanism by which TWHF inhibits inflammation has not been completely delineated.
Nitric oxide (NO) is known to be involved in the
Supported by the Intramural Research Program of the National Institute of Arthritis and Musculoskeletal and Skin Diseases,
NIH.
B. Wang, MD, L. Ma, MD (current address: China-Japan
Friendship Hospital, Beijing, China), X. Tao, MD, P. E. Lipsky, MD:
Autoimmunity Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, NIH, Bethesda, Maryland.
Address correspondence and reprint requests to P. E. Lipsky,
MD, Autoimmunity Branch, National Institute of Arthritis and Musculoskeletal Skin Diseases, NIH, 9000 Rockville Pike, Building 10,
Room 9N228, Bethesda, MD 20892. E-mail: lipskyp@mail.nih.gov.
Submitted for publication December 19, 2003; accepted in
revised form May 5, 2004.
2995
2996
WANG ET AL
support of normal physiologic functions, such as vasodilation and neurotransmission, and also contributes to
the killing of intracellular pathogens and host defense
against tumor cells. On the other hand, sustained and
excess production of NO can play a role in inflammation
and tissue damage. The rate-limiting enzyme in the
production of NO is NO synthase (NOS). There are
various isoforms of NOS. The constitutive and inducible
(iNOS) forms are responsible for regulating the physiologic and pathologic roles of NO, respectively (9–11).
An increase in NO production has been noted in
patients with RA or other inflammatory joint diseases
(12–15). Increases in NO production and iNOS expression by peripheral blood monocytes or synovium were
found to be more significant in patients with RA than in
those with osteoarthritis (15,16). NO production in RA
patients was significantly correlated with clinical manifestations of inflammation, including morning stiffness
and the number of tender and swollen joints, as well as
with the serum level of C-reactive protein (17,18).
Glucocorticoids and other antirheumatic drugs inhibit
NO production in RA patients (12,18). Notably, administration of the EA extract of TWHF caused a reduction
in production of NO in an animal model of arthritis that
paralleled improvement in the degree of arthritis (19).
These results indicate that NO is a mediator of inflammation that may be involved in the pathogenesis of RA
and other forms of arthritis. Therefore, it was of interest
to determine whether the EA extract of TWHF and its
active component, triptolide, could affect production of
NO in vivo and in vitro.
Results from the current study show that treatment of mice with the EA extract both in vivo and in
vitro inhibited NO production and iNOS messenger
RNA (mRNA) expression. Triptolide suppressed iNOS
gene expression at the transcriptional level by inhibiting
induction of the activity of Oct-1, which is known to
regulate iNOS transcription. The data suggest that the
clinical activity of the EA extract of TWHF in RA
patients may relate to its ability to suppress iNOS
expression.
MATERIALS AND METHODS
Drugs and animal treatment regimen. The EA extract
of TWHF was prepared from peeled roots of TWHF (obtained
from Fujian Province in China) by sequential extraction with
ethanol and ethyl acetate, as previously described (5,20).
Triptolide was isolated from the EA extract using silica gel
chromatography followed by preparative high-performance
liquid chromatography with a Nova-Pak C-18 column (Waters,
Milford, MA), and was identified by ultraviolet and infrared
Figure 1. Diagram of administration of ethyl acetate (EA) extract to
mice. Eighteen mice were randomly divided into 3 groups of 6 each.
The mice were immunized with trinitrophenyl–bovine serum albumin
(TNP-BSA) mixed with Freund’s complete adjuvant (CFA; 50 ␮g/0.1
ml/mouse) on day 0. The mice were treated orally with vehicle or 98
mg/kg or 196 mg/kg of the EA extract of Tripterygium wilfordii Hook F
by gavage daily for 6 days starting on day 14. The animals received a
peritoneal booster injection with TNP-BSA mixed with CFA on the
last day of treatment (day 19), were killed by an overdose of metofane
24 hours later, and peritoneal exudates were harvested.
spectroscopy, proton nuclear magnetic resonance spectroscopy, and mass spectroscopy (21). The triptolide content of the
EA extract was identified and quantitated by highperformance liquid chromatography, as previously described
(20), and was found to be 1.08 ng per mg of the EA extract. For
in vivo treatment, the EA extract was dissolved in a solution of
ethanol, Tween 20, and water (1:1:8). For in vitro study, the
EA extract, triptolide, and dexamethasone (Sigma, St. Louis,
MO) were first dissolved in a designated volume of ethanol.
The stock solutions were further diluted to the indicated
concentration with culture medium or phosphate buffered
saline (PBS).
As shown in Figure 1, male C57BL/6J mice were
divided into 3 groups with 6 mice in each group.
Trinitrophenyl–bovine serum albumin (TNP-BSA) (50 ␮g)
emulsified in 0.1 ml of Freund’s complete adjuvant (CFA) (22)
was administered to each mouse on day 0. Animals were
treated by daily gavage for 6 days with vehicle only (98 mg/kg
daily) or the EA extract (196 mg/kg daily), beginning on day 14.
These doses were equivalent to one-eighth and one-fourth of
the dose that caused death in 50% of animals after a single oral
administration of the EA extract of TWHF (LD50). The
animals received a booster of TNP-BSA by peritoneal injection
on the last day of treatment (day 19). The animals exhibited no
signs of distress after receiving vehicle or the EA extract of
TWHF, as manifested by weight loss, ruffled fur, anorexia, or
diarrhea.
Cell sources and cell culture. Four sources of cells
were used: 1) peritoneal macrophages prepared from the
C57BL/6J mice that had been immunized with TNP-BSA (50
␮g/0.1 ml/animal) 2 weeks before and treated orally for 6 days
with vehicle or the EA extract of TWHF at a daily dose of
one-eighth the LD50 or one-fourth the LD50, 2) peritoneal
macrophages from normal C57BL/6J mice, prepared 4 days
after intraperitoneal injection with 1.5 ml of 3% thioglycollate,
3) murine macrophage cell line RAW 264.7 cells, and 4)
NIH3T3 cells. The exudate cells were collected and incubated
on glass petri dishes for 3 hours. The macrophages were
harvested and counted after the nonadherent cells were removed by washing 3 times with RPMI 1640. Both of the cell
lines were obtained from American Type Culture Collection
(Rockville, MD).
TRIPTOLIDE AND NITRIC OXIDE SYNTHASE TRANSCRIPTION
All peritoneal macrophages and RAW 264.7 cells were
cultured in RPMI 1640 supplemented with penicillin (100
units/ml), streptomycin (100 ␮g/ml), L-glutamine (0.3 mg/ml),
and 10% fetal bovine serum (FBS). For NO production and
RNA extraction, cells were cultured in complete RPMI 1640
with or without stimulation as indicated and in the absence or
presence of the indicated concentrations of inhibitors for the
indicated periods. NIH3T3 cells were cultured in Iscove’s
modified Dulbecco’s medium (IMDM) supplemented with
penicillin (100 units/ml), streptomycin (100 ␮ g/ml),
L-glutamine (0.3 mg/ml), and 10% FBS. On the day before the
experiments, NIH3T3 cells were cultured in IMDM and 1%
FBS.
Assay of NO. NO production was evaluated by measuring the nitrite content in culture supernatants. Nitrite
content in duplicate diluted samples was measured by adding
100 ␮l of freshly prepared Griess reagent (equal volumes 0.2%
naphthylethylenediamine and 2% sulfanilamide in 5% phosphoric acid) to 100 ␮l of the samples in 96-well plates and
reading the optical density (OD) at 540 nm (23). The concentration of nitrite was determined by comparison with the OD
curves of serial dilutions of sodium nitrite.
RNA preparation and iNOS mRNA assay. Total RNA
was extracted from mitogen-stimulated cells, as previously
described (7,8). Briefly, after the culture supernatants were
removed, total RNA was extracted from the remaining cells
with guanidinium thiocyanate–phenol–chloroform (Ultraspec;
Biotecx, Houston, TX). Then iNOS mRNA was measured by
reverse transcriptase–polymerase chain reaction (RT-PCR), as
previously described (7). Briefly, mRNA was transcribed into
complementary DNA (cDNA) using the GeneAmp RNA PCR
kit (Perkin-Elmer, Branchburg, NJ) (7). First-strand cDNA
was reverse-transcribed from 1 ␮g total RNA using an oligo(dT)16 primer and murine leukemia virus RT at 42°C for 15
minutes. The reaction was stopped by heating to 99°C for 5
minutes, followed by cooling to 5°C for 5 minutes. Then 10 ␮l
of the synthesized cDNA from each sample was used in a 50-␮l
PCR amplification with 2.5 units/100 ml AmpliTaq DNA
polymerase and specific primers for mouse iNOS or ␤-actin.
Amplification of cDNA sequences was carried out in a PTC100 96V programmable thermal controller (MJ Research,
Waltham, MA). The primers used were as follows: for mouse
iNOS, sense 5⬘-TTTGTGCGAAGTGTCAGTGGC-3⬘ and antisense 3⬘-TGCCCTTTTTTGCCCCATAGG-5⬘; for ␤-actin,
sense 5⬘-GTGGGCCGCTCTAGGCACCAA-3⬘ and antisense
3⬘-CTCTTTGAGTCACGCACGACTTC-5⬘, designed using
the GeneWorks program. The amplification consisted of an
initial step at 95°C for 2 minutes, denaturation at 95°C for 1
minute, annealing-extension at 60°C for 1 minute, and extension at 72°C for 7 minutes.
PCR product (10 ␮g) from each sample was separated
by electrophoresis on a 1.2% agarose gel containing ethidium
bromide and visualized by ultraviolet-induced fluorescence.
The gel was denatured, and the PCR product was transferred
onto a nylon membrane. The membranes were prehybridized
in hybridization solution for 45 minutes, followed by hybridization with a ␥32P-labeled iNOS probe (CTACGTTCAGGACATCCTGA) or a ␤-actin probe (CCCAGATCATCATGTTTGAGACCTTCAACACCC) for 45 minutes. The membranes
were washed and then exposed to x-ray film (Eastman Kodak,
Rochester, NY). Signal intensity was quantitated by densitom-
2997
etry using an image analyzer (AMBIS Systems, San Diego,
CA). Signal intensity of the specific mRNA was normalized by
comparison with that of ␤-actin mRNA and expressed as the
ratio of the specific mRNA to the corresponding ␤-actin
mRNA.
Transient transfection of iNOS promoter reporter
constructs into NIH3T3 cells. The day before transfection, 5 ⫻
105 NIH3T3 cells in 5 ml of IMDM with 1% FBS were seeded
in 6-well plates (24). After the cells grew to ⬃80% confluence,
they were washed with serum-free medium. Four micrograms
of a human iNOS, promoter construct linked to luciferase
cDNA (pGL3-iNOS, kindly provided by Dr. Arnold S. Kristof,
NHLBI, NIH, Bethesda, MD) (25) and 2 ␮g of pSV-␤galactosidase (Clontech, Palo Alto, CA) were suspended in 50
␮l of medium without serum for a few seconds, and 20 ␮l of the
superfect transfection reagent (Qiagen, Chatsworth, CA) was
added and mixed to allow complex formation. Ten minutes
later, the complexes were diluted with 0.6 ml of IMDM
containing 10% FBS and transferred to the cells in the 6-well
plate. The cells were then incubated for 3 hours at 37°C. After
the medium containing the complexes was removed, the
transfected cells were cultured with or without LPS (5 ␮g/ml)
plus phorbol 12-myristate 13-acetate (PMA; 10 ng/ml) and in
the absence or presence of the indicated concentrations of
inhibitors for 24 hours. Lysates in each sample were obtained
by 3 cycles of freeze-thawing. Luciferase and ␤-galactosidase
activity from the cell extracts were assayed by the chemiluminescence method according to the instructions of the manufacturer (Promega, Madison, WI). The iNOS gene promoter
activity was quantitated by luciferase/␤-galactosidase activity.
Electrophoretic mobility shift assay (EMSA). Oct-1
binding activity was measured by EMSA, as previously described (26). NIH3T3 cells were grown to 80% confluence,
then seeded at a density of 4 ⫻ 106 cells in a culture flask
containing 30 ml of IMDM with 1% FBS and incubated
overnight. After stimulation with or without LPS (5 ␮g/ml)
plus PMA (10 ng/ml) and in the absence or presence of the
indicated concentrations of inhibitors for 3 hours, the cells
were washed twice with prechilled PBS, harvested by scraping,
and nuclear protein extracts were prepared using a nuclear
extract kit (Active Motif, Carlsbad, CA). Briefly, the cells were
pelleted and the membranes were dissolved with lysis buffer
containing Nonidet P40. The cytoplasmic fraction was then
removed, nuclei were further lysed, and nuclear proteins were
harvested. After the protein concentration of nuclear extract
was measured by an assay based on the Bradford method (27),
the nuclear extract was examined for binding activity by EMSA.
A double-stranded oligonucleotide probe prepared
to match the human Oct-1 binding site (forward 5⬘TGTCGAATGCAAATCACTAGAA-3⬘, complement 3⬘ACAGCTTACGTTTAGTGATCTT-5⬘) was labeled with T4
kinase and ␥32P-ATP and purified with a G-25 spin column.
Nuclear extract (10 ␮g) was then incubated with gel shift
loading buffer (Promega) at room temperature for 10 minutes,
and 32P-labeled Oct-1 consensus oligonucleotide was added,
incubated at room temperature for another 20 minutes, and
subjected to 5% polyacrylamide gel electrophoresis at 190V
for 90 minutes. To examine the specificity of the Oct-1 binding
protein, the gel shift was performed in parallel in the presence
of a 100-fold excess of unlabeled wild-type Oct-1 or mutant
Oct-1 oligonucleotide as competitors. The gel was then dried
2998
WANG ET AL
Figure 2. Effects of in vivo treatment with the ethyl acetate (EA)
extract of Tripterygium wilfordii Hook F on nitrite production by
murine peritoneal macrophages. C57BL/6J mice (n ⫽ 18) were
immunized with 50 ␮g of trinitrophenyl–bovine serum albumin (TNPBSA) emulsified in 0.1 ml of Freund’s complete adjuvant (CFA). Mice
were treated orally with vehicle or with the EA extract at a daily dose
of 98 mg/kg (one-eighth of the dose that is lethal for 50% of the
animals [LD50]) or 196 mg/kg (one-fourth of the LD50) for 6 days. The
animals were challenged with TNP-BSA in CFA intraperitoneally on
the last day of treatment, killed the next day, and peritoneal exudate
cells were collected. After the nonadherent cells were removed to petri
dishes, the macrophages were harvested and counted. Macrophages
(2 ⫻ 106 cells/ml) were incubated for 24 hours. Cell-free supernatants
were collected for determination of nitric oxide (NO) content with the
Griess reagent. Results are the mean and SEM from 6 mice in each
group. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01, versus the vehicle-treated group.
and exposed to x-ray film overnight at ⫺70°C. The binding
band was quantitated by densitometry.
Immunoblot analysis. Nuclear extracts of NIH3T3
cells were prepared, and the protein concentration of the
extracts was determined by an assay based on the Bradford
method. The extracts (20 ␮g) were fractionated by sodium
dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. Oct-1 was
detected using rabbit polyclonal IgG primary antibody (Santa
Cruz Biotechnology, Santa Cruz, CA) at a 1:200 dilution for 2
hours at room temperature. After extensive washing, a horseradish peroxidase–conjugated goat anti-rabbit second antibody
at a 1:2,000 dilution was applied for 1 hour at room temperature. The blot was washed and exposed to x-ray film with
enhanced chemiluminescence (Pierce, Rockford, IL). Immunoblotting of actin was also performed on the same membrane
after stripping.
Statistical analysis. Student’s t-test was used to evaluate the significance of the differences between groups.
RESULTS
Effects of in vivo treatment with the EA extract of
TWHF on NO production and iNOS mRNA expression
in murine peritoneal macrophages. The effect of the EA
extract of TWHF on in vivo NO production was first
examined using peritoneal macrophages obtained from
C57BL/6J mice that were immunized with TNP-BSA in
CFA (Figure 1). The nitrite that accumulated in the
culture supernatant of macrophages stimulated in vivo
was used as an index for NO synthesis by these cells.
Both doses of the EA extract administered orally to the
animals significantly suppressed NO production by the
activated peritoneal macrophages assessed immediately
ex vivo (Figure 2). NO production was inhibited by
47.7% or 79% by dosing with one-eighth the LD50 or
one-fourth the LD50 of the EA extract, respectively.
To examine the mechanism of the inhibition of
NO production by the EA extract in vivo, the effect of
the EA extract on iNOS mRNA expression was examined in the cells from the treated animals. As shown in
Figure 3 (upper panel), both doses of the EA extract
significantly reduced iNOS mRNA expression in the
peritoneal macrophages. Treatment with one-eighth the
LD50 or one-fourth the LD50 of the EA extract reduced
relative iNOS mRNA levels, quantitated by densitometry and expressed as iNOS/␤-actin ratios, by 40.2% and
61.9%, respectively (lower panel). The results suggest
that in vivo treatment with the EA extract inhibits
Figure 3. Effect of in vivo treatment with ethyl acetate (EA) extract of
Tripterygium wilfordii Hook F on inducible nitric oxide synthase
(iNOS) mRNA expression by murine peritoneal macrophages. Macrophages were collected and incubated as described in Figure 2. After
supernatants were removed, the cells were extracted for assay of iNOS
mRNA by reverse transcriptase–polymerase chain reaction. Top, Representative autoradiography showing the expression of iNOS mRNA
and ␤-actin mRNA from individual animals. A normal mouse with no
treatment and no stimulation (Nil) was used as a negative control.
Bottom, Relative iNOS mRNA levels quantitated by densitometry and
expressed as iNOS/␤-actin optical density ratios. Results are the mean
and SEM from 6 mice in each group. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01,
versus vehicle-treated group. LD50 ⫽ median lethal dose.
TRIPTOLIDE AND NITRIC OXIDE SYNTHASE TRANSCRIPTION
Figure 4. Effects of the ethyl acetate (EA) extract of Tripterygium
wilfordii Hook F (TWHF), triptolide (Tript), and dexamethasone
(Dex) in vitro on nitric oxide (NO) production by murine peritoneal
macrophages. Macrophages were collected from the peritoneal cavity
of C57BL/6J mice 4 days after intraperitoneal injection of 2.5 ml of 3%
thioglycollate. Macrophages (2 ⫻ 106 cells/ml) were prepared and
incubated for 24 hours with or without lipopolysaccharide (LPS; 2
␮g/ml) in the presence or absence of the indicated concentrations of
the EA extract of TWHF, Tript, or Dex. Cell-free supernatants were
collected for determination of NO content with the Griess reagent.
Results are the mean and SEM from 4 separate experiments with cells
from different mice. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01, versus LPS control.
up-regulation of iNOS mRNA, which results in decreased NO production.
In vitro effects of triptolide and the EA extract of
TWHF on NO production and iNOS mRNA expression
in activated macrophages. The effects of triptolide and
the EA extract on NO production and iNOS mRNA
expression were examined in vitro using thioglycollateelicited peritoneal macrophages. Since dexamethasone
suppresses NO production and iNOS mRNA expression
(28–30), we used it as a positive control. As shown in
Figures 4 and 5, triptolide, the EA extract, and dexamethasone suppressed NO production and iNOS
mRNA expression in a concentration-dependent manner. Similar effects on NO production and iNOS mRNA
expression were observed in the LPS-stimulated murine
macrophage cell line RAW 264.7 (data not shown). The
dose-response characteristics were similar to those
noted with peritoneal macrophages. Importantly, neither the EA extract nor triptolide affected cell viability,
assessed by trypan blue exclusion assay (data not
shown), indicating that inhibition of NO synthesis is not
simply related to a cytotoxic effect. Since inhibition of
iNOS mRNA paralleled the decrease in NO accumulation, the results suggest that triptolide and the EA
extract inhibited NO production by reducing iNOS
mRNA expression.
Effects of triptolide on iNOS promoter activity
and induction of Oct-1 binding activity. To determine
whether the EA extract or triptolide inhibited transcrip-
2999
tion of iNOS, a promoter construct in which luciferase
was driven by 8.3 kb of the human iNOS promoter was
transfected into NIH3T3 cells, and pSV-␤-galactosidase
was cotransfected as a control. LPS and PMA induced
iNOS promoter activity, as shown in Figure 6. Dexamethasone (5 ␮M) markedly inhibited iNOS promoter
activity induced by LPS and PMA. The EA extract at
concentrations of 8 ␮g/ml inhibited luciferase activity by
up to 70% of the control response. Similarly, triptolide
(11–44 nM) suppressed the enhanced iNOS promoter
activity in a concentration-dependent manner. The degree of inhibition by the EA extract of TWHF and
triptolide was comparable with that noted with 5 ␮M
dexamethasone.
Since Oct-1 is one of the transcription factors that
may regulate iNOS transcription (31–33), the effect of
triptolide on Oct-1 binding activity induced by LPS and
PMA was analyzed by EMSA. As shown in Figure 7A,
stimulation of NIH3T3 cells with LPS and PMA induced
Oct-1 binding activity. Specificity was confirmed by
competition with an excess molar concentration of wildtype Oct-1 or mutant Oct-1 oligonucleotide. Notably,
triptolide (11–44 nM) or dexamethasone (1–10 ␮M)
significantly inhibited Oct-1 binding activity induced by
the combination of LPS and PMA. However, the addi-
Figure 5. Effect of the EA extract of TWHF, Tript, and Dex in vitro
on inducible nitric oxide synthase (iNOS) mRNA expression by murine
peritoneal macrophages. Macrophages were prepared and cultured as
described in Figure 4. After the supernatants were removed, the cells
were extracted for assay of iNOS mRNA by reverse transcriptase–
polymerase chain reaction. Results are from 1 of 4 separate experiments with similar results, using cells from individual animals. Top,
Representative autoradiography showing iNOS and ␤-actin mRNA.
Bottom, Relative iNOS mRNA levels quantitated by densitometry and
expressed as iNOS/␤-actin optical density ratios. Data are from the
same experiment as in the upper panel. See Figure 4 for other
definitions.
3000
WANG ET AL
results suggest that triptolide inhibited the up-regulation
of Oct-1 binding activity induced by LPS and PMA.
Moreover, immunoblotting showed that triptolide did
not reduce the total amount of Oct-1 protein in the
nucleus (Figure 8). These results indicate that triptolide
inhibited the induction of Oct-1 binding activity that is
required for the induction of iNOS transcription.
DISCUSSION
Figure 6. Effects of the EA extract of TWHF, Tript, and Dex on
human inducible nitric oxide synthase (iNOS) promoter activity in
NIH3T3 cells. The pGL3-iNOS driving the luciferase gene and the
pSV-␤-galactosidase plasmid were cotransfected into NIH3T3 cells.
Transfected cells were cultured for 24 hours with or without LPS (5
␮g/ml) plus phorbol 12-myristate 13-acetate (PMA; 10 ng/ml) and in
the absence or presence of inhibitors at the indicated concentrations.
Luciferase and ␤-galactosidase activity from the cell extracts was
assayed by the chemiluminescence method. All iNOS gene promoter
activity was quantitated by luciferase/␤-galactosidase activity. Results
are the mean and SEM of 4 experiments. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01,
versus LPS ⫹ PMA control. See Figure 4 for other definitions.
tion of either triptolide or dexamethasone directly to the
reaction mixture of Oct-1 oligonucleotides and the nuclear extract obtained from the LPS- and PMAstimulated cells did not influence the binding capacity of
Oct-1 protein to its oligonucleotide (Figure 7B). These
The EA extract of TWHF has a potent antiinflammatory and immunosuppressive effect and has been
used successfully for the treatment of rheumatic diseases. RA is a chronic autoimmune inflammatory disease characterized by persistent synovitis. There is a
considerable body of evidence suggesting that NO is
involved in the pathogenesis of a variety of inflammatory
diseases, including RA (12–18), juvenile RA (33), ankylosing spondylitis (34), and inflammatory arthritis (15).
One possibility, therefore, to explain the therapeutic
effect of the EA extract on RA could relate to its ability
to inhibit NO production. Consistent with this possibility, treatment of rats with the EA extract at doses
equivalent to one-fifth to one-eighth of its LD50 was
previously shown to suppress NO production by lining
cells in the carrageenan-stimulated air pouch model of
inflammation (8) and to inhibit the levels of urinary
nitrite in rats with inflammatory arthritis (21). In these
experiments, a decrease in NO generation was corre-
Figure 7. Effects of Tript and Dex on Oct-1 activity. A, NIH3T3 cells were cultured for 3 hours with or without LPS (5 ␮g/ml) and phorbol
12-myristate 13-acetate (PMA; 10 ng/ml) and in the absence or presence of inhibitors at the indicated concentrations. Nuclear extracts in
each sample (10 ␮g) were then prepared, and electrophoretic mobility shift assays (EMSAs) were performed as described in Materials and
Methods. Left, Representative autoradiography showing Oct-1 binding. Right, Oct-1 bands quantitated by densitometry. Results are from
1 of 2 separate experiments with similar results. B, NIH3T3 cells were cultured for 3 hours with LPS (5 ␮g/ml) and PMA (10 ng/ml). Nuclear
extracts from the cells (10 ␮g) were then incubated with gel shift loading buffer in the absence or presence of inhibitors at the indicated
concentrations at room temperature for 10 minutes, and 32P-labeled Oct-1 consensus oligonucleotide was added and incubated at room
temperature for another 20 minutes, and EMSAs were then performed. The bands were quantitated by densitometry. Left, Representative
autoradiography showing Oct-1 binding. Right, Oct-1 bands quantitated by densitometry. Results are from 1 of 2 separate experiments with
similar results. N ⫽ negative control (without nuclear extract); C ⫽ 100-fold excess of unlabeled Oct-1 oligonucleotide; M ⫽ 100-fold excess
of unlabeled mutant Oct-1 oligonucleotide. See Figure 4 for other definitions.
TRIPTOLIDE AND NITRIC OXIDE SYNTHASE TRANSCRIPTION
Figure 8. Results of Oct-1 nuclear protein immunoblotting. Top,
NIH3T3 cells were cultured for 3 hours with or without LPS (5 ␮g/ml)
and phorbol 12-myristate 13-acetate (PMA; 10 ng/ml) and in the
absence or presence of Tript or Dex at the indicated concentrations.
Nuclear extracts (20 ␮g) were prepared and separated on 10% sodium
dodecyl sulfate–polyacrylamide gels, followed by immunoblot analysis
using the specific antibodies against Oct-1. Immunoblotting of actin
was also performed on the same membrane after stripping. Bottom,
Oct-1 bands quantitated by densitometry normalized by the intensity
of actin, as described in Materials and Methods. Results are the mean
and SEM of the ratio of Oct-1/actin from 3 separate experiments, all
with similar results. See Figure 4 for other definitions.
lated with reduced inflammation. However, the mechanism by which the EA extract inhibited NO production
in these models was not delineated. The current data
indicate that this is likely to result from a direct inhibitory effect on iNOS transcription.
In the first experiments, the effect of the EA
extract of TWHF on NO production in vivo was assessed
using a model in which NO production by macrophages
depends on activation of Th1 cells secreting interferon-␥
(IFN␥) (35,36). Although treatment with the EA extract
significantly inhibited macrophage NO production in
this model, it was possible that the effect was indirectly
mediated through suppression of T cell activation. In
this regard, the EA extract and triptolide are known to
inhibit T cell activation as well as the production of
IFN␥ by T cells (5). In vitro experiments with elicited
and directly stimulated macrophages and with a macrophage cell line were therefore carried out to document
that the EA extract and triptolide could directly inhibit
NO production by macrophages. Previously, we had
found that the maximum blood concentration of triptolide in rats was 45–60 ng/ml after a single oral administration equivalent to one-fifth of the LD50 of the EA
extract (data not shown). This range is similar to the
3001
concentration of triptolide found to inhibit in vitro NO
production by the murine cell lines used in the current
study. In RA patients, this range of triptolide concentrations may be reached since they are treated with
multiple administrations (3 times per day) of the EA
extract. A detailed analysis of the pharmacokinetics of
triptolide that is currently in progress should provide
necessary information to confirm this. The results of the
in vitro experiments are consistent with the in vivo
findings that treatment with the EA extract inhibited
production of NO in models of nonimmune inflammation (8), and suggest that the EA extract may be a
potential therapeutic inhibitor of NO synthesis in various pathologic conditions.
In the current study, murine macrophages were
used to analyze the impact of the EA extract and
triptolide on NO production, because human monocytes
do not generate significant amounts of NO (data not
shown). However, to delineate the inhibitory effect of
the EA extract on NO production in detail, we assessed
the effect of triptolide on the mitogen-induced activation of the human iNOS promoter. We reasoned that
this might be the more relevant analysis to understand
the potential actions of this agent in human patients.
Some differences in human and murine iNOS promoter
regulation have been reported. Chu and colleagues
reported that the cytokine-response elements of the
human iNOS promoter that contain 2 matched activator
protein 1 (AP-1) sites are not present in the murine
iNOS promoter region (37). However, the human iNOS
promoter is active in murine cell lines in response to
stimulation (38). The data indicate that triptolide inhibited human iNOS promoter activity. This paralleled the
decrease in iNOS mRNA expression and NO production
observed both in vivo and in vitro.
Sequence analysis has indicated that there are
many binding sites for transcription factors, including
NF-␬B, AP-1, and Oct-1, in the human and mouse iNOS
promoters (39–41). Previously, it has been reported that
triptolide inhibits T cell interleukin-2 (IL-2) expression
by reducing NF-␬B–mediated transcriptional activation
(42). We have also found that triptolide inhibited the
transcriptional activities not only of NF-␬B and the
nuclear factor of activated T cells (NF-AT), but also of
AP-1 (data not shown). Therefore, it was possible that
inhibition of NF-␬B, NF-AT, or AP-1 could play a role
in suppressing iNOS transcription. It has been reported
that mutation of the Oct-1 binding motif in the murine
iNOS promoter completely inhibited iNOS transcription
in BNL CL2 cells, whereas alteration of other binding
sites had no effect on the promoter activity (27,31).
3002
However, the role of Oct-1 in regulating the human
iNOS promoter has not been analyzed in detail, and
therefore the importance of Oct-1 nuclear binding in the
regulation of human iNOS activity is unknown. Notably,
however, comparison of murine and human iNOS promoters showed that the Oct-1 sequences are identical in
the 2 species (38). Therefore, it is possible that regulation of the human iNOS promoter may be similar to that
of the murine iNOS promoter, but this requires confirmation. Importantly, the current data show that elevated
Oct-1 nuclear binding is correlated with increases in
iNOS gene expression, suggesting that Oct-1 may play a
role in human iNOS transcription. It is important to
emphasize that no previous studies have examined the
effects of triptolide on the activation of the Oct-1
transcription factor.
Our results showed that triptolide significantly
inhibited the Oct-1 binding activity induced by the
combination of LPS and PMA. Triptolide had no influence on the reaction of Oct-1 oligonucleotide with the
nuclear extract from the cells induced by LPS and PMA
in the absence of the inhibitor. These results suggest that
triptolide inhibits the up-regulation of Oct-1 binding
activity induced by LPS and PMA. The Oct-1 binding
activity is regulated by protein modification such as
phosphorylation or S-nitrosylation (31,43). Our results
show that triptolide did not reduce the abundance of
Oct-1 protein in the nuclear extract, suggesting that it
inhibited Oct-1 binding activity induced by LPS and
PMA by blocking Oct-1 protein modification. Taken
together, the current results clearly show that triptolide
inhibits the up-regulation of Oct-1 binding activity,
which could account for the inhibition of iNOS transcription.
NO synthesized by iNOS is known to be an
important mediator of inflammation. An increase in NO
production has been noted in patients with RA. Moreover, NO directly combines with the superoxide anion to
form peroxynitrite. In addition, NO induces the production of cytokines, including IL-1 and tumor necrosis
factor, and inflammatory products of the cyclooxygenase
pathway in vitro, suggesting that it might mediate inflammation and joint destruction in RA (12–17). The
present results indicate that the EA extract and triptolide inhibit NO production and iNOS mRNA expression
in vivo and in vitro. Triptolide inhibition of iNOS
promoter activity may result from suppression of upregulation of Oct-1 binding activity, although an effect
of triptolide on other transcription factors involved in
regulation of iNOS expression is also possible. These
data therefore suggest that the EA extract may exert its
WANG ET AL
beneficial effect in RA by its ability to inhibit NO
production by reducing iNOS transcription.
ACKNOWLEDGMENT
We thank Dr. Arnold S. Krist of the National Heart,
Lung, and Blood Institute, NIH, for providing the Luciferase/
iNOS promoter plasmid DNA.
REFERENCES
1. Lipsky PE, Tao XL. A potential new treatment for rheumatoid
arthritis: thunder god vine. Semin Arthritis Rheum 1997;26:
713–23.
2. Tao XL, Lipsky PE. The Chinese anti-inflammatory and immunosuppressive herbal remedy Tripterygium wilfordii Hook F. Rheum
Dis Clin North Am 2000;26:29–50.
3. Tao X, Cush JJ, Garret M, Lipsky PE. A phase I study of ethyl
acetate extract of the Chinese antirheumatic herb Tripterygium
wilfordii Hook F in rheumatoid arthritis. J Rheumatol 2001;28:
2160–7.
4. Tao X, Younger J, Fan FZ, Wang B, Lipsky PE. Benefit of an
extract of Tripterygium wilfordii Hook F in patients with rheumatoid arthritis: a double-blind, placebo-controlled study. Arthritis
Rheum 2002;46:1735–43.
5. Tao X, Davis LS, Lipsky PE. Effects of an extract of the Chinese
herbal remedy Tripterygium wilfordii Hook F on human immune
responsiveness. Arthritis Rheum 1991;34:1274–81.
6. Tao X, Cai JJ, Lipsky PE. The identity of immunosuppressive
components of the ethyl acetate extract and chloroform methanol
extract (T2) of Tripterygium wilfordii Hook F. J Pharmacol Exp
Ther 1995;272:1305–12.
7. Tao X, Schulze-Koops H, Ma L, Cai J, Mao Y, Lipsky PE. Effects
of Tripterygium wilfordii Hook F extracts on induction of cyclooxygenase 2 activity and prostaglandin E2 production. Arthritis
Rheum 1998;41:130–8.
8. Tao X, Ma L, Mao Y, Lipsky PE. Suppression of carrageenaninduced inflammation in vivo by an extract of the Chinese herbal
remedy Tripterygium wilfordii Hook F. Inflamm Res 1999;48:
139–48.
9. Moncada S, Palmer RM, Higgs EA. Nitric oxide: physiology,
pathophysiology, and pharmacology. Pharmacol Rev 1991;43:
109–42.
10. Stefanovic-Racic M, Stadler J, Evans CH. Nitric oxide and arthritis. Arthritis Rheum 1993;36:1036–44.
11. Jang D, Murrell GA. Nitric oxide in arthritis. Free Radic Biol Med
1998;24:1511–9.
12. Farrell AJ, Blake DR, Palmer RM, Moncada S. Increased concentrations of nitrite in synovial fluid and serum samples suggest
increased nitric oxide in rheumatic diseases. Ann Rheum Dis
1992;51:1219–22.
13. Ueki Y, Miyake S, Tominaga Y, Eguchi K. Increased nitric oxide
levels in patients with rheumatoid arthritis. J Rheumatol 1996;23:
230–6.
14. Stichtenoth DO, Fauler J, Zeidler H, Frolich JC. Urinary nitrate
excretion is increased in patients with rheumatoid arthritis and
reduced by prednisolone. Ann Rheum Dis 1995;54:820–4.
15. Stichtenoth DO, Frolich JC. Nitric oxide and inflammatory joint
diseases. Br J Rheumatol 1998;37:246–57.
16. Grabowski PS, Wright PK, van’ t Hof RJ, Helfrich MH, Ohshima
H, Ralston SH. Immunolocalization of inducible nitric oxide
synthase in synovium and cartilage in rheumatoid arthritis and
osteoarthritis. Br J Rheumatol 1997;36:651–5.
17. Pham TN, Rahman P, Tobin YM, Khraishi MM, Hamilton SF,
Alderdice C, et al. Elevated serum nitric oxide levels in patients
TRIPTOLIDE AND NITRIC OXIDE SYNTHASE TRANSCRIPTION
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
with inflammatory arthritis associated with co-expression of inducible nitric oxide synthase and protein kinase C-␩ in peripheral
blood monocyte-derived macrophages. J Rheumatol 2003;30:
2529–34.
Yki-Jarvinen H, Bergholm R, Leirisalo-Repo M. Increased inflammatory activity parallels increased basal nitric oxide production
and blunted response to nitric oxide in vivo in rheumatoid arthritis.
Ann Rheum Dis 2003;62:630–4.
Tao X, Ma L, Cai J, Mao Y, Taurog J, Lipsky PE. Treatment with
an ethyl acetate extract of Tripterygium wilfordii Hook F improves
joint inflammation in HLA B27-transgenic rats [abstract]. Arthritis
Rheum 1996;39 Suppl 9:S298.
Cai JJ, Tao XL, Lipsky PE. High performance liquid chromatography determination of triptolide and tripdiolide in acetate extract
of Tripterygium wilfordii Hook F. J Liquid Chromat 1994;17:
4479–87.
Mao YP, Tao XL, Lipsky PE. Analysis of the stability and
degradation products of triptolide. J Pharm Pharmacol 2000;52:
3–12.
Wernersson S, Kleinau S, Heyman B. Immune complex-mediated
enhancement of antibody responses without induction of delayedtype hypersensitivity. Scand J Immunol 2000;52:563–9.
Khair-El-Din T, Sicher SC, Vazquez MA, Chung GW, Stallworth
KA, Kitamura K, et al. Transcription of the murine iNOS gene is
inhibited by docosahexaenoic acid, a major constituent of fetal and
neonatal sera as well as fish oils. J Exp Med 1996;183:1242–6.
Dlaska M, Weiss G. Central role of transcription factor NF-IL6 for
cytokine and iron-mediated regulation of murine inducible nitric
oxide synthase expression. J Immunol 1999;162:6171–7.
Kristof AS, Marks-Konczalik J, Moss J. Mitogen-activated protein
kinases mediate activator protein-1-dependent human inducible
nitric-oxide synthase promoter activation. J Biol Chem 2001;276:
8445–52.
Sawada T, Falk LA, Rao P, Murphy WJ, Pluznik DH. IL-6
induction of protein-DNA complexes via a novel regulatory region
of the inducible nitric oxide synthase gene promoter: role of
octamer binding proteins. J Immunol 1997;158:5267–76.
Von Knethen A, Callsen D, Brune B. NF-␬B and AP-1 activation
by nitric oxide attenuated apoptotic cell death in RAW 264.7
macrophages. Mol Biol Cell 1999;10:361–72.
De Vera ME, Taylor BS, Wang Q, Shapiro RA, Billiar TR, Geller
DA. Dexamethasone suppresses iNOS gene expression by upregulating I-␬B␣ and inhibiting NF-␬B. Am J Physiol 1997;273:
G1290–6.
Matsumura M, Kakishita H, Suzuki M, Banba N, Hattori Y.
Dexamethasone suppresses iNOS gene expression by inhibiting
NF-␬B in vascular smooth muscle cells. Life Sci 2001;69:1067–77.
Subramaniam N, Cairns W, Okret S. Glucocorticoids repress
transcription from a negative glucocorticoid response element
recognized by two homeodomain-containing proteins, Pbx and
Oct-1. J Biol Chem 1998;273:23567–74.
Lee BS, Kim YM, Kang HS, Kim HM, Pyun KH, Choi I. Octamer
3003
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
binding protein-1 is involved in inhibition of inducible nitric oxide
synthase expression by exogenous nitric oxide in murine liver cells.
J Biochem (Tokyo) 2001;129:77–86.
Liu XK, Abernethy DR, Andrawis NS. Nitric oxide inhibits Oct-1
DNA binding activity in cultured vascular smooth muscle cells.
Life Sci 1998;62:739–49.
Beri A, Singh S, Gupta A, Khullar M. Comparison of serum nitric
oxide levels in active juvenile rheumatoid arthritis with those of
patients in remission. Rheumatol Int 2003;Oct 31 [Epub ahead of
print].
Lamarque D, Nhieu JT, Breban M, Bernardeau C, Martin-Garcia
N, Szepes Z, et al. Lymphocytic infiltration and expression of
inducible nitric oxide synthase in human duodenal and colonic
mucosa is a characteristic feature of ankylosing spondylitis.
J Rheumatol 2003;30:2428–36.
Albina JE, Abate JA, Henry WL Jr. Nitric oxide production is
required for murine resident peritoneal macrophages to suppress
mitogen-stimulated T cell proliferation: role of IFN-␥ in the
induction of the nitric oxide-synthesizing pathway. J Immunol
1991;147:144–8.
Marcinkiewicz J, Grabowska A, Chain BM. Is there a role for
nitric oxide in regulation of T cell secretion of IL-2? J Immunol
1996;156:4617–21.
Chu SC, Marks-Konczalik J, Wu HP, Banks TC, Moss J. Analysis
of the cytokine-stimulated human inducible nitric oxide synthase
(iNOS) gene: characterization of differences between human and
mouse iNOS promoters. Biochem Biophys Res Commun 1998;
248:871–8.
Zhang X, Laubach VE, Alley EW, Edwards KA, Sherman PA,
Russell SW, et al. Transcriptional basis for hyporesponsiveness of
the human inducible nitric oxide synthase gene to lipopolysaccharide/interferon-␥. J Leukoc Biol 1996;59:575–85.
Xie QW, Whisnant R, Nathan C. Promoter of the mouse gene
encoding calcium-independent nitric oxide synthase confers inducibility by interferon-␥ and bacterial lipopolysaccharide. J Exp Med
1993;177:1779–84.
Nunokawa Y, Ishida N, Tanaka S. Promoter analysis of human
inducible nitric oxide synthase gene associated with cardiovascular
homeostasis. Biochem Biophys Res Commun 1994;200:802–7.
Lowenstein CJ, Alley EW, Raval P, Snowman AM, Snyder SH,
Russell SW, et al. Macrophage nitric oxide synthase gene: two
upstream regions mediate induction by interferon ␥ and lipopolysaccharide. Proc Natl Acad Sci U S A 1993;90:9730–4.
Qiu D, Zhao G, Aoki Y, Shi L, Uyei A, Nazarian S, et al.
Immunosuppressant PG490 (triptolide) inhibits T-cell interleukin-2 expression at the level of purine-box/nuclear factor of
activated T-cells and NF-␬B transcriptional activation. J Biol
Chem 1999;274:13443–50.
Segil N, Roberts SB, Heintz N. Mitotic phosphorylation of the
Oct-1 homeodomain and regulation of Oct-1 DNA binding activity. Science 1991;254:1814–6.