close

Вход

Забыли?

вход по аккаунту

?

Widespread distribution of knockdown resistance mutations in the bed bug Cimex lectularius HemipteraCimicidae populations in the United States.

код для вставкиСкачать
A r t i c l e
WIDESPREAD DISTRIBUTION OF
KNOCKDOWN RESISTANCE
MUTATIONS IN THE BED BUG,
Cimex lectularius (HEMIPTERA:
CIMICIDAE), POPULATIONS IN THE
UNITED STATES
Fang Zhu, John Wigginton, Alvaro Romero, Ali Moore,
Kimberly Ferguson, Roshan Palli, Michael F. Potter,
Kenneth F. Haynes, and Subba R. Palli
Department of Entomology, College of Agriculture, University
of Kentucky, Lexington, Kentucky
We previously reported high deltamethrin resistance in bed bugs, Cimex
lectularius, collected from multiple areas of the United States (Romero
et al., 2007). Recently, two mutations, the Valine to Leucine mutation
(V419L) and the Leucine to Isoleucine mutation (L925I) in voltagegated sodium channel a-subunit gene, had been identified to be
responsible for knockdown resistance (kdr) to deltamethrin in bed bugs
collected from New York (Yoon et al., 2008). The current study was
undertaken to investigate the distribution of these two kdr mutations in
110 bed bug populations collected in the United States. Out of the 17 bed
bug populations that were assayed for deltamethrin susceptibility, two
resistant populations collected in the Cincinnati area and three
deltamethrin-susceptible lab colonies showed neither of the two reported
mutations (haplotype A). The remaining 12 populations contained
L925I or both V419L and L925I mutations in voltage-gated sodium
channel a-subunit gene (haplotypes B&C). In 93 populations that were
not assayed for deltamethrin susceptibility, 12 contained neither of the
two mutations (haplotype A) and 81 contained L925I or V419L or both
mutations (haplotypes B-D). Thus, 88% of the bed bug populations
collected showed target-site mutations. These data suggest that
Grant sponsors: Bayer Environmental Science; Kentucky Agricultural Experiment Station; Grant number: 10-08-012.
Correspondence to: Subba R. Palli, Department of Entomology, College of Agriculture, University of
Kentucky, Lexington, KY 40546. E-mail: RPALLI@UKY.EDU
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 73, No. 4, 245–257 (2010)
Published online in Wiley InterScience (www.interscience.wiley.com).
& 2010 Wiley Periodicals, Inc. DOI: 10.1002/arch.20355
246
Archives of Insect Biochemistry and Physiology, April 2010
deltamethrin resistance conferred by target-site insensitivity of sodium
channel is widely spread in bed bug populations across the United States.
C 2010 Wiley Periodicals, Inc.
Keywords: pyrethroids; deltamethrin; knockdown resistance (kdr); voltage-gated sodium channel
INTRODUCTION
The bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), has rapidly become a
challenging indoor pest during the last 10 years (Boase, 2001; Doggett et al., 2004;
Potter, 2005). This nocturnal bloodsucking ectoparasite causes itching, anxiety,
sleeplessness, and even iron deficiencies (Venkatachalam and Beldavady, 1962; Hwang
et al., 2005; Pritchard and Hwang, 2009) and is a potential, though unproven, vector of
human pathogens (Jupp and Lyon, 1987; Blow et al., 2001; Goddard and de Shazo,
2009). In addition, bed bugs also can cause social stigma and economic hardship due to
cost of extermination and need to replace infested furniture (Potter, 2006). The
primary approach to control bed bugs has mainly relied on the application of
insecticides. After World War II, usage of dichloro-diphenyl-trichloroethane (DDT) and
other synthetic insecticides greatly decreased bed bug infestations in the United States
and Europe (Boase, 2001). However, during the past 10 years, bed bugs reappeared in
large numbers and became hard to control, partly due to the development of resistance
to currently used pyrethroids (Myamba et al., 2002; Gangloff-Kaufmann et al., 2006;
Moore and Miller, 2006; Karunaratne et al., 2007; Romero et al., 2007).
To effectively manage populations of resurgent bed bugs that are resistant to
pyrethroids, it is necessary to elucidate the mechanisms of pyrethroid resistance in this
insect. The mechanisms involved in pyrethroid resistance are mainly divided into two
groups, increased metabolic detoxification by P450s, glutathione transferases, and
esterases (Feyereisen, 1999, 2005; Vontas et al., 2001; Young et al., 2005), and
decreased target-site sensitivity of voltage-gated sodium channels (Liu et al., 2006;
Dong, 2007). The voltage-gated sodium channel plays a vital role in the generation
and propagation of action potentials in the neurons and is the primary target of
pyrethroids and DDT (Elliott et al., 1978; Goldin, 2003; ffrench-Constant et al., 2004).
Mutations to sodium channels confer pyrethroid resistance by reducing the binding of
pyrethroids to the sodium channel. The most common sodium channel mutation, kdr
mutation (L1014 to F/H/S), has been identified in many insects (Soderlund, 2005). In
addition, nine other amino acid changes were also shown to cause kdr and kdr-type
resistance (Dong, 2007). Recently, two point mutations (V419L and L925I) were
identified from a highly deltamethrin-resistant population of the bed bug (NY-BB)
(Yoon et al., 2008). V419L, a novel mutation, is located in the S6 transmembrane
segment of domain I of the para-type sodium channel gene. The L925I mutation is
located in the intracellular loop between S4 and S5 hydrophobic segments of domain
II of this gene. Both mutations were considered as the major factors for resistance in
NY-BB (Yoon et al., 2008). However, the distribution of these mutations in bed bug
populations across the United States is not known. More than 100 bed bug populations
were collected from 17 states across the United States between 2006 and 2009.
Bioassays were conducted to determine deltamethrin toxicity in 17 populations. The
distribution of two identified mutations in the para-type sodium channel gene was
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
247
investigated in all populations using sequencing and allele specific PCR (ASPCR). The
results showed that the target-site mutations are highly prevalent in the bed bug
populations across the United States and are likely responsible for most cases of
resistance reported for pyrethroids.
MATERIALS AND METHODS
Bed Bug Populations
Two insecticide-susceptible colonies, one collected from Fort Dix, NJ, 430 years ago
(Bartley and Harlan, 1974) and the other collected from Gainesville, FL, 420 years
ago (Romero et al., 2007) were maintained in the laboratory without any insecticide
exposure. Fifteen populations of bed bugs (third- to fifth-instar nymphs) were
collected from human dwellings across the United States (see Table 2). In order to
have enough individuals to perform residual bioassays, some of these populations of
bed bugs were maintained initially in the laboratory by using a parafilm-membrane
feeder. Bed bugs were kept in screened containers and fed with 391C heparinized
chicken blood through a thinly stretched parafilm membrane (Montes et al., 2002).
Bed bugs were reared at 271C, 6575% RH, and a photoperiod of 14:10 (L:D) h.
Additional bed bugs (93 locations) were collected from 17 states across the United
States (see Tables 2 and 3, which show the sampling sites and collection dates for all
populations). Locations were separated by at least 6.1 km. Samples were frozen with
liquid nitrogen and kept in 801C freezer until use.
Residual Bioassays
The resistant status of each of the 17 population was evaluated by confining 20 thirdto fifth-instar nymphs on deltamethrin-treated filter paper. Nymphs were exposed to a
discriminating dose (0.13 mg/cm2) of technical grade (99% active ingredient, Bayer
Environmental Science) deltamethrin. This dose is approximately 30 times the dose
required to kill 100% of a susceptible strain (Romero et al., 2007). Acetone-treated
filter paper that was allowed to dry was used as a control. The mortality was
determined after 24 h of exposure. Each experiment was repeated at least three times.
Gene Cloning and Sequencing
DNA was isolated from three individuals pooled for each population using DNasy kit
(Qiagen, Valencia, CA). Voltage-gated sodium channel a-subunit gene regions that
cover all 12 mutations (Fig. 1) were amplified using genomic DNA of CIN-1 and
primers shown in Table 1. These 12 mutations include 10 mutations that have been
reported causing kdr and kdr-type resistance and two new mutations from the bed bug
[actually V419 (C. lectularius) and V421 (Heliothis virescens) are the same residue].
Fragments that included mutations V419L and L925I were amplified using genomic
DNA of 15 other bed bug populations with known resistant status. The PCR products
were purified using QIAquick PCR Purification Kit (Qiagen) and sequenced at the
Advanced Genomics Technology Center of the University of Kentucky. The sequences
of gene fragments were aligned and compared using Vector NTI Advance 9 software
(Invitrogen, Carlsbad, CA).
Archives of Insect Biochemistry and Physiology
sequencing, ASPCR
ASPCR
sequencing
Cloning,
Cloning,
Cloning,
Cloning
Cloning,
Cloning,
Cloning,
Cloning, ASPCR
Cloning, sequencing
Cloning, sequencing
Sequencing
Cloning, sequencing
Cloning, sequencing
Sequencing
ASPCR
ASPCR
BBParaF1
BBParaR1
BBParaF2
BBParaR2
BBParaF2-1
BBParaR2-1
BBParaF3
BBParaR3
BBParaF4
BBParaR4
BBParaR4-1
BBParaF5
BBParaR5
BBParaR5-1
BBParaF1-AS
BBParaF3-AS
sequencing
sequencing
sequencing, ASPCR
Function
Name
50
50
50
50
50
50
50
50
50
5
50
50
50
50
50
50
0
0
TGCCTATTCTGTCGAAAGCCTCAG 30
GGTATTCAGGCGTTCAAAACTATGAG 30
GAGGAATGTGATTCCTATAGTCG 30
ACTATTTCAAACACAATTGCTTGTGG 30
ATGCATGTCAAGGACAAAAGTGG 30
TCTGATAGCTGGTCGTAACGG 30
ATCCCAACCAGCAGAAGTAGAC 30
ATTCCTGGGATCATTCTACCTCG 30
ATTATGGGCAGAACAGTGGGTGCCC 30
AACCTGGATATACATGCCTTCAAGG 3
TGATGGAGATTTTGCCACTGATG 30
TGCTCAATGATATCATCGAGCAGG 30
AACTTCATGGCAGCTTCAATTCCG 30
GCTAGTTGCATTTATAGTATTTG 30
ACTCATTGCTATCAACTTCATG 30
GGAATTGAAGCTGCCATGAAGTTG 30
Sequence
–
V (1749-1881aa)
IV (1369-1818aa)
L1770P
F1519I
–
M918T, L925I, T929I,
L932F, L1014F/H/S
C764R, M827I
II (729-867aa)
III (870-1117aa)
V419L, V421M, E434K
Mutations checked
I (366-523aa)
Fragment
Table 1. Primers Used for Cloning, Sequencing, and ASPCR
248
Archives of Insect Biochemistry and Physiology, April 2010
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
249
Table 2. Causal Link Between Haplotypes Representing Mutations in Sodium Channel Gene and
Deltamethrin Resistance in 17 Bed Bug Populations
Mutations
Sample no. Sample name Resistant status
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
FD-1a
GA-1a
LA-1a
CIN-1a
CIN-3a
LEX-1a
TRO-1
DOV-1
CIN-2a
FRA-1
TRO-2
KAL-1
WOR-1
SMI-1
NY-1
CIN-5
NY-2
Susceptible
Susceptible
Susceptible
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Resistant
Location
Fort Dix, NJ
Gainesville, FL
Los Angeles, CA
Cincinnati, OH
Cincinnati, OH
Lexington, KY
Troy, MI
Dover, NJ
Cincinnati, OH
Frankfort, KY
Troy, MI
Kalamazoo, MI
Worcester, MA
Smithtown, NY
Plainview, NY
Cincinnati, OH
New York, NY
Date frozen 419 aa 925 aa Haplotype
8/14/2006
8/14/2006
8/14/2006
8/14/2006
8/14/2006
8/14/2006
9/19/2006
10/20/2006
8/14/2006
8/17/2006
8/23/2006
10/17/2006
3/1/2007
5/17/2007
Early 2008
10/17/2008
4/30/2009
V
V
V
V
V
V
V
V
L
L
L
L
L
L
L
L
L
L
L
L
L
L
I
I
I
I
I
I
I
I
I
I
I
I
A
A
A
A
A
B
B
B
C
C
C
C
C
C
C
C
C
a
Resistance status of these populations was reported by Romero et al. (2007). The resistance status of the rest of the
populations was determined following methods described by Romero et al. (2007).
Allele-Specific PCR (ASPCR)
ASPCR was conducted to identify the mutations V419L and L925I in all 110 bed bug
populations. Two rounds of PCR reactions were performed. For the first PCR reaction,
the allele-independent primer pairs, BBParaF1/BBParaR1 and BBParaF3/BBParaR3
(Table 1), were used to generate fragment I and fragment III containing amino acid
V419 and L925, respectively. For fragment I, the first PCR was conducted with 100 ng
DNA template and 0.3 mM of BBParaF1/BBParaR1 primer pair in a 20-ml reaction.
The PCR conditions were 941C for 3 min 50 s, followed by 35 cycles of 941C for 30 s,
601C for 30 s, and 721C for 1 min, finishing with an extension step at 721C for 10 min.
For fragment III, the first PCR was conducted under the same reaction conditions
described for fragment I except that the annealing temperature was 551C and
BBParaF3/BBParaR3 primer pair was used. The second PCRs for fragments I and III
were conducted using 1 ml of a 1,000- and 10,000-fold dilution, respectively, of the
first-round PCR reaction solution, and allele-specific primer pairs, BBParaF1-AS/
BBParaR1 and BBParaF3-AS/BBParaR3 (Table 1). The allele-specific forward
primer was designed based on the specific sequence of voltage-gated sodium channel
a-subunit gene in LA-1 (susceptible strain without mutation) by placing a specific
nucleotide polymorphism at the 30 end of each primer to permit preferential
amplification of the gene allele without mutation. For fragment I, the second PCR was
conducted under the same reaction conditions described for the first PCR except that
25 cycles were used. For fragment III, the second PCR solution was heated to 941C for
3 min 50 s, followed by 35 cycles of 941C for 30 s, 681C for 2 min, finishing with an
extension step at 681C for 10 min. Each experiment was repeated three times with
Archives of Insect Biochemistry and Physiology
250
Archives of Insect Biochemistry and Physiology, April 2010
Figure 1. kdr mutations in insect sodium channels. The open circles represent mutations observed in the
bed bug (C. lectularius). The solid circles represent mutations that have been confirmed to reduce the sodium
channel sensitivity to pyrethroids. The Valine to Methionine mutation (V421M) was identified in Heliothis
virescens; the Glutamic acid to Lysine mutation (E434K) and the Cysteine to Arginine mutation (C764R) were
identified in Blattella germanica; the Methionine to Isoleucine mutation (M827I) is from Pediculus capitis; the
Methionine to Threonine mutation (M918T) is from Musca domestica and Hydrotaea irritans; the Threonine to
Isoleucine/Cysteine/Valine mutation (T929I/C/V) is from Plutella xyllostella, P. capitis, Frankliniella occidentalis,
and Ctenocephalides felis; the Leucine to Phenylalanine mutation (L932F) is from Pediculus capitis; the Leucine
to Phenylalanine/Histidine/Serine mutation (L1014F/H/S) exists in many insects; the Phenylalanine to
Isoleucine mutation (F1519I) is from Boophilus microplus; and the Leucine to Proline mutation (L1770P) is
from Varroa destructor. Please see Dong (2007) for references that report these mutations. Represents
mutations detected from the bed bug. V419 (C. lectularius) and V421 (Heliothis virescens) are the same residue.
Modified from Dong (2007).
independent preparations of DNA (three bed bug individuals for each DNA
preparation). To avoid the situation that any failed reactions will be scored as resistant,
we chose the templates with no PCR product to sequence.
RESULTS AND DISCUSSION
Sequencing of Voltage Gated Sodium Channel a-Subunit Gene Fragments From CIN-1
In previous studies, we reported that bed bugs collected from the Cincinnati, OH, area
(CIN-1) showed very high resistance (412,765-fold) to deltamethrin relative to the
susceptible strain, Fort Dix (FD-1) (Romero et al., 2007). To determine if the mutations
in the voltage-gated sodium channel a-subunit gene are responsible for observed
deltamethrin resistance in CIN-1 population, 14 primers were designed to clone the
fragments I to V that include 12 reported mutations including V419L and L925I,
which had been confirmed to be responsible for sodium channel insensitivity to
pyrethroids in insects (Dong, 2007; Fig. 1; Table 1). No mutations were detected in the
five fragments of CIN-1 voltage-gated sodium channel a-subunit gene, suggesting
mutations in this gene are not responsible for the deltamethrin resistance observed in
the CIN-1 population.
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
251
Determining a Causal Link Between Haplotypes and Deltamethrin Resistance
To identify if there is a causal link between two identified mutations, V419L and L925I
in sodium channel a-subunit gene and deltamethrin resistance in bed bug populations,
residual bioassays and sequencing of sodium channel a-subunit gene fragments
containing amino acids of two identified mutations were performed for 17 bed bug
populations. A discriminating dose (0.13 mg/cm2) of deltamethrin (Romero et al.,
2007) was used to evaluate the resistant status of 17 bed bug populations. Bioassay
results showed that three populations, FD-1, GA-1, and LA-1 (two of which were longmaintained laboratory colonies), are susceptible to deltamethrin. The other 14
populations showed moderate to high resistance to deltamethrin (Table 1). Sequencing
of para gene fragments containing two amino acids for identified mutations showed
that neither of the two mutations is present in the para gene fragments amplified using
the DNA of bed bugs from FD-1, GA-1, and LA-1 populations susceptible to
deltamethrin. In addition, two populations resistant to deltamethrin (CIN-1 and
CIN-3) also showed neither of these two mutations; this group is designated as
Haplotype A. Only L925I mutation but not V419L mutation, is present in three resistant
populations (LEX-1, TRO-1, and DOV-1; designated as Haplotype B). Both V419L and
L925I mutations are identified in nine other resistant populations (Haplotype C).
These results suggest a potential causal link. Haplotypes B (with mutation L925I)
and C (with mutations L925I and V419L) are resistant to deltamethrin. We have not
characterized any populations with only the V419L mutation (Haplotype D). Although
Haplotype A is likely pyrethroid-sensitive, bed bugs possessing this haplotype could
also be resistant by a mechanism that does not involve target site insensitivity. For
example, two populations from the Cincinnati area (CIN-1 and CIN-3) are
Haplotype A, but are nonetheless resistant to deltamethrin. These two populations
showed neither V419L nor L925I mutation in the voltage-gated sodium channel
a-subunit gene. Additionally, CIN-1 contained none of the 12 voltage-gated sodium
channel a-subunit gene mutations shown to be involved in pyrethroid resistance.
Recent studies showed that the inhibitors of P450 reduce deltamethrin resistance in
CIN-1 (Romero et al., 2009). Therefore, we hypothesized that P450-mediated
metabolic detoxification may be a mechanism responsible for deltamethrin resistance
observed in this population. Studies are underway in our laboratory to determine the
mechanism of resistance in CIN-1.
Examining Geographic Distribution of Knockdown Resistance in Bed Bug Populations
We developed ASPCR primers for two mutations, V419L and L925I, identified as
responsible for deltamethrin resistance in the NY-BB population. To determine if the
ASPCR primers developed for these two mutations are reliable to detect mutations in
bed bug populations, we performed ASPCR using the genomic DNA isolated from 17
bed bug populations. Similar to the results observed by sequencing, ASPCR also
detected neither mutation in five populations (Haplotype A; FD-1, GA-1, LA-1, CIN-1
and CIN-3), only L925I but not V419L in three resistant populations (Haplotype B;
LEX-1, TRO-1, and DOV-1), and both V419L and L925I mutations in the other nine
resistant populations (Haplotype C) (Fig. 2). Thus, ASPCR consistently confirmed
results observed by sequencing, suggesting that ASPCR could be used to monitor
resistance in bed bug populations.
The distribution of V419L and L925I mutations in 93 additional bed bug
populations collected from dwellings across the United States was examined by
Archives of Insect Biochemistry and Physiology
252
Archives of Insect Biochemistry and Physiology, April 2010
A
Resistant
S S S R R R R R R R R R R R R R R
status
ladder 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 ladder
1st PCR
1 kb
500 bp
1 kb
500 bp
ASPCR
1 kb
500 bp
B
1 kb
500 bp
Resistant
status
S S S R R R R R R R R R R R R R R
ladder 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 ladder
1st PCR
1 kb
500 bp
1 kb
500 bp
ASPCR
1 kb
500 bp
1 kb
500 bp
Figure 2. 1st PCR and ASPCR results for fragments I (A) and III (B) amplified using DNA isolated from 17
bed bug populations. The 1st PCR fragments were amplified using allele-independent primer pairs,
BBParaF1/BBParaR1 (A) and BBParaF3/BBParaR3 (B). The ASPCR fragments were amplified using allelespecific primer pairs, BBParaF1-AS/BBParaR1 (A) and BBParaF3-AS/BBParaR3 (B). The Arabic numbers
on the top of the gel pictures are the sample numbers as shown in Table 2. The same DNA template was used
for both A and B. S, Susceptible; R, Resistant.
ASPCR. Out of the 93 populations screened by ASPCR, 12 showed neither mutation
(Haplotype A), 42 showed L925I but not V419L mutation (Haplotype B), and 36
showed both mutations (Haplotype C) (Table 3). In addition, in three populations only
V419L but not L925I mutation was detected and designated as Haplotype D. Since
mutation V419L was shown as one of the two mutations present in the deltamethrinresistant NY-BB colony (Yoon et al., 2008), the populations with V419L mutation
(Haplotype D) may be resistant to deltamethrin but we have no bioassay data to
support this hypothesis. Mapping the geographical distribution of two identified
mutations in sodium channel a-subunit gene showed that populations collected from 9
of the 17 states showed 100% resistant bed bug populations (with haplotypes B, C, or
both B and C; Fig. 3). Five other states showed more than 50% populations with
resistance to deltamethrin (haplotypes B, C, and/or D; Fig. 3).
It is interesting that the presence of even a single mutation, L925I, could confer
significant deltamethrin resistance (Table 2). The frequency of a single mutation L925I
(Haplotype B) is 0.43 in 110 populations tested. This is even higher than the frequency
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
253
Table 3. The Distribution of Haplotypes Representing Mutations in Sodium Channel Gene of 93
Bed Bug Populations
Sample
no.
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
Location
Date
frozen
Haplotype
Rockville, MD
Washington, DC
Washington, DC
Washington, DC
Fairfield, OH
Louisville, KY
Fairfax, VA
Los Angeles, CA
Lexington, KY
Pennis, CA
Lexington, KY
Lexington, KY
Dayton, OH
Dayton, OH
Louisville, KY
Louisville, KY
Louisville, KY
Lexington, KY
Beaumont, TX
Lexington, KY
Dayton, OH
Dayton, OH
Dayton, OH
Savannah, GA
Scarborough, ME
Hampton, VA
Indianapolis, IN
Lexington, KY
Little Falls, NJ
Chicago, IL
Louisville, KY
Bayonne, NJ
Lake Hiwatha, NJ
Kalamazoo, MI
Morristown, NJ
Brunswick, ME
Morristown, NJ
Rockland, ME
Richmond, VA
Williamsburg, VA
Crownsville, MD
Jersey City, NJ
Duluth, MN
Southfield, MI
Southfield, MI
Southfield, MI
Southfield, MI
3/7/2006
3/7/2006
3/7/2006
3/7/2006
6/1/2006
6/1/2006
6/1/2006
6/1/2006
8/3/2006
8/4/2006
8/8/2006
8/8/2006
8/15/2006
8/15/2006
8/17/2006
8/17/2006
8/17/2006
8/17/2006
8/23/2006
8/23/2006
8/30/2006
8/30/2006
8/30/2006
8/31/2006
8/31/2006
9/5/2006
9/7/2006
9/19/2006
10/17/2006
10/19/2006
10/20/2006
10/20/2006
10/31/2006
10/31/2006
11/13/2006
11/14/2006
11/14/2006
11/22/2006
11/22/2006
11/22/2006
11/22/2006
11/22/2006
11/22/2006
1/25/2007
1/25/2007
1/25/2007
1/25/2007
A
A
A
A
A
D
A
D
A
A
B
B
C
C
C
B
C
C
B
B
C
C
C
B
B
B
C
B
B
A
C
C
C
C
D
B
A
B
B
B
A
C
B
B
B
B
B
Sample
no.
Location
Date
frozen
Haplotype
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
Southfield, MI
Southfield, MI
Southfield, MI
Troy, MI
Troy, MI
Cincinnati, OH
Kalamazoo, MI
Kalamazoo, MI
Lexington, KY
Lexington, KY
Lexington, KY
Laurel, MD
Laurel, MD
Southfield, MI
Southfield, MI
Southfield, MI
Southfield, MI
Baltimore, MD
Cincinnati, OH
Cincinnati, OH
Lexington, KY
Lynchburg, VA
Cincinnati, OH
Herndon, VA
Cincinnati, OH
Cincinnati, OH
Cincinnati, OH
Cincinnati, OH
Philadelphia, PA
Plainview, NY
Troy, MI
Troy, MI
Troy, MI
Burn Hills, MI
Lynbrook, NY
Upper, NY
Hempstead, NY
Farmingdale, NY
Herndon, VA
Hempstead, NY
Rocketway, NY
Lexington, KY
Lynbrook, NY
Woodsburgh, NY
Hauppauge, NY
Smithtown, NY
1/25/2007
1/25/2007
1/25/2007
1/25/2007
1/25/2007
2/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/1/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
3/19/2007
4/1/2007
4/1/2007
4/1/2007
4/1/2007
4/1/2007
4/1/2007
4/1/2007
4/27/2007
4/30/2007
5/4/2007
5/8/2007
5/14/2007
5/17/2007
5/21/2007
6/6/2007
6/6/2007
6/18/2007
6/18/2007
B
B
B
B
B
C
C
C
B
B
C
B
B
B
B
B
B
C
A
C
C
B
C
B
C
C
C
C
C
C
B
B
B
C
C
B
C
C
B
C
C
B
C
C
B
B
Haplotype A: No mutation at both 419 and 925 aa; B: mutation at 925 aa but no mutation at 419 aa; C: mutations
at both 419 and 925 aa; D: mutation at 419 aa but no mutation at 925 aa.
Archives of Insect Biochemistry and Physiology
254
Archives of Insect Biochemistry and Physiology, April 2010
Figure 3. The geographic distribution of kdr mutations in the bed bug populations collected from the
United States. The pies show the haplotype composition of all population samples in each state. The number
under each pie is the number of populations collected from each state.
(0.41) of Haplotype C containing both mutations. The frequency of occurrence of a
single mutation V419L (haplotype D) is very low (around 0.027). These data support
the important role of L925I mutation in deltamethrin resistance. Even though L925I
mutation is present in two haplotypes (B and C), these two haplotypes have a
somewhat different geographic distribution (Fig. 3). Haplotype C is predominantly
present in the northeastern part of the United States and occurs very infrequently in
the south. In contrast, haplotype B is present in both northern and southern states.
Interestingly, haplotype D is present in very limited regions and co-occurrs with
haplotype A.
Among the 17 states represented, samples collected from only one state (IL) and
District of Columbia showed no mutations in the kdr gene (only single sample per
region was collected). More than half of the states (9 out of 17) showed haplotypes B or
C or both B and C that confer resistance to deltamethrin. These data indicate that
deltamethrin resistance conferred by target-site insensitivity of sodium channel is
widely distributed in the bed bug populations across the United States. It is also
interesting that the predominance of resistance-conferring haplotypes B and C is
higher in the northeastern states than in the southern states.
In the 1940s and 1950s, DDT was commonly used to control bed bug infestations
(Boase, 2001). Subsequently, a high degree of resistance to DDT was reported in many
strains (Johnson and Hill, 1948; Gratz, 1959; Mallis and Miller, 1964; Nagem and
Williams, 1992). Since pyrethroids and chlorinated hydrocarbons share a similar mode
of action, cross-resistance may occur between these two classes of insecticides, and,
therefore, could explain why bed bugs have developed resistance to pyrethroids so
quickly. As the primary target of pyrethroids and DDT, the voltage-gated sodium
channel was subjected to selection since the 1940s when DDT was first introduced
(ffrench-Constant et al., 2004). Therefore, the kdr-mediated resistance mechanism is
well suited for studying the origins of pyrethroid resistance (Anstead et al., 2005). Use
of pyrethroids and pyrethroid-treated bed nets in different parts of the world for
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
255
controlling mosquitoes may have also contributed to pyrethroid resistance in bed bugs
(Myamba et al., 2002). Our study was not designed to look for the point of origin or
introduction of pyrethroid resistance into bed bug populations. However, because at
least three factors (two kdr mutations and one likely P450) are implicated and these are
found in independent samples, it is likely that resistance will have multiple geographic
origins. Further studies with more populations and additional markers are required to
reach a final conclusion on the origins of bed bug resistance in the United States.
In conclusion, the current study is the first effort to investigate the distribution and
extent of kdr mutations in bed bug populations across the United States. In addition,
we established a causal link between haplotypes and deltamethrin resistance in bed
bug populations and analyzed the geographic distribution of these mutations. The
major finding of this report is the discovery that target site–based mutations are
the main reason for reported pyrethroid resistance in bed bug populations from across
the United States. About 88% of the bed bug populations tested showed target-site
mutation(s) and most likely are resistant to deltamethrin. The remaining 12% of
populations may be susceptible to pyrethroids or resistant to them through some other
mechanism such as increased activity of detoxifying enzymes such as P450. Our study
will serve as baseline data to study the origin of pyrethroid-resistant bed bug
populations. In addition, this study has some important practical applications. ASPCR
primers developed in this study can be used for monitoring the target-site mutations in
bed bug populations. This type of monitoring will help in the development of
improved bed bug population management strategies. For example, currently, several
pest-management companies add additives such as piperonyl butoxide to synthetic
pyrethroid formulations to treat resistant populations of bed bugs. If the monitoring
program determines that the population being treated contains target-site mutations
(as we predict based upon data included in this report), then the treatment strategy
should include an insecticide that functions through a target site other than the sodium
channel protein. Thus, the studies reported here will help to conduct resistance
monitoring in bed bug populations leading to improvement in bed bug management
strategies.
ACKNOWLEDGMENTS
We thank Shelby Stamper, for technical support. We thank pest control firms from across
the nation for collecting bed bug samples. Drs. Harold Harlan and Robin Todd provided
us with bed bugs from their long-maintained susceptible strains. This is contribution
number 10-08-012 from the Kentucky Agricultural Experimental Station.
LITERATURE CITED
Anstead JA, Williamson MS, Denholm I. 2005. Evidence for multiple origins of identical
insecticide resistance mutations in the aphid Myzus persicae. Insect Biochem Mol Biol
35:249–256.
Bartley JD, Harlan HJ. 1974. Bed bug infestation: its control and management. p 884–886.
Military Medic November.
Blow JA, Turell MJ, Silverman AL, Walker ED. 2001. Stercorarial shedding and transtadial
transmission of hepatitis B virus by common bed bugs (Hemiptera: Cimicidae). J Med
Entomol 38:94–700.
Boase CJ. 2001. Bedbugs-back from the brink. Pestic Outlook 12:159–162.
Archives of Insect Biochemistry and Physiology
256
Archives of Insect Biochemistry and Physiology, April 2010
Doggett SL, Geary MJ, Russell RC. 2004. The resurgence of bed bugs in Australia: with notes on
their ecology and control. Environ Health 4:30–38.
Dong K. 2007. Insect sodium channels and insecticide resistance. Invert Neurosci 7:17–30.
Elliott M, Janes NF, Potter C. 1978. The future of pyrethroids in insect control. Annu Rev
Entomol 23:443–469.
Feyereisen R. 1999. Insect P450 enzymes. Annu Rev Entomol 44:507–533.
Feyereisen R. 2005. Insect Cytochrome P450. In: Gilbert LI, Iatrou K, Gill SS, editors.
Comprehensive molecular insect science. Oxford: Elsevier. p 1–77.
ffrench-Constant RH, Daborn PJ, Le Goff G. 2004. The genetics and genomics of insecticide
resistance. Trends Genet 20:163–170.
Gangloff-Kaufmann J, Hollingworth C, Hahn J, Hansen L, Kard B, Waldvogel M. 2006. Bed
bugs in America: a pest management industry survey. Am Entomol 52:105–106.
Goddard J, de Shazo R. 2009. Bed bugs (Cimex lectularius) and clinical consequences of their
bites. J Am Med Assoc 301:1358–1366.
Goldin AL. 2003. Mechanisms of sodium channel inactivation. Curr Opin Neurobiol
13:284–290.
Gratz NG. 1959. A survey of bed-bug resistance to insecticide in Israel. Bull WHO 20:835–840.
Hwang SW, Svoboda TJ, De Jong IJ, Kabasele KJ, Gogosis E. 2005. Bed bug infestations in an
urban environment. Emerg Infect Dis 11:533–538.
Johnson MS, Hill AJ. 1948. Partial resistance of a strain of bed bugs to DDT residual. Med
Newslett 12:26–28.
Jupp PG, Lyon SF. 1987. Experimental assessment of bedbugs (Cimex lectularius and Cimex
hemipterus) and mosquitoes (Aedes aegypti Formosus) as vectors of human immunodeficiency
virus. AIDS 1:171–174.
Karunaratne SHPP, Damayanthi BT, Fareena MHJ, Imbuldeniya V, Hemingway J. 2007.
Insecticide resistance in the tropical bedbug Cimex hemipterus. Pest Biochem Physiol
88:102–107.
Liu N, Xu Q, Zhu F, Zhang L. 2006. Pyrethroid resistance in mosquitoes. Insect Sci 13:159–166.
Mallis A, Miller AC. 1964. Prolonged resistance in the house fly and bed bug. J Econ Entomol
57:608–609.
Montes C, Cuadrillero C, Vilella D. 2002. Maintenance of a laboratory colony of Cimex lectularius
(Hemiptera: Cimicidae) using an artificial feeding technique. J Med Entomol 39:675–679.
Moore DJ, Miller DM. 2006. Laboratory evaluations of insecticide product efficacy for control of
Cimex lectularius. J Econ Entomol 99:2080–2086.
Myamba J, Maxwell CA, Asidi A, Curtis CF. 2002. Pyrethroid resistance in tropical bedbugs,
Cimex hemipterus, associated with use of treated bednets. Med Vet Entomol 16:448–451.
Nagem RL, Williams P. 1992. Susceptibility tests of the bedbug, Cimex lectularius L. (Hemiptera:
Cimicidae) to DDT in Belo Horizonte, MG (Brazil). Rev Saude Publica 26:125–128.
Potter MF. 2005. A bed bug state of mind: emerging issues in bed bug management. Pest Control
Technol 33:82–85, 88, 90, 92–93, 96–97.
Potter MF. 2006. The perfect storm: an extension view on bed bugs. Am Entomol 52:102–104.
Pritchard MJ, Hwang SW. 2009. Severe anemia from bedbugs. Can Med Assoc J 181:287–288.
Romero A, Potter MF, Potter DA, Haynes KF. 2007. Insecticide resistance in the bed bug: a factor
in the pest’s sudden resurgence? J Med Entomol 44:175–178.
Romero A, Potter MF, Haynes KF. 2009. Evaluations of piperonyl butoxide as a deltamethrin
synergist for pyrethroid–resistant bed bugs. J Econ Entomol 102:2310–2315.
Soderlund D. 2005. Sodium channels. In: Gilbert LI, Iatrou K, Gill SS, editors. Comprehensive
molecular insect science. Amsterdam: Elsevier B.V. p 1–24.
Archives of Insect Biochemistry and Physiology
Bed Bug Resistance Monitoring
257
Venkatachalam PS, Beldavady B. 1962. Loss of haemoglobin iron due to excessive biting by
bedbugs. Trans R Soc Trop Med Hyg 56:218–221.
Vontas JG, Small GJ, Hemingway J. 2001. Glutathione S-transferases as antioxidant defence
agents confer pyrethroid resistance in Nilaparvata lugens. Biochem J 357:65–72.
Yoon KS, Kwon DH, Strycharz JP, Hollingsworth CS, Lee SH, Clark JM. 2008. Biochemical and
molecular analysis of deltamethrin resistance in the common bed bug (Hemiptera:
Cimicidae). J Med Entomol 45:1092–1101.
Young SJ, Gunning RV, Moores GD. 2005. The effect of piperonyl butoxide on pyrethroidresistance-associated esterases in Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae).
Pest Manag Sci 61:397–401.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
4
Размер файла
189 Кб
Теги
population, distributions, hemipteracimicidae, lectularius, bed, cime, state, united, bug, resistance, mutation, widespread, knockdown
1/--страниц
Пожаловаться на содержимое документа