close

Вход

Забыли?

вход по аккаунту

?

Effect of HypoxiaReoxygenation on Cell Viability and Expression and Secretion of Neurotrophic Factors NTFs in Primary Cultured Schwann Cells.

код для вставкиСкачать
THE ANATOMICAL RECORD 293:865–870 (2010)
Effect of Hypoxia/Reoxygenation on Cell
Viability and Expression and Secretion
of Neurotrophic Factors (NTFs) in
Primary Cultured Schwann Cells
HAO ZHU,1* FENG LI,1* WEN-JUAN YU,2 WEN-JIN WANG,1 LIU LI,1 LI-DAN
WAN,1 YAN LE,1 AND WEN-LONG DING1
1
Department of Anatomy, Shanghai Jiao Tong University School of Medicine, Shanghai
Jiao Tong University Institutes of Medical Sciences, Shanghai, China
2
Department of Psychiatry, Shanghai Mental Health Center, Shanghai Jiao Tong
University School of Medicine, Shanghai, China
ABSTRACT
As the primary myelin-forming cells of the peripheral nervous system,
Schwann cells (SCs) play a key role in the regeneration of injured peripheral nerves. However, hypoxia causes injury of SCs, as observed in peripheral neuropathies, including those caused by diabetes. So we investigated
the effect of hypoxia/reoxygenation (H/R) on SCs in this study. To do so,
SCs were cultured in hypoxic condition in vitro and then in normal condition for 24 hr; The effects H/R on SCs were evaluated by MTT (3(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide) assay, Hoechst staining,
immunocytochemistry, western blotting, ELISA, and RT-PCR. H/R resulted
in a significant decrease in SCs survival and an increase in caspase-3 activity. H/R also reduced the mRNA level of BDNF (brain derived neurotrophic
factor) and its secretion, but NGF mRNA level was elevated in these cells.
These observations showed that H/R induces death of primary cultured
SCs, and different mechanisms responsible for regulating NGF and BDNF
C 2010 Wiley-Liss, Inc.
expression. Anat Rec, 293:865–870, 2010. V
Key words: Schwann cell; hypoxia/reoxygenation; caspase-3;
neurotrophic factors
Schwann cells (SCs) are the myelin-forming cells of
the peripheral nervous system and play a key role in peripheral nerve regeneration. After peripheral nerves are
transected, Wallerian degeneration takes place. SCs, together with macrophages remove necrotic tissue and
myelin debris. Furthermore, SCs proliferate to form
Büngner bands, which help the regrowing axons to elongate their growth cones in the direction of denervated
targets. The whole regeneration process is completed
when the regenerative axons are remyelinated by SCs.
The nerve regeneration process is also regulated by neurotrophic factors (NTFs) synthesized directly or indirectly by SCs.
In various pathological processes, SCs experience ischemia and hypoxia. Traumatic injury can damage blood
supply of nearby nerve and SCs are both directly and
indirectly induced to be exposed to hypoxia in diabetic
neuropathy, contributing to SCs dysfunction. Besides, biC 2010 WILEY-LISS, INC.
V
ological activity of SCs seeded in grafts decays as time
goes on and regeneration of nerve fibers in the middle of
Abbreviations used:DEPC, diethyl pyrocarbonate; DMSO,
dimethyl sulfoxide; SCs, Schwann cells.
Grant sponsor: Shanghai Leading Academic Discipline
Project; Grant numbers: S30201; S30205; Grant sponsor:
Shanghai Science and Technology Foundation of China; Grant
number: 03BK15.
y
Authors contributed equally to this work.
*Correspondence to: Prof. Wen-Long Ding, Prof. Department
of Anatomy, Shanghai Jiao Tong University School of Medicine,
No. 227 South Chongqing Road, Shanghai 200025, China
E-mail: dingwl500@sina.com.cn.
Received 12 October 2008; Accepted 8 December 2009
DOI 10.1002/ar.21105
Published online 23 February 2010 in Wiley InterScience (www.
interscience.wiley.com).
866
ZHU ET AL.
a conduit is usually poorer than that at both ends after
graft transplantation (Guenard et al., 1992; Yank et al.,
1999), which may be associated with SCs exposure to
local hypoxia induced by ischemia.
How does hypoxia/reoxygenation (H/R) affect SCs?
Thus, it is very important to make it clear effects of H/R
on SCs and mechanisms of action. In this study, we
examined cell survival, caspase-3 activity, expression,
and secretion of NTFs after SCs were exposed to H/R.
probed with rabbit anti-active caspase-3 (Stressgen Bioreagents, Victoria, BC, Canada). Cells were then incubated with peroxidase-conjugated goat anti-rabbit IgM
or IgG (1:200) for immunocytochemistry. The results of
immunostaining were examined with a Leica DM2500
microscope using a DDC 2/3 camera and analyzed with
RS IMAGE ProTM Version4.5 (Roper Scientific, Trenton,
NJ).
Western Blot Analysis
MATERIALS AND METHODS
Primary Cultures of Schwann Cells
SCs cultures were obtained utilizing our previous
method (Zhu et al., 2008). Briefly, sciatic nerves and
brachial plexus from 2- to 3-day-old Sprague-Dawley rats
were harvested and digested with 0.12% collagenase and
0.25% trypsin (Sigma, St. Louis, MO) at 37 C for 10–13
min. Twenty-four hours after plating, cells were treated
with cytosine arabinoside (5 lg/mL; Sigma, St. Louis,
MO) for 3 days to eliminate proliferating fibroblasts. Following this treatment, the culture medium was replaced
with fresh medium supplemented with forskolin (4 lM;
Sigma) and basic fibroblast growth factor (bFGF; 20 ng/
mL; R&D Systems, Minneapolis, MN) to allow for
Schwann cell proliferation. After 8 days, SCs were
detached with 0.25%EDTA- trypsin (Sigma) and passaged.
The culture medium was changed three times per week.
Hypoxia/Reoxygenation
Hypoxic conditions were induced according to our previous method (Zhu et al., 2008). Briefly, the incubation
chamber was filled with a mixture of 5% CO2/92% N2
and monitored by an oxygen analyzer (Shanghai Instrument Co, Shanghai, China) with an oxygen sensitive
metal electrode. The chamber was sealed and placed at
37 C in a humidified incubator for 15 min when the concentration of oxygen was lower than 1%. Subsequent to
the hypoxic treatment, the medium was replaced with
fresh medium and cells were then cultured for 24 h
under normoxic conditions (95% air, 5% CO2). Three replicates were used in each experiment.
Evaluation of Apoptotic Cells
Cultured cells were incubated for 15 min with
Hoechst 33342 (10 lg/mL) under dim light, and then
observed under an epifluorescence microscope. Cells
with small nuclei, high fluorescence intensity due to
chromatin condensation or nuclear fragmentation were
considered as apoptotic cells. The number of high-fluorescent condensed or fragmented nuclei was counted
using a Leica DM2500 microscope. Five different fields
were counted per dish. Results are expressed as percentage of condensed or fragmented nuclei relative to
the total number of nuclei counted per dish for each experimental condition. The number of dead and apoptotic cells in each group was expressed as percentage of
total cell number.
Immunocytochemistry
Twenty-four hours following hypoxia treatment, cultured cells were fixed with 4% paraformaldehyde and
To confirm the results of active caspase-3 immunocytochemistry, we detected active caspase-3 using Western
blot analysis. SCs were washed with PBS and lysed with
a lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl,
1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM
EDTA, 1 mM sodium orthovanadate, 10 mM sodium fluoride, 4 lg/mL leupeptin, 1 lg/mL aprotinin, and 100 lg/
mL PMSF; all from Sigma). After incubation on ice for
30 min, cell lysates were then clarified by centrifugation
at 16,000 g for 10 min at 4 C and the supernatant
was saved for protein analysis and Western blot. Total
protein concentration was determined by using a commercially available kit based on the bicinchoninic acid
(BCA) method. For Western blot analysis, 20 lg of the
cell extract was electrophoresed on a 12% SDS/polyacrylamide gel and transferred to a PVDF membrane. The
membrane was blocked with 5% nonfat dry milk in trisbuffered saline-0.1% Tween 20 (TBS-T), washed with
TBS–T and incubated overnight with anti-active caspase-3 (1:500) and anti-GAPDH antibody (1:2000,
Sigma). The membrane was washed and then incubated
with secondary antibody conjugated with peroxidase
(1:1000) in 5% nonfat dry milk in TBS–T buffer for 1 h.
Detection was carried out using an enhanced chemiluminescence detection kit (Pierce).
MTT Assay
The MTT (3(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide) assay was used to study the effect of H/
R on SC survival. Cells were planted in a 96-well plate
and cultured for 24 h after hypoxia. 10 lL of MTT stock
solution (10 mg/mL) (Sigma) was then added to the
remaining medium and the cultures were incubated for
another 4 h at 37 C. The medium was discarded after
the incubation and the insoluble dark blue formazan
was dissolved in 100 lL of DMSO and quantified at 570
nm with a reference wavelength of 630 nm using a
microtiter plate reader (Bio-Rad Laboratories, Hercules,
CA). Survival of the control group was defined as 100%
and that of H/R group was expressed as percentage of
control group.
Reverse Transcriptase–Polymerase Chain
Reaction (RT–PCR)
Twenty-four hours following hypoxia treatment, the
total RNA was extracted from cells using Trizol (Invitrogen, Carlsbad, CA). RNA was reverse transcribed in a
final volume of 20 lL, containing 1 lg of total RNA, 50
pM oligodT, 10 lM of each deoxyribonucleoside triphosphate (dNTP), 20 units RNasin and 10 units AMV
Reverse Transcriptase (Promega), 4 lL of 5 Reverse
Transcriptase buffer with DEPC H2O (TaKaRa, Dalian,
867
THE EFFECT OF HYPOXIA/REOXYGENATION ON SCHWANN CELLS
TABLE 1. Nucleotide sequence for oligonucleotide primers and size of the expanded PCR products
Gene
NGF
BDNF
GAPDH
Primer
forward
reverse
forward
reverse
forward
reverse
Sequence
0
0
5 TCCACCCACCCAGTCTTCCA3
50 GCCTTCCTGCTGAGCACACA30
50 AGCTGAGCGTGTGTGACAGT30
50 TCCATAGTAAGGGCCCGAAC30
50 CACCACCATGGAGAAGGCC30
50 GATGGATGCCTTGGCCAGG30
Product (bp)
Gene bank
343
V00836
252
X55573
190
M32599
China) supplied by the manufacturer. Two separate negative control reactions, either without RNA or without
AMV, were run in parallel. PCR was performed using
2 lL of synthesized cDNA with 0.125 lL Taq polymerase
(TaKaRa, China), 2 lL of dNTPs, 0.5 lL of each primer,
2.5 lL of PCR buffer, supplied by the company, and
DEPC H2O added to give a total reaction volume of
25 lL. All common components were added to a master
mix and then aliquoted. The cycling conditions were as
follows: Initial denaturation at 95 C for 5 min followed
by 28 cycles of: 95 C for 1 min, 55 C for 1 min, 72 C for
2 min, and a final extension at 72 C for 5 min. GAPDH
was used as the loading control. Primers were designed
as shown in Table 1.
Quantification of Neurotrophic Factors
by ELISA
Twenty-four hours after hypoxia treatment, NTFs concentrations in cellular supernatants were measured
using commercially available assays according to the
manufacture’s directions: BDNF Emax Immunoassay
(Promega Corp, Madison, WI) for BDNF, and rat b-NGF
ELISA kit (R&D Systems) for NGF. Briefly, the monoclonal antibody (mAb) was added to each well of a 96-well
plate and incubated overnight at 4 C. The following
additions to each well were carried out sequentially:
samples and BDNF standards in duplicate (incubated
2 h at room temperature); anti-human BDNF pAb (incubated 2 h at room temperature); anti-IgY HRP (incubated 1 h at room temperature); TMB solution
(incubated 20 min at room temperature). The plate was
washed with Tris buffered saline with 0.05% Tween 20
(TBST) buffer each time. Finally, stop solution was
added and absorbance was read at 450 nm on a microplate reader (Bio-Rad Laboratories) within 30 min. The
same procedure was carried out for NGF with following
reagents: goat anti-ratb-NGF, biotinylated goat antiratb-NGF, and streptavidin-HRP. NTFs concentrations
were calculated based on a standard curve.
Statistical Analysis
One-way ANOVA followed by a Newman Keuls’ multiple comparison tests was used to compare control and
treated groups with P < 0.05 being considered statistically significant.
RESULTS
H/R Induces SCs Apoptosis
Hoechst33342, a bis-benzimidazole dye, was used to
measure SCs apoptosis. It could penetrate the plasma
membrane and stain DNA in cells without permeabiliza-
Fig. 1. H/R induced apoptosis of SCs. (A) Hoechst 33342 staining
was performed to visualize the extent of programmed cell death. Condensed or fragmented nuclei were considered as apoptotic cells.
Arrows indicated condensed nuclei and arrowheads indicated fragmented nuclei. Bar: 20 lm. (B) Quantification of SCs death after H/R.
Data (mean SEM) were summarized from three independent experiments, ** p < 0.01 vs. control group.
tion. In contrast to the nuclei of normal cells, those of
apoptotic cells have highly condensed chromatin stained
uniformly by Hoechst 33342 (Fig.1). We found that H/R
could induce up to 31.7 4.5% SCs to apoptosis, which
were consistent with the results obtained by MTT reduction assay.
H/R Reduces SCs Viabilities
The effect of H/R on SCs injury was investigated by
MTT assay and trypan blue staining. Cells were incubated in normal condition for 24 h after exposure to hypoxia. Cell viability was assessed by MTT reduction
assay. We found that H/R resulted in a significant
decrease in SCs survival (MTT: 64 4.7%) (Fig. 2). This
result was further verified by cell count with a hemocytometer. Trypan blue staining was employed to identify
dead cells, and cell survival rate was determined before
ELISA assay. There were (9.86 0.42) 105 cells in the
control group, and only (6.56 0.28) 105 in the H/R
group. Thus, the number of viable cells in the H/R group
was 66.5 5.4% of that in the control group. This was
consistent with the results obtained by MTT assay.
868
ZHU ET AL.
Fig. 2. Effects of H/R on viabilities of SCs examined by MTT assay.
SCs were exposed to hypoxia for 15 min, then incubated in normal
condition for 24 h. Data are collected from three independent experiments and expressed as mean SEM. ** p < 0.01 vs. control group.
H/R Activates Caspase-3 in SCs
We investigated the possible mechanism of H/R
induced cell death by studying the activation of the initiator and the executioner (caspase-3) in the apoptotic
cascade. The level of the active caspase-3 in H/R SCs
was examined by immunocytochemistry and western
blot. As shown in Fig. 3, the grade of caspase-3 was
higher in H/R group than in control group. Treatment of
H/R increased intracellular level of active caspase-3
nearly 3.3-fold of control level in SCs. In Figure 4, western blot analysis further confirmed H/R induced caspase-3 to be activated in SCs.
Fig. 3. Microscopic findings of immunoreactivity of active caspase3 in SCs. (A) SCs were exposed to hypoxia for 15 min, then incubated
in normal condition for 24 h. Extensive positive cellular labeling of caspase-3 was seen in H/R-induced SCs. Only mild positive staining was
shown in control group. Bar: 100 lm. (B) The grade of caspase-3 in
the H/R group was higher than in control group. Data (mean SEM)
were summarized from three independent experiments. ** p < 0.01 vs.
control group.
H/R Enhances the mRNA level of NGF and
Reduces BDNF mRNA in SCs
We studied the effect of H/R on the biological activities
of SCs by examining NGF and BDNF mRNA through
expression RT-PCR. RT-PCR revealed that H/R induced
a significant reduction of BDNF mRNA in SCs, which
was about 75% of normal level; whereas the level of
NGF mRNA was elevated to 1.27 fold of control after
H/R (Fig. 5).
H/R Decreases BDNF Secretion in SCs
To test whether H/R treatment also influences NTFs
secretion, we examined secreted proteins through ELISA
assay. ELISA assay revealed that NGF and BDNF concentrations in cellular supernatant of H/R group were
only 2.97 0.29 and 6.0 1.3 (pg/mL), respectively,
both lower than that of control, in which it was 4.3 0.6, and 29.8 2.7 (pg/mL) (Fig. 6). However, H/R leads
to large amount of cell death, which might confuse the
result of ELISA assay, as the concentration of NTFs in
the supernatant correlates with cell number. To eliminate this effect, we counted the cell number in two
groups (data described above: cell number within H/R
group was only 66.5 5.4% of the control group) and
adjusted the results obtained by ELISA assay by cell
number. Adjusted data was named reactive values. In
Fig. 4. Western blot analysis of activated caspase-3 in SCs
exposed to H/R. SCs were exposed to hypoxia for 15 min, then incubated in normal condition for 24 h. H/R induced caspase-3 to be activated in SCs.
this way, secreted NTFs levels were compared based on
identical cell number. Adjusted NGF and BDNF concentrations were 4.48 0.34 and 9.2 1.9 (pg/mL) respectively in H/R group. Compare of this reactive value
demonstrated that H/R significantly reduced BDNF
secretion (P < 0.01), but had no effect on NGF secretion
(Fig. 6).
DISCUSSION
The present study indicates that H/R is able to reduce
SCs viabilities. Our results from MTT assay, trypan
blue, and Hoechst 33342 staining provided the first evidence that H/R results in the injury of primary cultured
SCs. Previous studies have shown that most cells of
mammals can not continue to meet the energy demands
THE EFFECT OF HYPOXIA/REOXYGENATION ON SCHWANN CELLS
869
Fig. 5. The in vitro effects of H/R on mRNA level of NGF and BDNF in SCs demonstrated by RT-PCR
analysis. SCs were exposed to hypoxia for 15 min, then incubated in normal condition for 24 h. Values of
densitometric analysis are mean SEM of three independent experiments, *p < 0.05 vs. control group.
Fig. 6. Effect of H/R on secretion of NGF (A) and BDNF (B) by
hypoxic SCs in vitro. SCs were exposed to hypoxia for 15 min, then
incubated in normal condition for 24 h. NTF levels in the cellular
supernatants were examined by ELISA assay. The left bars (examined)
display secretion level of NTFs in two groups, and the right bars (reac-
tive) display secretion level after cell number calibration (measured
value adjusted to cell number). Data are collected from three independent experiments and expressed as mean SEM. **p < 0.01 vs.
control group.
of active ion-transporting systems after exposure to hypoxia, leading to exhaustion of fermentable substrate,
catastrophic membrane failure and cell death (Boutilier,
2001). In peripheral neuropathy, caspase-3 was shown to
be activated in SCs. The studies of injury mechanisms in
SCs revealed that apoptosis is associated with the level
of caspase-3 activation (Iida et al., 2004; Wang et al.,
2005). Caspase-3 is considered as a key initiator and
executioner in the apoptotic pathway and mediates the
cleavage of itself, other downstream caspases and other
caspase substrates (Nunez et al., 1998). Caspase-3 and
Bcl-2 mutually adjust and jointly participate in apoptosis
(Nunez et al., 1998). Bcl-2 regulates the activation of
key caspases and also serves as a caspase substrate
(Soilu-Hänninen et al., 1999). The finding of H/R activating caspase-3 in SCs suggests that H/R might promote
the execution of the apoptotic program, similar to the
mechanism in the study that the activity and the expression of caspase-9 and caspase-3 are increased during hypoxia in the cerebral cortex of newborn piglets (Nunez
et al., 1998).
Our results showed that H/R increased the mRNA
level of NGF, whereas had an adverse effect on mRNA
level and protein secretion of BDNF in SCs,. In addition,
although not significant, there is also a trend of increase
in NGF secretion. These results indicated that H/R is
able to enhance the biological activities of SCs through
different effects on NTFs, and H/R induced different
mechanisms responsible for regulating NGF and BDNF
expression. This study is similar to Meyer’s research in
1992. They demonstrated that there were marked
increases in NGF and BDNF mRNA in the non-neuronal
cells of the transected nerve. However, the time-course
and spatial pattern of both expression are distinctly different. There is a marked rapid increase in NGF mRNA,
whereas a continuous slow increase of BDNF mRNA
starting after day 3 postlesion and reaching maximal
levels 3 weeks–4 weeks later. Rapid increased NGF
might be correlated with protecting injured neurons and
SCs and stimulating SCs retrodifferentiation and proliferation. Subsequent increased BDNF might play an important role in inducing SCs migration and expression of
myeline proteins. So SCs are likely to promote self survival against H/R-induced damage through autocrine
production of NGF. In response to hypoxia, mammalian
cells activate adaptive mechanisms and express a
870
ZHU ET AL.
variety of gene products to avert necrotic or apoptotic
cell death (Oka et al., 2007). To SCs exposed to hypoxia,
they upregulated NGF to meet urgent requirements of
sustaining survival, and downregulated BDNF, a nonurgent requirement, in short term. The phenomenon that
H/R stimulates survival and proliferation is also seen in
other cells (Lou et al., 1997; Sung et al., 2007). The
effect of H/R on SCs might be associated with hypoxiainducible factor-1 (HIF-1). HIF-1 is a transcription factor
that regulates the adaptive response to hypoxia in mammalian cells (Chavez and LaManna, 2002). For example,
HIF-1 regulates the expression of erythropoietin (Epo)
and vascular endothelial growth factor (VEGF), basic
fibroblast growth factor (bFGF), which have neuroprotective effect (Taoufik et al., 2008; Liu et al., 2007). Upregulation of HIF-1 in Schwann cells is caused by
ischemic damage or hypoxia (Oka et al., 2007; Keilhoff
et al., 2008), which shows HIF-1 may have a role in protecting Schwann cells against hypoxia.
In addition, although the results of RT-PCR analysis
and ELISA examination for NGF had an accordant
trend of increase, RT-PCR results showed that H/R
induced a significant increase in the mRNA level of
NGF. The reason might be that RT-PCR analysis, based
on a single cycle number, is not a particularly accurate
measure and may demonstrate a change trend.
In conclusion, hypoxia has been documented as an integral part of many pathological states including ischemic diseases (neoplasia, vascular malformations),
neurodegenerative diseases, chronic inflammatory diseases, and tumor progression. Exposure to H/R activates
caspase-3 and reduces SCs viabilities, on the other hand,
improves SCs survival and biological activities by autocrine NGF. Regulation of SCs survival and death is
mediated by the two ways after H/R. Further studies are
in progress in our institute to investigate the mechanisms, by which H/R induces SCs injury.
LITERATURE CITED
Boutilier RG. 2001. Mechanisms of cell survival in hypoxia and
hypothermia. J Exp Biol 204:3171–3181.
Chavez JC, LaManna JC. 2002. Activation of hypoxia-inducible
factor-1 in the rat cerebral cortex after transient global ischemia: potential role of insulin-like growth factor-1. J Neurosci
22:8922–8931.
Guenard V, Kleitman N, Morrissey TK, Bunge RP, Aebischer P.
1992. Syngeneic Schwann cells derived from adult nerves seeded
in semipermeable guidance channels enhance peripheral nerve
regeneration. J Neurosci 12:3310–3320.
Iida H, Schmeichel AM, Wang Y, Schmelzer JD, Low PA. 2004.
Schwann cell is a target in ischemia-reperfusion injury to peripheral nerve. Muscle Nerve 30:761–766.
Keilhoff G, Schild L, Fansa H. 2008. Minocycline protects Schwann
cells from ischemia-like injury and promotes axonal outgrowth in
bioartificial nerve grafts lacking Wallerian degeneration. Exp
Neurol 212:189–200.
Liu Y, Lu JB, Chen Q, Ye ZR. 2007. Involvement of MAPK/ERK kinase-ERK pathway in exogenous bFGF-induced Egr-1 binding activity enhancement in anoxia-reoxygenation injured astrocytes.
Neurosci Bull 23:221–228.
Lou Y, Oberpriller JC, Carlson EC. 1997. Effect of hypoxia on the
proliferation of retinal microvessel endothelial cells in culture.
Anat Rec 248:366–373.
Meyer M, Matsuoka I, Wetmore C, Olson L, Thoenen H. 1992.
Enhanced synthesis of brain-derived neurotrophic factor in the
lesioned peripheral nerve: different mechanisms are responsible for
the regulation of BDNF and NGF mRNA. J Cell Biol 119:45–54.
Nunez G, Benedict MA, Hu Y, Inohara N. 1998. Caspases: the proteases of the apoptotic pathway. Oncogene 17:3237–3245.
Oka N, Kawasaki T, Mizutani K, Sugiyama H, Akiguchi I. 2007.
Hypoxia-inducible factor 1alpha may be a marker for vasculitic
neuropathy. Neuropathology 27:509–515.
Soilu-Hänninen M, Ekert P, Bucci T, Syroid D, Bartlett PF, Kilpatrick T. 1999. Nerve growth factor signaling through p75 induces
apoptosis in Schwann cells via a Bcl-2-independent pathway. J
Neurosci 19:4828–4838.
Sung SM, Jung DS, Kwon CH, Park JY, Kang SK, Kim YK. 2007.
Hypoxia/reoxygenation stimulates proliferation through PKC-dependent activation of ERK and AKT in mouse neural progenitor
cells. Neurochem Res 32:1932–1939.
Taoufik E, Petit E, Divoux D, Tseveleki V, Mengozzi M, Roberts
ML, Valable S, Ghezzi P, Quackenbush J, Brines M, Cerami A,
Probert L. 2008. TNF receptor I sensitizes neurons to erythropoietin- and VEGF-mediated neuroprotection after ischemic and excitotoxic injury. Proc Natl Acad Sci USA 105:6185–6190.
Wang Y, Schmeichel AM, Iida H, Schmelzer JD, Low PA. 2005. Ischemia-reperfusion injury causes oxidative stress and apoptosis of
Schwann cell in acute and chronic experimental diabetic neuropathy. Antioxid Redox Signal 7:1513–1520.
Yank Q, Qiu YF, Shen XY, Liu CD. 1999. Studies on the influences of
hypoxia on morphology and migration of the cultured Schwann cells
and anti-hypoxia effect of EGb 761. Chin J Neuroanat 15:273–276.
Zhu H, Wang WJ, Ding WL, Li F, He J. 2008. Effect of panaxydol
on hypoxia-induced cell death and expression and secretion of
neurotrophic factors (NTFs) in hypoxic primary cultured Schwann
cells. Chem Biol Interact 174:44–50.
Документ
Категория
Без категории
Просмотров
2
Размер файла
239 Кб
Теги
expressions, factors, effect, hypoxiareoxygenationin, neurotrophic, schwann, ntfs, primary, secretion, culture, viability, cells
1/--страниц
Пожаловаться на содержимое документа