close

Вход

Забыли?

вход по аккаунту

?

Excreted urinary mediators in an animal model of experimental immune nephritis with potential pathogenic significance.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 56, No. 3, March 2007, pp 949–959
DOI 10.1002/art.22556
© 2007, American College of Rheumatology
Excreted Urinary Mediators in an Animal Model of
Experimental Immune Nephritis With Potential
Pathogenic Significance
Tianfu Wu,1 Chun Xie,1 Madhavi Bhaskarabhatla,1 Mei Yan,1 Amanda Leone,1 Su Sin Chen,1
Xin J. Zhou,1 Chaim Putterman,2 and Chandra Mohan1
Objective. Currently, proteinuria is viewed as the
earliest indicator of renal disease in immune-mediated
nephritis. The objective of this study was to determine
whether additional mediators may be excreted in the
urine during immune-mediated nephritis, using an
experimental model with a well-defined disease course.
Methods. Urine samples from mice with anti–
glomerular basement membrane (anti-GBM) antibody–
induced experimental nephritis were screened using a
focused immunoproteome array bearing 62 cytokines/
chemokines/soluble receptors. Molecules identified
through this screening assay were validated using an
enzyme-linked immunosorbent assay. One of these molecules was further evaluated for its pathogenic role in
disease, using antibody-blocking studies.
Results. Compared with B6 and BALB/c mice, in
which moderately severe immune-mediated nephritis
develops, the highly nephritis-susceptible 129/Sv and
DBA/1 mice exhibited significantly increased urinary
levels of vascular cell adhesion molecule 1 (VCAM-1),
P-selectin, tumor necrosis factor receptor I (TNFRI),
and CXCL16, particularly at the peak of disease.
Whereas some of the mediators appeared to be serum
derived early in the disease course, local production in
the kidneys appeared to be an important source of these
mediators later in the course of disease. Both intrinsic
renal cells and infiltrating leukocytes appeared to be
capable of producing these mediators. Finally, antibodymediated blocking of CXCL16 ameliorated experimental immune nephritis.
Conclusion. These studies identified VCAM-1,
P-selectin, TNFRI, and CXCL16 as a quartet of molecules that have potential pathogenic significance; the
levels of these molecules are significantly elevated during experimental immune nephritis. The relevance of
these molecules in spontaneous immune nephritis warrants investigation.
The experimental transfer of antibodies to the
glomerular basement membrane (anti-GBM) into young
healthy mice and rats precipitates glomerular and interstitial disease, with a rapid and reproducible time course
(1–3). The immune-mediated nephritis in this experimental model shares several features with autoantibodymediated nephritis in spontaneous lupus, particularly
the downstream cellular and molecular players that
mediate renal disease. This appears to be important,
because antiglomerular antibodies have also been suggested to be of pathogenic relevance in human and
murine lupus (4,5). Hence, some of the lessons learned
from the experimental immune nephritis model may be
applicable to the pathogenic events that mediate spontaneous lupus nephritis.
Recently, we observed an interesting straindependent difference in susceptibility to anti-GBM
antibody–induced nephritis. Whereas some mouse
strains exhibit mild to moderately severe anti-GBM–
triggered nephritis, other strains exhibit florid renal
disease following an anti-GBM antibody challenge (2,3).
1
Tianfu Wu, PhD, Chun Xie, MD, Madhavi Bhaskarabhatla,
MS, Mei Yan, BS, Amanda Leone, BS, Su Sin Chen, MD, Xin J. Zhou,
MD, Chandra Mohan, MD, PhD: University of Texas Southwestern
Medical School at Dallas; 2Chaim Putterman, MD, PhD: Albert
Einstein College of Medicine, Bronx, New York.
Drs. Wu and Xie contributed equally to this work.
Address correspondence and reprint requests to Chandra
Mohan, MD, PhD, Department of Internal Medicine/Rheumatology,
University of Texas Southwestern Medical Center, Mail Code 8884,
Y8.204, 5323 Harry Hines Boulevard, Dallas, TX 75390-8884. E-mail:
Chandra.mohan@utsouthwestern.edu.
Submitted for publication May 1, 2006; accepted in revised
form November 20, 2006.
949
950
WU ET AL
Examples of the former include the C57BL/6 (B6)
and BALB/c mouse strains, whereas the 129/Sv, BUB,
NZW, and DBA/1 mouse strains develop severe proliferative renal disease following an anti-GBM antibody
challenge (2,3). The genetic and molecular players that
account for this strain difference currently remain unknown.
In this study, we compared the proteins excreted
in the urine of mice with severe nephritis with those in
the urine of mice with mild nephritis, using immunoproteomic analysis. Interestingly, compared with the
B6 and BALB/c strains, DBA/1 and 129/Sv mice exhibited high urinary levels of vascular cell adhesion molecule 1 (VCAM-1), P-selectin, soluble tumor necrosis
factor receptor I (TNFRI), and CXCL16, correlating
well with the level of disease severity. Importantly, these
molecules were noted to be expressed within the kidneys
during disease, being elaborated by intrinsic renal cells
as well as infiltrating leukocytes. Finally, we demonstrate
that at least 1 of these molecules, CXCL16, is essential
for renal disease in this experimental model.
MATERIALS AND METHODS
Mice. B6, 129/Sv, BALB/c, and DBA/1 mice were
purchased from The Jackson Laboratory (Bar Harbor, ME).
Urine samples from the mice subjected to accelerated experimental nephritis were collected on day 1, day 7, and day 14/15
or day 21 after disease induction, as described previously (3).
Female mice were used for all experiments, and 24-hour urine
collection using metabolic cages was carried out for all mice.
All collected urine samples were aliquoted and rapidly frozen
away without any protease inhibitors. This was done deliberately, to enrich for potential urinary biomarkers that were not
labile and that may be robustly detected in any laboratory
setting. All animal experiments were carried out in accordance
with the institutional guidelines.
Screening of urine using proteomic arrays. Membranes bearing antibodies to 62 mouse cytokines/chemokines/
soluble receptors were purchased from Ray Biotech (Norcross,
GA [online at http://www.raybiotech.com]) and were used to
screen urine obtained from B6, BALB/c, 129/Sv, and DBA/1
mice (5 mice per strain) 14 days after induction of experimental nephritis, as detailed previously (3). The specific molecules
that were assayed on the arrays were Axl, Blc, CD30 ligand
(CD30L), CD30T, CD40, Crg2, cutaneous T cell–attracting
chemokine (CTACK), CXCL16, eotaxin, eotaxin 2, Fas ligand,
fractalkine, granulocyte colony-stimulating factor (G-CSF),
granulocyte–macrophage CSF (GM-CSF), interferon- ␥
(IFN␥), insulin-like growth factor binding protein 3 (IGFBP3), IGFBP-5, IGFBP-6, interleukin-1␣ (IL-1␣), IL-1␤, IL-2,
IL-3, IL-3Rb, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12 p40/p70,
IL-12 p70, IL-13, IL-17, KC, leptin receptor (leptin R), leptin
(OB), LiX, L-selectin, lymphotactin, monocyte chemotactic
protein 1 (MCP-1) MCP-5, macrophage CSF (M-CSF), MIG,
macrophage inflammatory protein 1␣ (MIP-1␣), MIP-1␤,
MIP-2, MIP-3␣, MIP-3␤, platelet factor 4 (PF-4), P-selectin,
RANTES, stem cell factor (SCF), stromal cell–derived factor
1␣ (SDF-1␣), thymus and activation–regulated chemokine
(TARC), T cell–attracting chemokine 3 (TCA-3), thymusexpressed chemokine (TECK), tissue inhibitor of metalloproteinases 1 (TIMP-1), TNF␣, TNFRI, TNFRII, thrombopoietin
(TPO), VCAM-1, and vascular endothelial growth factor
(VEGF). Screening was carried out as recommended by the
manufacturer. Briefly, after blocking the membranes, they
were incubated with urine samples diluted at a ratio of 1:5 in
dilution buffer. Next, biotin-conjugated primary antibodies to
the different mediators on the membrane and horseradish
peroxidase (HRP)–conjugated streptavidin were applied to
develop the membranes. The intensity of spots on the membrane were imaged using ImageJ software (http://
rsb.info.nih.gov/ij). Selected reactivities were confirmed using
enzyme-linked immunosorbent assays (ELISAs), as described
below.
ELISA detection of TNFRI, CXCL16, P-selectin, and
VCAM-1. The following ELISA kits were purchased from
R&D Systems (Minneapolis, MN) and were used according to
the recommendations of the manufacturer: mouse TNFRI/
TNFRSF1A DuoSet (catalog no. DY425), mouse CXCL16
DuoSet (catalog no. DY503), mouse P-Selectin/CD62P DuoSet (catalog no. DY737), and mouse VCAM-1/CD106 DuoSet
(catalog no. DY643). The detection limits of these 4 ELISAs
were 4 pg/ml, 16 pg/ml, 62 pg/ml, and 125 pg/ml, respectively.
All urine samples were diluted at a ratio of 1:5 or higher for the
ELISAs, and concentrations of the respective molecules were
ascertained using manufacturer-supplied standards. Likewise,
all culture supernatants were diluted at a ratio of 1:2 or 1:10
before assaying for the respective molecules.
Treatment of anti-GBM antibody–induced nephritis
using anti-CXCL16. A total of 18 129/Sv mice were subjected
to the accelerated model of anti-GBM nephritis, as described previously (3), using adjuvant sensitization on day 0
and rabbit anti-mouse GBM sera on day 5. These 18 mice were
divided into 3 groups of 6 each. On days 1, 4, 8, 12, 16, and
20, rat anti-mouse CXCL16 antibody (R&D Systems; catalog
no. MAB503), 500 ␮g intraperitoneally (n ⫽ 6 mice), or rat
IgG2A isotype control (R&D Systems; catalog no. MAB9371)
(n ⫽ 6 mice) was injected into mice in the experimental group
and the isotype-control group, respectively. In addition, 6
mice were subjected to anti-GBM nephritis but were not
treated with any additional antibodies. Urine and blood samples were collected from all groups of mice on days 0, 7, 14, 17,
and 21. Mice were killed on day 21, and the kidneys were
processed, analyzed, and graded for histopathology, as detailed
elsewhere (3).
Real-time reverse transcription–polymerase chain
reaction (PCR). Anti-GBM antibody–challenged 129/Sv mice
were killed on day 0, day 7, or day 15. RNA was extracted
from the renal cortex (after stripping it away from the medulla)
for real-time PCR assays using the following primers, according to the previously described protocols (6). For Pselectin, AGATCTGGGCTTCCTGGGTGAAAT and
AACGCAAGGACAGGTATCCAGTGA; for VCAM-1,
TACCTGCCATCGGGATGATCGTTT and ATTTCTGTG-
VCAM-1, P-SELECTIN, TNFRI, AND CXCL16 IN NEPHRITIC URINE
CCTCCACCAGACTGT; for CXCL16, TGTCTTCTTCCTCACTGCAGCCAT and ACAGGAGTGTACCAGAGCTGCAAA; for TNFRI, TCAGGCAGTGTCTCAGTTGCAAGA
and TCCACCTGGGACATTTCTTTCCGA. The fold change
was calculated as described previously (6).
In vitro cell culture. Mesangial cells from glomeruli
and macrophages from the bone marrow of 2-month-old
B6 or 129/Sv mice were derived as described elsewhere
(6,7) and stimulated with or without lipopolysaccharide (LPS)
(10 ␮g/ml) for 24 hours. Released VCAM-1, CXCL16,
TNFRI, and P-selectin were analyzed by ELISA, as described
above.
Immunohistochemical analysis. Kidney sections obtained from 129/Sv mice 14 days after anti-GBM antibody
challenge were stained with the following primary antibodies: goat anti-mouse CXCL16 antibody (R&D Systems;
catalog no. AF503), goat anti-mouse TNFRI antibody (R&D
Systems; catalog no. BAF425), goat anti-mouse VCAM-1 antibody (R&D Systems; catalog no. BAF643), or goat anti-mouse
P-selectin antibody (Santa Cruz Biotechnology, Santa Cruz,
CA; catalog no. SC-6941) or the isotype control antibodies.
The sections were then developed as described previously (6).
Briefly, antigen retrieval was performed by using sodium
citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0)
in a pressure cooker, followed by protein blocking for 20
minutes and peroxidase blocking for 20 minutes. For primary
incubation, anti-TNFRI antibody (0.5 ␮g/ml, 60 minutes),
anti–P-selectin antibody (0.2 ␮g/ml, 60 minutes), anti-CXCL16
antibody (0.25 ␮g/ml, 60 minutes), or anti-VCAM-1 antibody
(0.3 ␮g/ml, 30 minutes) was added. This was followed by
incubation with biotinylated anti-goat IgG (2 ␮g/ml), avidin–
biotin–peroxidase complex staining (Vectastain Elite ABC Kit;
Vector, Burlingame, VT), HRP, diaminobenzidine (DAB) chromagen, and hematoxylin. The protein block, DAB chromagen,
and the peroxidase block were from the Dako Cytomation
Envision kit (Dako, Carpinteria, CA; catalog no. K4011).
Statistical analysis. All comparisons were performed
using Student’s t-test for normally distributed data and the
Mann-Whitney U test otherwise, using SigmaStat (SPSS, Chicago, IL) or GraphPad Prism (GraphPad Software, San Diego,
CA) software.
RESULTS
Higher amounts of urinary VCAM-1, P-selectin,
TNFRI, and CXCL16 in strains with severe nephritis.
We recently noted that certain strains of mice, such as
NZW, DBA/1, BUB, and 129/Sv, develop severe nephritis in response to an anti-GBM antibody insult, compared with 16 other inbred strains tested (2,3). As a
quick screen for mediators that may be excreted in the
urine of nephritic mice, we assayed urine from 2 strains
of mice with mild experimental nephritis (i.e., B6 and
BALB/c), and 2 strains of mice with severe experimental
nephritis (i.e., DBA/1 and 129/Sv), 14 days following the
nephrotoxic insult (the peak of disease) for the presence
951
Figure 1. Screening of excreted molecules in nephritic urine using
commercial protein arrays. A, Representative array profile depicting
the reactivity patterns of urine from 4 strains of mice, 14 days after
challenge with antiglomerular antibodies, using the accelerated model,
as described previously (3). Black dots indicate the presence of
particular proteins. The 4 black dots at the top left represent the
positive control, and the 4 blank spots immediately below represent the
negative control. Colored circles represent the 4 molecules that were
reproducibly elevated in urine from DBA/1 and 129/Sv mice, but not in
urine from BALB/c and B6 mice, following nephrotoxic insult. Each
array is representative of 2 independent experiments, each of which
was conducted using 5 urine samples pooled from each strain of mice.
B, Relative abundance of the different proteins, as gauged by measuring the image intensity using ImageJ software. The profile shown is
representative of 2 independent experiments. These results were
further validated using a second approach, enzyme-linked immunosorbent assay, as detailed in the text and in Figure 2. VCAM-1 ⫽ vascular
cell adhesion molecule 1; TNFRI ⫽ tumor necrosis factor receptor I;
AU ⫽ arbitrary unit.
952
of 62 cytokines/chemokines or soluble mediators, using a
commercially available reverse proteomic array from
Ray Biotech. Figures 1A and B show representative
array profiles for urine obtained from these 4 strains of
mice. The 2 highly disease-prone strains of mice, DBA/1
and 129/Sv, exhibited increased levels of several molecules in their urine, including VCAM-1, P-selectin,
TNFRI, and CXCL16, that were not prominent in the
urine of the “control” strains of mice. These findings
were confirmed using an orthogonal method, ELISA, as
detailed below.
In contrast, urine from these 4 strains of mice
exhibited similar levels of Axl, Blc, CD30L, CD30T,
CD40, Crg2, CTACK, eotaxin, eotaxin-2, Fas ligand,
fractalkine, G-CSF, GM-CSF, IFN ␥ , IGFBP-3,
IGFBP-5, IGFBP-6, IL-1␣, IL-1␤, IL-2, IL-3, IL-3Rb,
IL-4, IL-5, IL-6, IL-9, IL-10, IL-12 p40/p70, IL-12 p70,
IL-13, IL-17, KC, leptin R, leptin (OB), LIX, L-selectin,
lymphotactin, MCP-1, MCP-5, M-CSF, MIG, MIP-1␣,
MIP-1␤, MIP-2, MIP-3␣, MIP-3␤, PF-4, RANTES,
SCF, SDF-1␣, TARC, TCA-3, TECK, TIMP-1, TNF␣,
TPO, and VEGF, following anti-GBM antibody–
induced immune nephritis (Figure 1). Finally, the levels
of TNFRII (positioned next to TNFRI on the arrays
shown in Figure 1A) were elevated not only in the
urine of DBA/1 and 129/Sv mice but also in the urine of
B6 mice, in which milder disease develops; therefore,
TNFRII was not studied further.
Excretion of urinary VCAM-1, P-selectin, TNFRI,
and CXCL16 early in disease but peaking with disease
crescendo. Next, the above array findings were confirmed by ELISA. Interestingly, in the 2 severe disease–
prone strains, urinary levels of VCAM-1, P-selectin,
TNFRI, and CXCL16 were relatively high on day 7, with
a peak on day 14, relative to the levels in B6 and BALB/c
mice (Figure 2). In contrast, urinary protein or albumin
excretion in these 2 strains of mice was not increased on
day 7 (Figure 2, top row). Hence, these 4 molecules
appear to be particularly attractive as potential early
biomarkers of renal disease, because they appear in the
urine before proteinuria sets in. As is evident in Figure
2, day 14 urine from the DBA/1 and 129/Sv mice had
significantly higher levels of TNFRI (P ⬍ 10⫺8),
P-selectin (P ⬍ 10⫺7), VCAM-1 (P ⬍ 10⫺7), and
CXCL16 (P ⬍ 0.004) compared with the corresponding
day 14 urinary levels in the B6 and BALB/c control mice.
Similarly, day 21 urine from the DBA/1 and 129/Sv mice
had significantly higher levels of TNFRI (P ⬍ 0.01),
P-selectin (P ⬍ 0.03), VCAM-1 (P ⬍ 10⫺5), and
CXCL16 (P ⬍ 0.001) compared with the corresponding
day 21 urinary levels of these molecules in the B6 and
WU ET AL
BALB/c control mice. Interestingly, these 4 molecules
exhibited quite different excretion profiles over time.
Whereas VCAM-1 levels continued to be high past day
14 (similar to the level of protein), levels of the other 3
markers, particularly TNFRI, dropped rapidly after day
14. Because acute glomerular disease in this model
reaches its peak at about day 14 (2,3), it is tempting to
propose that whereas the urinary levels of P-selectin,
CXCL16, and particularly TNFRI may be good markers
of acute renal disease, urinary VCAM-1 may be a better
marker of past or chronic nephritis.
Similar serum levels of the 4 molecules in all 4
mouse strains on day 7. A possible factor contributing to
the early rise in urine levels of VCAM-1, P-selectin,
TNFRI, and CXCL16 could have been potentially high
serum levels of these same molecules. Therefore, serum
levels of these 4 molecules were next assayed at serial
time points following the glomerular insult. In all 4
strains of mice, serum levels of VCAM-1, P-selectin, and
CXCL16 reached a peak on day 7 (not day 14), to a fairly
similar degree in all 4 strains. Representative ELISA
results are shown in Figure 3. Hence, the content of
these molecules in urine on day 7 might have been
derived from serum, at least in part. After day 7,
however, the serum and urine levels of these molecules
pursued discordant kinetics, as is evident by comparing
Figures 2 and 3. Thus, the differential expression of
these molecules in day 14 and day 21 urine samples from
the DBA/1 and 129/Sv mice on the one hand, and from
the BALB/c and B6 mice on the other, is unlikely to be
attributable to differences in the serum levels of these
molecules in these strains of mice; rather, local production of these mediators in diseased (DBA/1 and 129/Sv)
kidneys may be a major source of these molecules at
these later time points.
In contrast to the above 3 molecules, serum levels
of TNFRI peaked on day 14 and subsided thereafter,
similar to the profiles of TNFRI in urine. Indeed, the
absolute day 14 serum levels of TNFRI were also highest
in 129/Sv mice, followed by DBA/1 mice, and were
substantially lower in B6 and BALB/c mice, again reflecting the corresponding urinary profiles. Based on
these patterns, it appears that the urinary TNFRI profiles in these 4 strains of mice may be dictated by their
corresponding serum levels, to a significant extent.
Hyperexpression of VCAM-1, TNFRI, P-selectin,
and CXCL16 within diseased kidneys. To determine
whether these molecules were expressed within the
kidneys, a couple of complementary approaches were
adopted. First, real-time PCR studies indicated that
levels of these molecules were indeed up-regulated
VCAM-1, P-SELECTIN, TNFRI, AND CXCL16 IN NEPHRITIC URINE
Figure 2. Urine levels of VCAM-1, CXCL16, P-selectin, and TNFRI, by enzyme-linked immunosorbent assay
(ELISA). DBA/1 and 129/Sv mice develop renal disease that is severe compared with that in B6 and BALB/c
mice, when challenged with antiglomerular antibodies. In this model of severe disease, 24-hour urine levels of
protein and albumin peak on day 14 and tend to remain high until day 21 (top row). Typically, healthy B6 mice
do not excrete ⬎1 mg of protein per 24-hour period. The 24-hour urine levels of VCAM-1, CXCL16, TNFRI,
and P-selectin followed a very similar time course, as depicted in the second through fifth rows. Each plot was
derived by monitoring 5–6 mice per strain through day 21. Within each row, the data from the 4 strains are plotted
using the same y-axis scale, in order to highlight the differences between strains. Day 14 and day 21 levels of all
4 molecules were significantly higher in DBA/1 and 129/Sv mice compared with the 2 control strains, BALB/c and
B6. Broken lines connect the mean values. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01; ⴱⴱⴱ ⫽ P ⬍ 0.001 by Student’s t-test (or
Mann-Whitney nonparametric test for non-normally distributed data), day 7, day 14, and day 21 versus day 0.
NS ⫽ not significant (see Figure 1 for other definitions).
953
954
WU ET AL
Figure 3. Serum levels of VCAM-1, CXCL16, P-selectin, and TNFRI during anti–glomerular basement
membrane (anti-GBM) antibody–induced nephritis. Serum levels of CXCL16, P-selectin, TNFRI, and VCAM-1
were assayed in the same sets of mice (n ⫽ 5–6 mice per strain) described in Figure 2, on days 0, 7, 14, and 21
after the anti-GBM antibody insult. Broken lines connect the mean values. ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01; ⴱⴱⴱ ⫽
P ⬍ 0.001 by Student’s t-test (or Mann-Whitney nonparametric test for non-normally distributed data), day 7, day
14, and day 21 versus day 0. NS ⫽ not significant (see Figure 1 for other definitions).
within the renal cortex as disease evolved following the
nephrotoxic insult, with the most dramatic differences
being noted in the expression of VCAM-1 and CXCL16
(Figure 4). Furthermore, we could demonstrate the
increased presence of these molecules within the diseased kidneys using immunohistochemistry (Figure 5).
Whereas VCAM-1 and CXCL16 showed increased
staining in the glomeruli, tubules, and vascular endothelium, TNFRI staining was stronger in the tubules and
interstitium. P-selectin staining was strongest within the
glomeruli (Figure 5).
Although these studies indicate that these molecules can be hyperexpressed within the diseased kidney,
they do not clearly distinguish whether these molecules
are expressed within renal-intrinsic cells or within infiltrating leukocytes. In vitro studies, however, demonstrated that intrinsic renal cells (as exemplified by mesangial cells) and systemic leukocytes (as exemplified by
macrophages) were both capable of synthesizing these
products, particularly upon stimulation with LPS (data
not shown). Importantly, the levels of all 4 molecules
elaborated by the 129/Sv-derived macrophages and mesangial cells were significantly higher than the levels
elaborated by B6 cells, which is in resonance with the
contrasting urinary profiles of these molecules in these 2
strains of mice, with one exception. Although LPStriggered mesangial cells from 129/Sv mice were a rich
source of VCAM-1, CXCL16, and P-selectin, no signif-
VCAM-1, P-SELECTIN, TNFRI, AND CXCL16 IN NEPHRITIC URINE
Figure 4. Expression of CXCL16, P-selectin, TNFRI, and VCAM-1
within nephritic kidneys. RNA from the renal cortex of 129/Sv mice
(n ⫽ 5) with anti–glomerular basement membrane antibody–induced
nephritis was isolated on days 0, 7, and 15, and mRNA levels of the 4
molecules were assayed by real-time polymerase chain reaction. The
fold change is with respect to mRNA levels on day 0 and was calculated
after normalization against GAPDH message, as detailed elsewhere
(27). Values are the mean and SD. ⴱ ⫽ P ⬍ 0.05; ⴱⴱⴱ ⫽ P ⬍ 0.001 by
Student’s t-test (or Mann-Whitney nonparametric test for nonnormally distributed data), day 7 and day 15 versus day 0. NS ⫽ not
significant (see Figure 1 for other definitions).
icant increase in TNFRI production was noted. It remains possible that yet other glomerular cell types (e.g.,
glomerular endothelial cells and podocytes) may be
additional sources of some of these mediators; this
possibility needs to be examined further.
955
Assessing the role of CXCL16 in immune nephritis. Finally, we sought to determine the pathophysiologic
relevance of these 4 molecules in immune nephritis.
Some information is already available concerning the
role of VCAM-1, P-selectin, and TNFRI in renal disease
(8–19), as discussed below. However, much less is known
about the role of CXCL16, which is a chemokine
expressed on dendritic cells and macrophages. This
chemokine has been shown to be important for the
recruitment of T cells into various tissues and for
cell–cell interactions via the CXCR6 counterreceptor
(20–22). Although CXCL16 has been suggested to be
important in arthritis, its role in immune nephritis is
currently unknown. Given that it can be expressed within
the kidneys (Figures 4 and 5), we wondered whether this
chemokine might have an obligatory role in engendering
renal disease following an immune trigger. Because
CXCL16⫺/⫺ mice are not yet available, we examined
whether blockade of CXCL16 function using blocking
antibodies might have the potential to ameliorate nephritis. As depicted in Figure 6, anti-CXCL16 antibody
treatment resulted in a significant reduction in proteinuria, glomerulonephritis, tubulointerstitial disease, and
crescent formation following the experimental induction
of anti-GBM disease in susceptible 129/Sv mice, compared with placebo-treated mice.
Figure 5. Immunohistochemical localization of CXCL16, P-selectin, tumor necrosis factor receptor I (TNFRI), and
vascular cell adhesion molecule 1 (VCAM-1) within diseased kidneys. Formalin-fixed kidney sections from 129/Sv mice,
obtained on day 0 or day 15 following the anti–glomerular basement membrane antibody challenge, were stained with
antibodies to P-selectin, CXCL16, TNFRI, or VCAM-1, or with the secondary control antibody. Results are representative
of 3–5 independent kidney sections.
956
WU ET AL
Figure 6. Effect of CXCL16 on amelioration of experimental immune nephritis. 129/Sv mice were
subjected to anti–glomerular basement membrane antibody–induced nephritis, as detailed previously (2,3). Whereas mice in the experimental group (n ⫽ 6) received intraperitoneal injections of
anti-CXCL16 (500 ␮g per injection) 3 times weekly throughout the 21-day experimental period,
while mice in the placebo groups received an equivalent amount of isotype control antibody (n ⫽
6) or no antibody (n ⫽ 6). All mice were examined for the degree of proteinuria over 24 hours, the
degree of glomerular disease, the extent of glomerular crescent formation, and the degree of
interstitial disease. Values are the mean ⫾ SD. ⴱⴱ ⫽ P ⬍ 0.01; ⴱⴱⴱ ⫽ P ⬍ 0.001 by Student’s t-test
(or Mann-Whitney nonparametric test for non-normally distributed data), experimental group
versus placebo groups. GN ⫽ glomerulonephritis.
DISCUSSION
Experimental immune nephritis has proven to be
a reasonable tool with which to model and study clinical
diseases marked by spontaneous immune nephritis, such
as Goodpasture’s syndrome and lupus nephritis. Use of
this experimental tool has been instrumental in demonstrating the potential pathogenic role of several mediators, including a variety of adhesion molecules, chemokines, and cytokines (23–29). Proteinuria is typically the
first indicator that surfaces in both experimental and
spontaneous immune nephritis (1–5).
In this study, we used 2 resources to determine
whether other molecules might become evident in urine
before the appearance of overt proteinuria. First, we had
previously completed a strain distribution study of antiGBM disease susceptibility (2,3), which in effect allowed
us to compare urine from mice that experience severe
anti-GBM disease with that from control strains of mice.
Second, we took advantage of a commercially available
proteome array that allows screening for the presence of
62 different molecules in any given sample. In compar-
ing urine from DBA/1 and 129/Sv mice subjected to
experimental immune nephritis with urine from the
BALB/c and B6 control mice, we identified CXCL16,
P-selectin, TNFRI, and VCAM-1 as 4 molecules that are
hyperexcreted in mice with severe nephritis. Whereas
some of these molecules have previously been studied in
the context of renal disease, others have not.
VCAM-1 is an adhesion molecule that is expressed on a large number of cell types, including
macrophages, dendritic cells, and endothelial cells, and
plays an important role in cell recruitment into tissues
mediated by VCAM-1–very late activation antigen 4
interactions. Increased expression of VCAM-1 has also
been noted in arthritis and other immune disorders, in
which it has also been identified as a therapeutic target
(30,31). Endothelial hyperexpression of VCAM-1 has
previously been noted in experimental immune nephritis, although antibody-mediated blockade was shown to
have only a minimal impact on disease (32). VCAM-1
has also been observed to be expressed in the kidneys, in
both murine and human lupus (8–10). The above find-
VCAM-1, P-SELECTIN, TNFRI, AND CXCL16 IN NEPHRITIC URINE
ings are reinforced by our present study, the results of
which show that mesangial cells may be an additional
source of VCAM-1. In addition, it is clear that infiltrating leukocytes may be another good source of this
molecule. The present findings indicate the VCAM-1
may be a potential urinary marker of renal disease in
mice with experimental immune-mediated nephritis,
concordant with earlier studies of lupus nephritis (33).
In addition, it appears that elevated urinary VCAM-1
levels may persist even after active renal inflammation
subsides (Figure 2).
P-selectin is an adhesion molecule that is expressed on platelets and several other cell types, and the
level of P-selectin has been reported to be elevated in
other autoinflammatory diseases, in which it has also
been recognized as a circulating disease marker (11–13).
The prominence of P-selectin in experimentally induced
immune nephritis has also been quite extensively studied
(34–37). Interestingly, a protective role for endothelial
P-selectin in immune nephritis has been suggested (37).
It has also been observed to be expressed within the
kidneys, in both mice and patients with spontaneous
lupus nephritis (14,15). However, it has not been specifically measured in the urine of mice or in the urine of
patients with lupus or immune nephritis. These data
represent the first demonstration of elevated levels of
urinary P-selectin in immune nephritis.
TNFRI is a cytokine receptor that plays various
functions in the immune system. Interestingly, the expression of TNFRII (but not TNFRI) on intrinsic renal
cells has recently been shown to be important in experimental immune nephritis (38). Additionally, levels of
serum TNFRI have been noted to be increased in
human systemic lupus erythematosus (17,18). There is a
single report of hyperexpression of TNFRI in the kidneys of patients with proliferative lupus nephritis (19),
but TNFRI has not yet been examined in the urine of
patients with lupus or immune nephritis. Thus, this
report is the first to describe elevated levels of urinary
TNFRI in immune nephritis. Based on our findings,
however, it appears that urinary TNFRI in immune
nephritis may be originating, at least in part, from serum
(Figures 2 and 3).
CXCL16 is a chemokine that is reported to be
expressed on dendritic cells and macrophages and is
important for the recruitment of T cells and natural
killer T cells into various tissues and for cell–cell interactions via the CXCR6 counterreceptor (20–22).
CXCL16 also appears to be important in arthritis;
however, it has not been studied previously in human
957
nephritis, in either the kidneys or urine. This represents
the first report implicating a pathogenic role for this
molecule in immune nephritis. Our in vitro studies
indicate that both macrophages and mesangial cells
constitute potential sources of this chemokine in nephritic kidneys, although additional cell types may also
be contributors.
The results of these studies have several important implications. First, given that all of these molecules
are expressed within diseased or injured kidneys (Figures 4 and 5), they may be playing critical roles in disease
pathogenesis. Indeed, in this study, we have formally
demonstrated a pathogenic role for CXCL16 in experimental immune nephritis. Bone marrow transfer studies
using CXCL16-deficient mice are warranted to ascertain
the respective contributions of infiltrating versus resident renal cells toward the renal expression of CXCL16
(and the other implicated molecules) during immune
nephritis. Although these 4 molecules have been discussed as independent entities, it is certainly possible
that they may be coordinately regulated during disease,
and there is some evidence to support this possibility
(39–41).
Second, because these 4 molecules appear early
in experimental immune nephritis, prior to the onset of
proteinuria, and correlate well with disease, they may
also have the potential to serve as harbingers of renal
disease in spontaneous immune-mediated nephritis
(e.g., in lupus). In parallel studies, we recently demonstrated that levels of these 4 molecules are also elevated
in the urine of mice and patients with lupus, correlating
well with proteinuria and disease activity (Wu T, et al:
unpublished observations). It would also be important to
expand these “biased” proteomic studies (focused on
only 62 molecules) to unbiased proteomic screens, in
order to uncover additional mediators that may be
excreted in the urine during the course of the disease.
One hopes that such urine-based proteomic studies
coupled with serum-based proteomics, as exemplified by
the recently reported “glomerular proteome arrays”
(42), may collectively pave the way toward a panel of
“biomarkers” that may help identify individuals at the
incipience of immune-mediated renal damage.
Finally, given the observation that at least some
of these molecules may play critical roles in the pathogenesis of nephritis, they also represent potential targets
for therapeutic intervention. Indeed, VCAM-1 has been
suggested as a potential therapeutic target in end-organ
disease (30,31), although antibody-mediated blocking in
experimental immune nephritis has not been very effective (32). Likewise, it has been suggested that glomerular
958
WU ET AL
disease may be amenable to therapy by blocking
P-selectin (16), although conflicting results have been
noted in experimental immune nephritis (37). Based on
the antibody-blocking studies described here, CXCL16
may turn out to be yet another therapeutic target in
immune nephritis. Finally, it remains to be seen whether
the coordinate blocking of 1 or more of these molecules
may offer therapeutic relief that is even more superior in
immune nephritis.
AUTHOR CONTRIBUTIONS
Dr. Mohan had full access to all of the data in the study and
takes responsibility for the integrity of the data and the accuracy of the
data analysis.
Study design. Wu, Xie, Mohan.
Acquisition of data. Wu, Xie, Bhaskarabhatla, Yan, Leone, Chen,
Zhou.
Analysis and interpretation of data. Wu, Xie, Putterman.
Manuscript preparation. Wu, Xie, Putterman, Mohan.
Statistical analysis. Wu, Xie.
REFERENCES
1. Masugi M. Glomerulonephritis durch das spezifische antinierenserum: ein Beitrag zur Pathogenese der diffusen Glomerulonephritis. Beitr Pathol Anat Allgemein Pathol 1934;92:429–66.
2. Xie C, Zhou XJ, Liu X, Mohan C. Enhanced susceptibility to
end-organ disease in the lupus-facilitating NZW mouse strain.
Arthritis Rheum 2003;48:1080–92.
3. Xie C, Sharma R, Wang H, Zhou XJ, Mohan C. Strain distribution
pattern of susceptibility to immune-mediated nephritis. J Immunol
2004;172:5047–55.
4. Hahn BH. Antibodies to DNA [review]. N Engl J Med 1998;338:
1359–68.
5. Lefkowith JB, Gilkeson GS. Nephritogenic autoantibodies in
lupus: current concepts and continuing controversies [review].
Arthritis Rheum 1996;39:894–903.
6. Fu Y, Xie C, Yan M, Li Q, Lu C, Mohan C. The lipopolysaccharide-triggered mesangial transcriptome: evaluating the role of
interferon regulatory factor-1. Kidney Int 2005;67:1350–61.
7. Zhu J, Liu X, Xie C, Yan M, Yu Y, Sobel ES, et al. T cell
hyperactivity in lupus as a consequence of hyperstimulatory antigen-presenting cells. J Clin Invest 2005;115:1869–78.
8. Nakatani K, Fujii H, Hasegawa H, Terada M, Arita N, Ito MR, et
al. Endothelial adhesion molecules in glomerular lesions: association with their severity and diversity in lupus models. Kidney Int
2004;65:1290–300.
9. Seron D, Cameron JS, Haskard DO. Expression of VCAM-1 in
the normal and diseased kidney. Nephrol Dial Transplant 1991;6:
917–22.
10. Wuthrich RP. Vascular cell adhesion molecule-1 (VCAM-1) expression in murine lupus nephritis. Kidney Int 1992;42:903–14.
11. Kappelmayer J, Nagy B Jr, Miszti-Blasius K, Hevessy Z, Setiadi H.
The emerging value of P-selectin as a disease marker. Clin Chem
Lab Med 2004;42:475–86.
12. Geng JG, Chen M, Chou KC. P-selectin cell adhesion molecule in
inflammation, thrombosis, cancer growth and metastasis. Curr
Med Chem 2004;11:2153–60.
13. Sfikakis PP, Charalambopoulos D, Vaiopoulos G, Mavrikakis M.
Circulating P- and L-selectin and T-lymphocyte activation and
patients with autoimmune rheumatic diseases. Clin Rheumatol
1999;18:28–32.
14. Segawa C, Wada T, Takaeda M, Furuichi K, Matsuda I, Hisada Y,
et al. In situ expression and soluble form of P-selectin in human
glomerulonephritis. Kidney Int 1997;52:1054–63.
15. Takaeda M, Yokoyama H, Segawa-Takaeda C, Wada T, Kobayashi K. High endothelial venule-like vessels in the interstitial
lesions of human glomerulonephritis. Am J Nephrol 2002;22:
48–57.
16. Matsuda M, Shikata K, Shimizu F, Suzuki Y, Miyasaka M,
Kawachi H, et al. Therapeutic effect of sulphated hyaluronic acid,
a potential selectin-blocking agent, on experimental progressive
mesangial proliferative glomerulonephritis. J Pathol 2002;198:
407–14.
17. Davas EM, Tsirogianni A, Kappou I, Karamitsos D, Economidou
I, Dantis PC. Serum IL-6, TNF␣, p55 srTNF␣, p75srTNF␣,
srIL-2␣ levels and disease activity in systemic lupus erythematosus.
Clin Rheumatol 1999;18:17–22.
18. Gabay C, Cakir N, Moral F, Roux-Lombard P, Meyer O, Dayer
JM, et al. Circulating levels of tumor necrosis factor soluble
receptors in systemic lupus erythematosus are significantly higher
than in other rheumatic diseases and correlate with disease
activity. J Rheumatol 1997;24:303–8.
19. Aten J, Roos A, Claessen N, Schilder-Tol EJ, Ten Berge IJ,
Weening JJ. Strong and selective glomerular localization of
CD134 ligand and TNF receptor-1 in proliferative lupus nephritis.
J Am Soc Nephrol 2000;11:1426–38.
20. Chandrasekar B, Bysani S, Mummidi S. CXCL16 signals via Gi,
phosphatidylinositol 3-kinase, Akt, I ␬ B kinase, and nuclear
factor-␬ B and induces cell-cell adhesion and aortic smooth muscle
cell proliferation. J Biol Chem 2004;279:3188–96.
21. Shimaoka T, Nakayama T, Fukumoto N, Kume N, Takahashi S,
Yamaguchi J, et al. Cell surface-anchored SR-PSOX/CXC chemokine ligand 16 mediates firm adhesion of CXC chemokine receptor
6-expressing cells. J Leuk Biol 2004;75:267–74.
22. Gough PJ, Garton KJ, Wille PT, Rychlewski M, Dempsey PJ,
Raines EW. A disintegrin and metalloproteinase 10-mediated
cleavage and shedding regulates the cell surface expression of
CXC chemokine ligand 16. J Immunol 2004;172:3678–85.
23. Tang T, Rosenkranz K, Assmann KJ, Goodman MJ, GutierrezRamos JC, Carroll MC, et al. A role for Mac-1 (CDllb/CD18) in
immune complex-stimulated neutrophil function in vivo: Mac-1
deficiency abrogates sustained Fc␥ receptor-dependent neutrophil
adhesion and complement-dependent proteinuria in acute glomerulonephritis. J Exp Med 1997;186:1853–63.
24. Hebert MJ, Takano T, Papayianni A, Rennke HG, Minto A,
Salant DJ, et al. Acute nephrotoxic serum nephritis in complement
knockout mice: relative roles of the classical and alternate pathways in neutrophil recruitment and proteinuria. Nephrol Dial
Transplant 1998;13:2799–803.
25. Suzuki Y, Shirato I, Okumura K, Ravetch JV, Takai T, Tomino Y,
et al. Distinct contribution of Fc receptors and angiotensin IIdependent pathways in anti-GBM glomerulonephritis. Kidney Int
1998;54:1166–74.
26. Clynes R, Dumitru C, Ravetch JV. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 1998;279:1052–4.
27. Le Hir M, Haas C, Marino M, Ryffel B. Prevention of crescentic
glomerulonephritis induced by anti-glomerular membrane antibody in tumor necrosis factor-deficient mice. Lab Invest 1998;78:
1625–31.
28. Janssen U, Ostendorf T, Gaertner S, Eitner F, Hedrich HJ,
Assmann KJ, et al. Improved survival and amelioration of nephrotoxic nephritis in intercellular adhesion molecule-1 knockout
mice. J Am Soc Nephrol 1998;9:1805–14.
VCAM-1, P-SELECTIN, TNFRI, AND CXCL16 IN NEPHRITIC URINE
29. Tesch GH, Schwarting A, Kinoshita K, Lan HY, Rollins BJ, Kelley
VR. Monocyte chemoattractant protein-1 promotes macrophagemediated tubular injury, but not glomerular injury, in nephrotoxic
serum nephritis. J Clin lnvest 1999;103:73–80.
30. Matsuyama T, Kitani A. The role of VCAM-1 molecule in the
pathogenesis of rheumatoid synovitis. Hum Cell 1996;9:187–92.
31. Foster CA. VCAM-1/␣ 4-integrin adhesion pathway: therapeutic
target for allergic inflammatory disorders [review]. J Allergy Clin
Immunol 1996;98(6 Pt 2):270–7.
32. Allen AR, McHale J, Smith J, Cook HT, Karkar A, Haskard DO,
et al. Endothelial expression of VCAM-1 in experimental crescentic nephritis and effect of antibodies to very late antigen-4 or
VCAM-1 on glomerular injury. J Immunol 1999;162:5519–27.
33. Spronk PE, Bootsma H, Huitema MG, Limburg PC, Kallenberg
CG. Levels of soluble VCAM-1, soluble ICAM-1, and soluble
E-selectin during disease exacerbations in patients with systemic
lupus erythematosus (SLE); a long term prospective study. Clin
Exp Immunol 1994;97:439–44.
34. Tipping PG, Huang XR, Berndt MC, Holdsworth SR. A role for P
selectin in complement-independent neutrophil-mediated glomerular injury. Kidney Int 1994;46:79–88.
35. Tipping PG, Huang XR, Berndt MC, Holdsworth SR. P-selectin
directs T lymphocyte-mediated injury in delayed-type hypersensitivity responses: studies in glomerulonephritis and cutaneous
delayed-type hypersensitivity. Eur J Immunol 1996;26:454–60.
36. Mayadas TN, Mendrick DL, Brady HR, Tang T, Papayianni A,
37.
38.
39.
40.
41.
42.
959
Assmann KJ, et al. Acute passive anti-glomerular basement membrane nephritis in P-selectin-deficient mice. Kidney Int 1996;49:
1342–9.
Rosenkranz AR, Mendrick DL, Cotran RS, Mayadas TN. Pselectin deficiency exacerbates experimental glomerulonephritis: a
protective role for endothelial P-selectin in inflammation. J Clin
Invest 1999;103:649–59.
Vielhauer V, Stavrakis G, Mayadas TN. Renal cell-expressed TNF
receptor 2, not receptor 1, is essential for the development of
glomerulonephritis. J Clin Invest 2005;115:1199–209.
Wolf D, Hallmann R, Sass G, Sixt M, Kusters S, Fregien B, et al.
TNF-␣-induced expression of adhesion molecules in the liver is
under the control of TNFR1: relevance for concanavalin A-induced hepatitis. J Immunol 2001;166:1300–7.
Kossodo S, Moore R, Gschmeissner S, East N, Upton C, Balkwill
FR. Changes in endogenous cytokines, adhesion molecules and
platelets during cytokine-induced tumour necrosis. Br J Cancer
1995;72:1165–72.
Zheng F, Cheng QL, Plati AR, Ye SQ, Berho M, Banerjee A, et
al. The glomerulosclerosis of aging in females: contribution of the
proinflammatory mesangial cell phenotype to macrophage infiltration. Am J Pathol 2004;165:1789–98.
Li QZ, Xie C, Wu T, Mackay M, Putterman C, Mohan C.
Glomerular proteome arrays: a novel approach to study glomerular-reactive autoantibodies in lupus. J Clin Invest 2005;115:
3428–39.
Документ
Категория
Без категории
Просмотров
1
Размер файла
249 Кб
Теги
potential, excreted, experimentov, urinary, mode, immune, animals, pathogens, nephritis, mediators, significance
1/--страниц
Пожаловаться на содержимое документа