close

Вход

Забыли?

вход по аккаунту

?

Expression of recombination activating genes 1 and 2 in peripheral B cells of patients with systemic lupus erythematosus.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 46, No. 5, May 2002, pp 1255–1263
DOI 10.1002/art.10264
© 2002, American College of Rheumatology
Expression of Recombination Activating Genes 1 and 2 in
Peripheral B Cells of Patients With Systemic Lupus Erythematosus
Hermann J. Girschick,1 Amrie C. Grammer,2 Toshihiro Nanki,2
Eduardo Vazquez,2 and Peter E. Lipsky2
Objective. To analyze immunoregulatory abnormalities in patients with systemic lupus erythematosus
(SLE) by assessing the expression of messenger RNA
(mRNA) for types 1 and 2 recombination activating
genes (RAG) in the peripheral blood of patients with
active SLE.
Methods. We examined B cell populations and
also individual B cells from patients with SLE for the
expression of RAG mRNA.
Results. Analysis of bulk mRNA indicated that
RAG1 and RAG2 mRNA were found routinely in peripheral B cells of patients with active SLE, but not in
healthy subjects. When assessed on a single-cell basis,
there was a 3-fold increase in the frequency of RAG1and RAG2-expressing B cells in SLE patients compared
with healthy subjects. Notably, B cells expressing both
RAG1 and RAG2 mRNA expressed only IgD mRNA, but
not IgG mRNA. Fifty percent of RAG-expressing B cells
also expressed VpreB mRNA, whereas all expressed
CD154 mRNA. Phenotypic analysis indicated that RAGexpressing B cells were activated, mature B cells.
Conclusion. These results indicate that RAG expression is up-regulated in peripheral IgDⴙ and
VpreBⴙ B cells of patients with active SLE. These cells
may contribute to the immunoregulatory abnormalities
in patients with SLE.
Numerous aberrations of the immune system
have been reported in systemic lupus erythematosus
(SLE) and have been implicated in the pathogenesis of
this autoimmune disease (1,2). Included in these abnormalities are immune-cell signaling defects resulting in
hyperactivity of B and T cells (3), hypomethylation of
DNA leading to abnormal autoreactive B cells (4), and
changes in the immunoglobulin repertoire of lupus B
cells leading to an increased number of B cell–producing
autoantibodies (5). In addition, enhanced mutational
activity of immunoglobulin genes has been implicated in
the pathogenesis of SLE (6–8). Although the causes of
autoantibody production have not been completely delineated, it has been suggested that one contributing
feature might be a failure of editing or revision of
autoreactive B cell receptors (BCRs) (5,9). On the other
hand, recent data suggest that receptor editing/revision
might be enhanced in patients with SLE (10,11).
V–D–J rearrangement of immune-receptor genes
is a feature of developing lymphocytes in the bone
marrow (12) and depends on recombination activating
gene (RAG) enzymes (13). RAG enzymes are expressed
at high levels during ontogeny, but their expression
diminishes in immature B cells and is usually absent in
recirculating, mature, naive B cells (14,15). However, we
(16) and others have demonstrated a marked reexpression of the RAG-encoding endonucleases RAG1 and
RAG2 during germinal center reactions in secondary
lymphoid organs (17–28). This has led to the proposal
that V–D–J editing/revision in secondary lymphoid organs might be a mechanism to rescue B cells whose
antigen receptor avidity has been decreased as a result
of somatic hypermutation or to rescue B cells in which
somatic mutation has generated autoreactivity (8,21). In
mice, in contrast to humans, peripheral transcription of
Supported by NIH grant AI-31229. Dr. Girschick is a recipient of a Deutsche Forschungsgemeinschaft grant, Gi-295/1-1. Dr.
Grammer’s work is supported by a grant from the Arthritis Foundation.
1
Hermann J. Girschick, MD (current address: Children’s
Hospital, University of Wuerzburg, Wuerzburg, Germany): University
of Texas Southwestern Medical Center, Dallas; 2Amrie C. Grammer,
PhD, Toshihiro Nanki, MD, Eduardo Vazquez, BS, Peter E. Lipsky,
MD: National Institute of Arthritis and Musculoskeletal and Skin
Diseases, NIH, Bethesda, Maryland.
Drs. Girschick and Grammer contributed equally to this work.
Address correspondence and reprint requests to Peter E.
Lipsky, MD, Scientific Director, NIAMS, National Institutes of
Health, 9000 Rockville Pike, Building 10, Room 9N228, Bethesda, MD
20892-1820. E-mail: lipskyp@mail.nih.gov.
Submitted for publication October 22, 2001; accepted in
revised form January 11, 2002.
1255
1256
GIRSCHICK ET AL
RAG genes is strictly limited and found only in B cell
precursor cells and transitional cells that have left the
bone marrow and were completing maturation in the
spleen, but not in peripheral blood or other lymphoid
organs (29,30). Thus, the potential for revision of a BCR
seems to be tightly regulated in normal animals, and
might be different in mice and humans.
In humans, small populations of normal B cells in
the peripheral blood have been reported to express
RAG messenger RNA (mRNA) (16,31). We have reported that RAG-expressing peripheral B cells are
postswitch IgG⫹ B cells (16), whereas others have
reported that these B cells also express the surrogate
light chain VpreB component (31). Some of these
VpreB⫹ B cells might be recent bone marrow immigrants still expressing RAGs and VpreB, as has been
demonstrated in the mouse (29,30). Alternatively, reexpression of the surrogate light chain has recently been
demonstrated in tonsillar germinal center B cells, suggesting a physiologic role of VpreB in peripheral B cell
development (16). Consistent with this conclusion is the
recent report of VpreB expression in CD27⫹ memory B
cells with mutated IgVH genes (31), consistent with the
conclusion that this molecule might be up-regulated
during activation of human memory B cells.
RAG-mediated receptor editing/revision has
been documented as an important means to avoid
autoimmunity in transgenic animals (27,32–36). Similarly, enhanced peripheral receptor editing/revision has
been reported to occur in patients with active SLE as an
attempt to avoid autoimmunity (8,11). Whether overexpression of RAG is associated with enhanced peripheral
receptor editing/revision in patients with active SLE
remains to be determined.
In order to investigate whether there is abnormal
RAG expression in patients with active SLE, RAG
mRNA expression in peripheral blood B cells of SLE
patients was investigated. Compared with healthy subjects, a 3-fold increase of RAG1- and RAG2-mRNA–
expressing B cells was documented in SLE patients. In
contrast to healthy subjects, who expressed RAGs in
postswitch memory B cells, SLE patients expressed
RAGs in IgD⫹ preswitch, mature B cells that exhibited
an activated, mature phenotype.
PATIENTS AND METHODS
Preparation of B cells from peripheral blood. Peripheral blood mononuclear cells (PBMCs) were separated by
Ficoll-Hypaque density gradient centrifugation from the heparinized peripheral blood of 9 patients with active SLE and 14
healthy donors. The patients fulfilled the revised criteria for
classification of SLE (37).
Because of the small amount of blood available from
patients with active SLE, B cells were directly purified by flow
cytometric cell sorting. To accomplish this, B cells from the
SLE patients (n ⫽ 9) were stained for surface expression of
CD19 using a biotinylated anti-human CD19 mononuclear
antibody (mAb) (Coulter, Miami, FL) followed by
Streptavidin-RED670 (Life Technologies, Gaithersburg, MD)
or antigen-presenting cell (APC)–conjugated anti-CD19 mAb
(Becton Dickinson, San Jose, CA), and were isolated from
PBMCs with a FACStarPlus or FACS Vantage flow cytometer
(Becton Dickinson). Postsort analysis of isolated B cell populations revealed a purity of ⬎98%.
Single-cell sorting. Individual CD19⫹ B cells of SLE
patients 4, 6, 7, and 8 were sorted into 96-well polymerase
chain reaction (PCR) plates (Robbins Scientific, Sunnyvale,
CA) using a FACStarPlus flow cytometer (Becton Dickinson)
outfitted with a single-cell deposition unit, as described previously (38). In some cases, cells were sorted in bulk and then
deposited manually by limiting dilution.
Preparation of RNA and complementary DNA (cDNA)
from sorted bulk populations. Total RNA was extracted using
the RNeasy RNA isolation kit (Qiagen, Chatsworth, CA).
From each patient, 0.1 ⫻ 106 sorted B cells were used for RNA
preparation. Contaminating genomic DNA was removed using
RQ1 RNase-free DNAse according to the manufacturer’s
instructions (Promega, Madison, WI). For conversion of
mRNA into cDNA, Superscript II RNase H–reverse transcriptase (RT) (Life Technologies) was used according to the
manufacturer’s instructions. One sample of each RNA was
prepared by omitting the RT, and this was used as a control. In
addition, RNA preparations from synovial fibroblasts were
used as negative controls. The latter did not yield a product
when amplified for RAG mRNA.
Preparation of RNA and cDNA from sorted single
cells. Five microliters of lysis solution (1 ␮l of 5⫻ first-strand
buffer B [Life Technologies], 0.01M dithiotureitol [Life Technologies], 1% Nonidet-P40 [Sigma, St. Louis, MO], 5 ␮l of
recombinant RNasin ribonuclease inhibitor [Promega], 800
␮M each of dATP, dCTP, dGTP, and dTTP [Sigma], 0.05 ␮g
oligod(T)12-18 [Pharmacia Biotech, Piscataway, NJ]) were
added into each well of the PCR plate before sorting individual
cells into the wells. The conversion of mRNA from a single cell
was carried out with Superscript II RNase H–RT (Life Technologies) as described previously (16,39).
PCR amplification. The relative amount of RAG1-,
RAG2-, TdT-, IgD-, IgG-, VpreB-, 14.1-, and CD154-encoding
cDNA in the different samples was determined by amplification of ␤-actin–adjusted samples using the PCR Southern
technique (16). The primer pairs used are listed in Table 1. In
the first round of PCR, 35 cycles of 30 seconds at 94°C, 1
minute at 60°C, and 2 minutes at 72°C with a final 5-minute
extension at 72°C were carried out. A second nested step of
PCR was performed in the analysis of cDNA generated from
single cells. Five microliters of the first PCR product was
subjected to nested PCR amplification, using primers as indicated in Table 1. For analysis of human RAG2 mRNA, two
different 5⬘ primers for the alternative exon 1A and exon 1B
RAG1 AND RAG2 EXPRESSION IN SLE
Table 1.
DNA
1257
Sequences of oligonucleotides used as primers for the amplification of complementary
␤-actin
Sense
Antisense
Nested sense
Nested antisense
RAG1*
Sense
Antisense
Nested sense
Nested antisense
RAG2*
Exon 1A sense
Exon 1B sense
Antisense
Nested sense
Nested antisense
TdT
Sense
Antisense
VpreB
Sense
Antisense
Nested sense
Nested antisense
14.1
Sense
Antisense
Total IgD
Sense
Antisense
Nested sense
Nested antisense
Total IgG
Sense
Antisense
Nested sense
Nested antisense
5⬘GTCCTCTCCCAAGTCCACACA3⬘
5⬘CTGGTCTCAAGTCAGTGTACAGGTAA3⬘
5⬘GTCCTCTCCCAAGTCCACACA3⬘
5⬘CTCAAGTTGGGGGACAAAAAG3⬘
5⬘GAGCAAGGTACCTCAGCCAG3⬘
5⬘AACAATGGCTGAGTTGGGAC3⬘
5⬘TTCTGCCCCAGATGAAATTC3⬘
5⬘TGACCATCAGCCTTGTCCAG3⬘
5⬘GCAGCCCCTCTGGCCTTC3⬘
5⬘GCGGTCTCCAGACAAAAATC3⬘
5⬘TTTCAGACTCCAAGCTGCCT3⬘
5⬘TCTCTGCAGATGGTAACAGTCAG3⬘
5⬘AGCGAAGAGGAGGGAGGTAG3⬘
5⬘ACTTGAGCCCTCGGAAGAAG3⬘
5⬘TTCCCTGCTCCTATGCATTC3⬘
5⬘TGCACAGTTGTGGTCCTCAG3⬘
5⬘TCTCCCTCTCCTCCTTCTCC3⬘
5⬘AGTTGTGGTCCTCAGCCG3⬘
5⬘GATGTCATGGTCGTTCCTCA3⬘
5⬘GTAACCCATGGCCTGCTG3⬘
5⬘CGCGTACTTGTTGTTGCTCT3⬘
5⬘GGTACATGGGGACACAGAGC3⬘
5⬘CTGCAGGGGTTAGCAGGTAG3⬘
5⬘ACCGCCAGCAAGAGTAAGAA3⬘
5⬘CTGCAGGGGTTAGCAGGTAG3⬘
5⬘GCTGCCTGGTCAAGGACTAC3⬘
5⬘CATCACGGAGCATGAGAAGA3⬘
5⬘TTCCCCCCAAAACCCAAGGA3⬘
5⬘CATCACGGAGCATGAGAAGA3⬘
* RAG ⫽ recombination activating gene.
were used. The RAG1 sense primer was partly spanning the
intron, since 7 nucleotides lay in exon 1 and 15 nucleotides in
exon 2. The RAG2-1A sense primer completely spanned the
intron, and the RAG2-1B primer partly spanned the intron,
since 15 nucleotides lay in exon 1 and 8 nucleotides in exon 2.
The same primers have been used previously and their specificity for RAG mRNA documented (16).
Control samples of each preparation prepared without
RT were run in parallel and were negative for the presence of
contaminating DNA. PCR reactions without added cDNA
were also run in parallel and did not yield a product. In
addition, analysis of cDNA from individual synovial fibroblasts
did not yield a product with RAG-specific primers. Thus, RAG
amplification from genomic DNA was excluded.
Detection of amplified cDNA by PCR Southern analysis. Quantification of cDNA in the different bulk samples was
carried out as previously described (16). Initially, PCR amplification for the housekeeping gene ␤-actin was carried out in
triplicate using 20, 25, 30, and 35 PCR cycles. RT-PCR
products were analyzed on a 1.8% agarose gel and transferred
to a nylon membrane by alkaline vacuum transfer (Bio-Rad,
Hercules, CA). PCR Southern blots were incubated in hybridization buffer containing ␥32P-labeled probes for ␤-actin PCR
products, as listed in Table 2. The amount of hybridized probe
for the housekeeping gene was then quantified by PhosphorImager. The linear range of PCR was determined by plotting
the amount of PhosphorImager counts (above background
levels) of the hybridized probe as a function of the number of
Table 2. Sequences of oligonucleotides used for the detection of
polymerase chain reaction products by Southern blotting
␤-actin
RAG1*
RAG2*
TdT
VpreB
14.1
IgD
IgG
CD154
5⬘CTCAAGTTGGGGGACAAAAAG3⬘
5⬘TCTCTGGAGCAATCTCCAGCA3⬘
5⬘TTCCATCTGGATGTAAAGCAT3⬘
5⬘TCCAAAATGAAGACGACCAA3⬘
5⬘CTTGGAACCACAATCCGC3⬘
5⬘AAGGCTACGCTGGTGTGTCT3⬘
5⬘CCTGATGTGGCTGGAGGACCA3⬘
5⬘GGGTGTACACCTGTGGTTCT3⬘
5⬘TTATGAGGAGTGGGCAGGCTCAG3⬘
* RAG ⫽ recombination activating gene.
1258
GIRSCHICK ET AL
cycles. The mean counts of these triplicates in the linear range
of PCR amplification were calculated and were used to
calculate an amount of cDNA (in ␮l) of each preparation that
contained the same relative content of housekeeping gene
cDNA. This calculated volume of cDNA was subjected to
further PCR amplification for specific cDNA (40).
The amplified PCR products were again analyzed by
agarose gel electrophoresis and transferred to a nylon membrane and blotted. The number of PCR cycles in which the
PCR product was amplified in a linear range was again
determined for each primer set, as described above for housekeeping genes. After hybridization using specific probes (Table
2), the amount of hybridized probe was quantified by
PhosphorImager and visualized by exposure of the hybridized
nylon membrane to a photographic emulsion.
Flow cytometric analysis. Subsets of peripheral blood
B cells were delineated by staining PBMCs for 30 minutes
on ice with mAb specific for CD19 (phycoerythrin [PE]–
labeled [Becton Dickinson]; Tri color–labeled [Caltag, South
San Francisco, CA]), IgD (fluoroscein isothiocyanate–labeled
[Caltag]; biotinylated [PharMingen, San Diego, CA]; followed
by streptavidin PE [Becton Dickinson]), IgM (PE-labeled
[Caltag]), CD154 (PE-labeled [Becton Dickinson]) (41), CD69
(PE-labeled [Becton Dickinson]), and CD38 (APC-labeled
[Becton Dickinson]). Isotype-matched antibodies were used as
controls. Analysis was performed with a FACS Calibur flow
cytometer using CellQuest and Paint-a-Gate software (Becton
Dickinson).
RESULTS
RAG1, RAG2, TdT, VpreB, 14.1, and CD154
mRNA expression in bulk cDNA from peripheral B cells
of SLE patients. RAG1 mRNA was uniformly expressed
in B cell populations from all patients with active SLE
(Figures 1A and B). RAG2 mRNA was found in 5 of 9
patients with active SLE. Using the same PCR technique, RAG1 mRNA expression was not detectable in
peripheral blood B cells from 14 normal subjects,
whereas RAG2 mRNA was found in only 3 of 14 normal
donors (16). One of 9 SLE patients exhibited TdT
mRNA expression, whereas 6 of 9 SLE mRNA preparations were positive for VpreB mRNA, and 4 of 9 SLE
samples were positive for the surrogate (␺) light chain
constant region encoding human gene 14.1. By comparison, normal B cell populations were rarely positive for
TdT, VpreB, and 14.1 mRNA (Table 3).
CD154 expression has been demonstrated by
normal tonsil B cells, B cell lines, and activated peripheral blood B cells and has been implicated in homotypic B cell activation during germinal center B cell
development (41–42). Moreover, CD154 has been reported to be expressed by circulating B cells of patients
with active SLE (43,44). Therefore, we analyzed the
current group of patients with active SLE for B cell
Figure 1. A, Expression of types 1 and 2 recombination activating
genes (RAG1 and RAG2), TdT, surrogate light chain (VpreB and
14.1), and CD154 mRNA in peripheral B cells of 9 patients with active
systemic lupus erythematosus (SLE). CD19⫹ peripheral B cells from
the peripheral blood of 9 patients with active SLE and from 14 healthy
donors were sorted with a FACS Vantage flow cytometer. Specific
mRNA for RAG1, RAG2, TdT, surrogate light chain (VpreB and
14.1), and CD154 were amplified as described in Patients and Methods, and reverse transcriptase–polymerase chain reaction (RT-PCR)
products were detected by Southern hybridization. As positive controls, extractions of mononuclear cell mRNA were isolated from the
thymus (lane A), from the peripheral blood of a preB-leukemia patient
(lane B), and from a tonsil (lane C). RT-PCR using “RT⫺ only”
controls (lanes D and E) and a “no cDNA” control (lane F) was
performed for all samples and did not yield a product. B, The amount
of hybridized RAG1 and RAG2 probe in samples from SLE patients
and healthy individuals was quantified by PhosphorImager and normalized against the amount of probe detected in human tonsil, with
results shown as the percentage of expression.
expression of CD154. Notably, 7 of 9 SLE B cell samples
exhibited CD154 mRNA expression.
RAG1, RAG2, IgG, and IgD mRNA expression by
individual peripheral B cells of SLE patients. Analysis
of individual peripheral blood B cells from 3 SLE
RAG1 AND RAG2 EXPRESSION IN SLE
1259
patients (patients 4, 6, and 8) indicated that variable
percentages (mean 23%) of cells in each patient expressed RAG1 mRNA (Figure 2). The frequency of
RAG2 mRNA–expressing B cells ranged from 17% to
48% (mean 32%). Only the coordinate action of RAG1
and RAG2 together can lead to recombination of the
BCR (45). Therefore, the frequency of B cells expressing
RAG1 plus RAG2 mRNA was analyzed. As shown in
Figure 2, 3–10% of individual SLE B cells manifested
coordinate RAG1 and RAG2 mRNA expression (mean
8%), a frequency that was higher than in CD19⫹ B cells
of healthy individuals (⬍3%).
To assess the stage of maturation of the B
cells expressing RAG1 plus RAG2 mRNA, IgG and
IgD mRNA were examined in these individual cells
to determine whether they were pre- or postswitch B
cells. Few IgG mRNA–expressing cells were detected
in SLE patients 4, 6, and 8, in contrast to an abundance
of IgD mRNA–expressing cells (mean 44% of ␤-actin–
positive cells). This predominance of IgD mRNA–
expressing B cells was consistent with the expression
of surface immunoglobulins analyzed by immunostaining and fluorescence-activated cell sorter analysis
(mean ⫾ SEM 73 ⫾ 14% IgM⫹,IgD⫹ and 21 ⫾ 1%
IgM⫹,IgD⫺). From 33% to 66% of RAG1 plus
RAG2 mRNA–positive B cells expressed IgD mRNA
(mean 50%). No coordinate RAG1 and RAG2 mRNA
expression was found in IgG mRNA–positive cells
(Figure 2).
Table 3. Comparison of RAG1, RAG2, TdT, VpreB, 14.1, and
CD154 mRNA expression by B cell preparations from healthy individuals and systemic lupus erythematosus (SLE) patients, as defined by
semiquantitative polymerase chain reaction and Southern blotting*
mRNA
type
Healthy individuals
(n ⫽ 14)
SLE patients
(n ⫽ 9)
RAG1
RAG2
TdT
VpreB
14.1
CD154
0 (0)
3 (21)
0 (0)
2 (14)
0 (0)
ND
9 (100)
5 (56)
1 (11)
6 (67)
4 (44)
7 (77)
* CD19⫹ peripheral B cells from the SLE patients were sorted with a
FACS Vantage flow cytometer. Specific mRNA for types 1 and 2
recombination activating genes (RAG1 and RAG2), TdT, surrogate
light chain, and CD154 were amplified as described in Patients and
Methods, using comparable amounts of total RNA. Reverse
transcriptase–polymerase chain reaction products were detected by
Southern blot hybridization. The number (%) of mRNA-positive B cell
preparations is shown. The results from the healthy individuals were
previously reported (16). ND ⫽ not done.
Figure 2. Expression of RAG1, RAG2, IgG, and IgD mRNA in
individual peripheral B cells of SLE patients. Individual CD19⫹ B
cells from 3 patients with active SLE were analyzed. Only ␤-actin
mRNA–positive cells were considered for analysis of the frequency of
RAG1- and RAG2-mRNA–containing cells. The frequency of
RAG1⫹, RAG2⫹, RAG1⫹ and RAG2⫹, IgD⫹, and IgG⫹ cells, as
well as the frequency of IgD⫹ or IgG⫹ cells in the RAG1- and
RAG2-expressing cells, were determined in the various subsets. The
frequency of IgD⫹ and IgG⫹ cells in the RAG1⫹,RAG2⫹ cells was
calculated as (RAG1⫹ ⫹ RAG2⫹ ⫹ Ig⫹)/(RAG1⫹ ⫹ RAG2⫹) ⫻
100. See Figure 1 for definitions.
RAG1, RAG2, VpreB, and CD154 mRNA expression by individual peripheral B cells of an SLE patient.
In patient 7, we investigated the expression of RAG1,
RAG2, VpreB, and CD154 mRNA in individual peripheral B cells (Figure 3). Ten percent of B cells were
positive for RAG1 and RAG2 mRNA. Fifty percent of
these cells were VpreB mRNA positive. Notably, all
double-RAG–positive cells were positive for CD154.
1260
GIRSCHICK ET AL
Figure 3. Expression of RAG1, RAG2, VpreB, and CD154 mRNA by
individual peripheral B cells of an SLE patient. Individual CD19⫹ B
cells from 1 patient with active SLE were analyzed. Only ␤-actin
mRNA–positive cells were considered in the analysis of the frequency
of RAG1- and RAG2-mRNA–containing cells. The frequency of
RAG1⫹, RAG2⫹, RAG1⫹ and RAG2⫹, VpreB⫹, and CD154⫹ B
cells and the frequency of VpreB⫹ or CD154⫹ cells in the RAG1- and
RAG2-expressing B cells was determined in the various subsets. The
frequency of VpreB⫹ or CD154⫹ cells in the RAG1⫹,RAG2⫹ cells
was calculated as (RAG1⫹ ⫹ RAG2⫹ ⫹ VpreB⫹ or CD154⫹)/
(RAG1⫹ ⫹ RAG2⫹) ⫻ 100. See Figure 1 for definitions.
Identification of RAG1ⴙ, RAG2ⴙ, CD19ⴙ,
IgDⴙ cells in SLE as activated, mature B cells. As
shown in representative samples in Figure 4, the majority of IgM⫹,IgD⫹ cells in SLE expressed CD154
(mean ⫾ SEM 84 ⫾ 21%), whereas few normal B cells
expressed this marker (mean ⫾ SEM 7 ⫾ 2%). In SLE,
CD154⫹, preswitch IgD⫹ SLE B cells that expressed
mRNA for both RAG1 and RAG2 coexpressed IgM and
markers of activation (Figure 4). IgM⫹,IgD⫹ SLE
CD19⫹ B cells coexpressed CD69 (mean ⫾ SEM 76 ⫾
22%) and CD38 (69 ⫾ 10%), whereas only a few cells of
this subset from healthy individuals expressed CD69
(mean ⫾ SEM 9 ⫾ 3%) or CD38 (8 ⫾ 3%). Although
differing in activation status, the percentage of
IgM⫹,IgD⫹ B cells in peripheral blood CD19⫹ B cells
was similar for healthy volunteers (mean ⫾ SEM 82 ⫾
5%) and SLE patients (73 ⫾ 14%).
DISCUSSION
By using a combination of flow cytometric cell
sorting and RT-PCR analysis, the expression of RAG
mRNA by peripheral blood B cells of SLE patients was
examined. When bulk preparations of mRNA were
analyzed, RAG1 transcripts were routinely detected in
all patients, whereas RAG2 transcripts were detected in
5 of 9 patients. Using the same technique, none of the 14
normal B cell mRNA preparations expressed RAG1 and
only 3 of 14 were positive for RAG2 mRNA. In addition,
VpreB expression was up-regulated in SLE B cells.
Comparable differences were noted when individual B cells were analyzed. Three times more SLE B
cells than normal peripheral blood B cells expressed
both types of RAG mRNA, and they were exclusively
IgD mRNA positive. Further analysis in another SLE
patient demonstrated that 50% of double-RAG–positive
cells were VpreB mRNA positive, and 100% were
CD154 mRNA positive.
Flow cytometric analysis of IgD⫹ SLE B cells
revealed that the majority of these cells were CD154
positive (for review, see ref. 46). Moreover, the IgD⫹ B
cell subset in SLE coexpressed the activation markers
CD69 and CD38. These data suggest that RAG1⫹,
RAG2⫹,IgD⫹ SLE B cells are mature B cells that have
undergone activation in vivo. Moreover, additional detailed phenotyping of IgM⫹,IgD⫹ B cells in these
patients indicated that nearly all were CD27⫹ memory
cells (data not shown). The previous finding that more
than 95% of the Ig VH genes expressed by SLE B cells in
the IgD⫹,CD27⫹ subset were somatically mutated (47)
is further evidence that this subpopulation contains
mature memory B cells.
Although peripheral blood B cells expressing
mRNA for VpreB have been detected in healthy donors
(31), the frequency of these cells (0.5–1%) is much lower
than that observed in SLE patients (8%). It has been
demonstrated that this peripheral VpreB⫹ B cell population is positive for RAG1 and RAG2 mRNA. However, the frequency of RAG1⫹,RAG2⫹ B cells in this
population is unknown (31). Recent work has demonstrated coordinate RAG mRNA expression in up to 3%
of IgG⫹ individual normal peripheral B cells, but not in
IgD⫹ B cells from healthy donors (16). This observation
is in contrast to our finding in SLE patients, in which
IgD⫹, but not IgG⫹, peripheral blood B cells coexpressed RAG1, RAG2, and VpreB. The suggestion has
been made that VpreB⫹,RAG1⫹,RAG2⫹ B cells observed in the periphery or in secondary lymphoid tissues
of mice are immature B cells that have left the bone
marrow prematurely in response to inflammation or a
dysfunction of the bone marrow–blood barrier (48). The
latter could occur in SLE following induction of endothelial cell apoptosis by lupus anticoagulant autoantibodies (49) or a disruption of endothelial integrity by
autoantibodies to vascular antigens (50,51). In contrast
to the induction of increased numbers of immature B
cells in the periphery following adjuvant challenge in
mice (48), however, the current data clearly show that
RAG1 AND RAG2 EXPRESSION IN SLE
1261
Figure 4. Abnormal expression of activation antigens in subsets of CD19⫹, IgM⫹, IgD⫹ peripheral blood B
cells from systemic lupus erythematosus (SLE) patients. Freshly isolated peripheral blood mononuclear cells
from SLE patients (B, C, and D) and a normal volunteer (A) were assessed for expression of CD19, IgM, and IgD
as well as the activation antigens CD154, CD69, and CD38. Following staining with fluorochrome-conjugated
monoclonal antibodies, CD19⫹, IgM⫹, IgD⫹ cells were gated and were assessed for expression of the various
activation antigens. Shown are the patterns of IgM and IgD expression as well as activation antigen expression
by the gated population. Bars on histograms from the gated CD19⫹, IgM⫹, IgD⫹ B cell population delineate
positive staining for IgM, IgD, and each activation antigen using isotype-matched antibodies as controls. The
mean fluorescence intensity of the cells expressing the activation antigen and the percentage of CD19⫹, IgM⫹,
IgD⫹ B cells that are positive are listed to the right of each histogram. Histograms for activation antigens
expressed by normal adult CD19⫹, IgM⫹, IgD⫹ B cells are representative of samples from 2 different normal,
healthy volunteers.
the SLE patients examined in this study have activated,
mature B cells in their blood that coexpress RAG1,
RAG2, and surrogate light chain.
The current data also demonstrate that expression of RAG-encoded proteins is up-regulated in SLE B
cells, although it remains to be determined whether
these proteins are enzymatically active. Functional expression of RAG genes has been shown to lead to
receptor editing/replacement of surface immunoglobulin. In this regard, previously published studies have
observed evidence of receptor editing/replacement in
both V␬ and V␭ chains from patients with active SLE
(10,11). Although the signals required for RAG expression have not been completely delineated, induction of
RAG expression in B cells is initiated by engaging
surface immunoglobulin (sIg) (52–54) and maintained
by engaging CD40 (18,31) possibly by a B cell lineage–
specific activator protein/paired box gene 5 (BSAP)–
dependent mechanism (55). This mechanism of RAG
induction may be a critical factor in SLE B cells that may
have been stimulated through sIg by autoantigens and
through CD40 by abnormally expressed CD154 on adjacent B cells or on activated T cells (43,44,56). Of note,
engaging sIg on B cells that are already positive for
RAGs, such as immature B cells or activated B cells,
results in a down-regulation of RAG expression (26).
SLE B cells may not have received this down-regulatory
signal or may be resistant to it.
Recent data have demonstrated that the human
RAG2 promoter, which, in contrast to the mouse pro-
1262
GIRSCHICK ET AL
moter, regulates the expression of both RAG1 and
RAG2, is regulated in both lymphoid and nonlymphoid
cells and is differentially regulated in T and B cells (57).
This B cell regulatory region is homologous to the
mouse RAG2 promoter. The T cell–specific factors that
directly regulate RAG2 are c-myb (58) and GATA-3
(59). B cell–specific regulation of RAG2 involves BSAP
through a transactivation mechanism (50,57,60). RAG2
protein expression is restricted to cells in G1/G0 because
of posttranscriptional degradation in the S/G2/M phase
of mitosis (60). Importantly, and perhaps explaining the
coordinate regulation of RAGs and VpreB, BSAP is also
involved in regulation of the VpreB promoter (61). As
an additional regulatory region, the RAG1 promoter,
which regulates only RAG1 expression, is activated by
nuclear transcription factor Y in a manner that is not
lymphoid specific (62). Differential activity of RAG1
and RAG2 promoter regions may contribute to the
uncoordinated expression of the RAG enzymes in
healthy subjects (16) and SLE patients.
In summary, the use of standard and single-cell
RT-PCR analysis and flow cytometric evaluation has
demonstrated a significant increase in the frequency of
RAG1- and RAG2-mRNA⫹ B cells in the peripheral
blood of SLE patients. RAG-expressing B cells also
contained IgD, VpreB, and CD154 mRNA. The phenotype of these cells indicates that they are activated,
mature B cells. Circulating mature B cells of patients
with SLE, therefore, reexpress RAG enzymes after
cellular activation, potentially becoming capable of receptor revision.
ACKNOWLEDGMENTS
The technical assistance of Bonnie Darnell, Angie
Mobley, Rehana Hussain, Michelle McGuire, Christine Pavlovitch, Skip Lightfoot, and Gretchen Vinson is greatly appreciated. We thank Dr. Richard McFarland, Dr. Erdal Diri, and
Dr. Gabor Illei for providing patient samples, and Dr. Marlyn
Mayo, Dr. Laurie Davis, Dr. Kathryn Meek, Dr. Nancy Farner,
Dr. Jisoo Lee, Dr. Sule Yavuz, and Dr. Kenji Hayashida for
helpful discussions.
REFERENCES
1. Tsokos GC. Overview of cellular immune function in systemic
lupus erythematosus. In: Lahita RG, editor. Systemic lupus erythematosus. 3rd ed. London (UK): Academic Press; 1998. p.
17–54.
2. Grammer AC, Doerner T, Lipsky PE. Abnormalities in B cell
activity and the immunoglobulin repertoire in human SLE. In:
Theofilopoulos AN, Bona CA, eds. Molecular pathology of autoimmune diseases. Langhorne (PA): Gordon and Breach Science
Publishers; 2001. p. 282–318.
3. Tsokos GC, St. Liossis C. Immune cell signaling defects in lupus:
activation, anergy and death. Immunol Today 1999;20:119–24.
4. Tonegawa S. Somatic generation of antibody diversity. Nature
1983;302:575–81.
5. Bensimon C, Chastagner P, Zouali M. Human lupus anti-DNA
autoantibodies undergo essentially primary V␬ gene rearrangements. EMBO J 1994;13:2951–62.
6. Diamond B, Katz JB, Paul E, Aranow C, Lustgarten D, Scharff
MD. The role of somatic mutation in the pathogenic anti-DNA
response. Annu Rev Immunol 1992;10:731–57.
7. Isenberg DA, Ehrenstein MR, Longhurst C, Kalsi JK. The origin,
sequence, structure, and consequences of developing anti-DNA
antibodies: a human perspective. Arthritis Rheum 1994;37:
169–80.
8. Doerner Th, Heimbaecher C, Farner NL, Lipsky PE. Enhanced
mutational activity of V␬ gene rearrangements in systemic lupus
erythematosus. Clin Immunol 1999;92:188–96.
9. Suzuki N, Mihara S, Sakane T. Development of pathogenic
anti-DNA antibodies in patients with systemic lupus erythematosus. FASEB J 1997;11:1033–8.
10. Doerner Th, Farner NL, Lipsky PE. Ig ␭ and heavy chain usage in
early untreated sustemic lupus erythematosus suggests intensive B
cell stimulation. J Immunol 1999;163:1027–36.
11. Doerner Th, Foster SJ, Farner NL, Lipsky PE. Immunoglobulin
kappa chain receptor editing in systemic lupus eruthematosus.
J Clin Invest 1998;102:688–94.
12. Tonegawa S. Somatic generation of antibody diversity. Nature
1983;302:575–81.
13. Grawunder U, Leu TMJ, Schatz DG, Werner A, Rolink AG,
Melchers F, et al. Downregulation of RAG1 and RAG2 gene
expression in preB cells after functional immunoglobulin heavy
chain rearrangement. Immunity 1995;3:601–8.
14. Constantinescu A, Schlissel MS. Changes in locus-specific V(D)J
recombinase activity induced by immunoglobulin gene products
during B cell development. J Exp Med 1997;185:609–20.
15. Hertz M, Nemazee D. Receptor editing and commitment in B
lymphocytes. Curr Opin Immunol 1998;10:208–13.
16. Girschick HJ, Grammer AC, Nanki T, Mayo M, Lipsky PE. RAG1
and RAG2 expression by B cell subsets from human tonsil and
peripheral blood. J Immunol 2001;166:377–86.
17. Tarlington D. Germinal centers: a second childhood for lymphocytes. Curr Biol 1997;7:R155–R159.
18. Hikida M, Mori M, Takai T, Tomochika K, Hamatani K, Ohmori
H. Reexpression of RAG-1 and RAG-2 genes in activated mature
mouse B cells. Science 1996;274:2092–4.
19. Han S, Zheng B, Schatz DG, Spanopoulou E, Kelsoe G. Neoteny
in lymphocytes: RAG1 and RAG2 expression germinal center B
cells. Science 1996;274:2094–7.
20. Papavasiliou F, Casellas R, Suh H, Qin X-F, Besmer E, Pelanda R,
et al. V(D)J recombination in mature B cells: a mechanism for
altering antibody responses. Science 1997;278:298–300.
21. Han S, Dillon SR, Zheng B, Shimoda M, Schlissel MS, Kelsoe G.
V(D)J recombinase activity in a subset of germinal center B
lymphocytes. Science 1997;278:301–5.
22. Ohmori H, Hikida M. Expression and function of recombination
activating genes in mature B cells. Critical Reviews in Immunology
1997;18:221–35.
23. Liu Y-J. The reuse of B lymphocytes in germinal centers. Science
1997;278:238–9.
24. Nemazee D. Can receptor editing play an important role in normal
B-cell development? J Autoimmunity 1996;9:259–61.
25. Giachino C, Padovan E, Lanzavecchia A. Re-expression of RAG-1
and RAG-2 genes and evidence for secondary rearrangements in
human germinal center B lymphocytes. Eur J Immunol 1998;28:
3506–13.
26. Meffre E, Papavasiliou F, Cohen P, de Bouteiller O, Bell D,
Karasuyama H, et al. Antigen receptor engagement turns off the
RAG1 AND RAG2 EXPRESSION IN SLE
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
V(D)J recombination machinery in human tonsil B cells. J Exp
Med 1998;188:765–72.
Radic MZ, Erikson J, Litwin S, Weigert M. B lymphocytes may
escape tolerance by revising their antigen receptors. J Exp Med
1993;177:1165–73.
Retter MW, Nemazee D. Receptor editing occurs frequently
during normal B cell development. J Exp Med 1998;188:1231–8.
Yu W, Nagaoka H, Jankovic M, Misulovin Z, Suh H, Rolink A, et
al. Continued RAG expression in late stages of B cell development
and no apparent re-induction after immunization. Nature 1999;
400:682–7.
Monroe RJ, Seidl KJ, Gaertner F, Han S, Chen F, Sekiguchi J, et
al. RAG2:GFP knockin mice reveal novel aspects of RAG2
expression in primary and peripheral lymphoid tissues. Immunity
1999;11:201–12.
Meffre E, Davis E, Schiff C, Cunnigham-Rundles C, Ivashkiv LB,
Staudt LM, et al. Circulating human B cells that express surrogate
light chains and edited receptors. Nature Immunol 2000;1:207–13.
Tiegs SL, Russell DM, Nemazee D. Receptor editing in selfreactive bone marrow B cells. J Exp Med 1993;177:1009–20.
Prak EL, Weigert M. Light chain replacement: a new model for
antibody gene rearrangement. J Exp Med 1995;182:541–8.
Chen Ch, Nagy Z, Prak EL, Weigert M. Immunoglobulin heavy
chain replacement: a mechanism of receptor editing. Immunity
1995;3:747–55.
Chen Ch, Prak EL, Weigert M. Editing disease-associated autoantibodies. Immunity 1997;6:97–105.
Pelanda R, Schwers S, Sonoda E, Torres RM, Nemazee D,
Rajewsky K. Receptor editing in a transgenic mouse model: site,
efficiency, and role in B cell tolerance and antibody diversification.
Immunity 1997;7:765–75.
Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield
NF, et al. The 1982 revised criteria of systemic lupus erythematosus. Arthritis Rheum 1982;25:1271–7.
Brezinschek HP, Brezinschek RI, Lipsky PE. Analysis of heavy
chain repertoire of human peripheral B cells using single-cell
polymerase chain reaction. J Immunol 1995;155:190–202.
Nanki T, Hayashida K, El-Gabalawy HS, Suson S, Shi K, Girschick
HJ, et al. SDF-1–CXCR4 interactions play a central role in CD4⫹
T cell accumulation in rheumatoid arthritis synovium. J Immunol
2000;165:6590–8.
Mayo MJ, Combes B, Jenkins RN. T-cell receptor Vb gene
utilization in primary biliary cirrhosis. Hepatology 1996;24:
1148–55.
Grammer AC, McFarland R, Heaney J, Darnell BF, Lipsky PE.
Expression, regulation, and function of B cell-expressed CD154 in
germinal centers. J Immunol 1999;163:4150–9.
Grammer AC, Bergman MC, Miura Y, Fujita K, Davis LS, Lipsky
PE. The CD40 ligand expressed by human B cells costimulates B
cell responses. J Immunol 1995;154:4996–5010.
Desai-Mehta A, Lu L, Ramsey-Goldman R, Datta SK. Hyperexpression of CD40 ligand by B and T cells in human lupus and its
role in pathogenic autoantibody production. J Clin Invest 1996;97:
2063–73.
Devi BS, van Noordin S, Krausz T, Davies KA. Peripheral blood
lymphocytes in SLE: hyperexpression of CD154 on T and B
lymphocytes and increased number of double negative T cells. J
Autoimmun 1998;11:471–5.
1263
45. Oettinger MA, Schatz DG, Gorka C, Baltimore D. RAG-1 and
RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 1990;248:1517–23.
46. Grammer AC, Lipsky PE. CD40-mediated regulation of immune
responses by TRAF-dependent and TRAF-independent signaling
mechanisms. Adv Immunol 2001;76:61–178.
47. Odendahl M, Jacobi A, Hansen A, Feist E, Hiepe F, Burmester
GR, et al. Disturbed peripheral B lymphocyte homeostasis in
systemic lupus erythematosus. J Immunol 2000;165:5970–9.
48. Gartner F, Alt FW, Monroe RJ, Seidl KJ. Antigen-independent
appearance of recombination activating gene (RAG)-positive
bone marrow B cells in the spleens of immunized mice. J Exp Med
2000;192:1745–54.
49. Nakamura N, Shidara Y, Kawaguchi N, Azuma Ch, Mitsuda N,
Onishi S, et al. Lupus anticoagulant autoantibody induces apoptosis in umbilical vein endothelial cells: involvement of annexin V.
Biochem Biophys Res Comm 1994;205:1488–93.
50. Hashimoto Y, Nakano K, Yoshinoya S, Tanimoto K, Itoh K.
Endothelial cell destruction by polymorphonuclear leukocytes
incubates with sera from patients with systemic lupus erythematosus (SLE). Scand J Rheumatol 1992;21:209–14.
51. Cruz PP, Houssiau FA, Ramirez G, Baguley E, McCutcheon J,
Vianna J, et al. Antibodies to endothelial cells in systemic lupus
erythematosus: a potential marker for nephritis and vasculitis. Clin
Exp Immunol 1991;85:254–61.
52. Verkoczy LK, Stiernhdm BJ, Berinstein NL. Up-regulation of
recombination activating gene expression by signal transduction
through the surface Ig receptor. J Immunol 1995;154:5136–43.
53. Hertz M, Nemazee D. BCR ligation induces receptor editing in
IgM⫹IgD⫺ bone marrow B cells in vitro. Immunity 1997;6:
429–36.
54. Ma A, Fisher P, Dildrop R, Oltz E, Rathbun G, Achacoso P, et al.
Surface IgM mediated regulation of RAG gene expression in E
mu-N-myc B cell lines. Embo J 1992;11:2727–34.
55. Lauring J, Schlissel MS. Distinct factors regulate the murine
RAG-2 promoter in B- and T-cell lines. Mol Cell Biol 1999;19:
2601–12.
56. Datta SK. Production of pathogenic antibodies: interaction between autoimmune T and B cells. Lupus 1998;7:591–6.
57. Fong IC, Zarrin AA, Wu GE, Berinstein NL. Functional analysis
of the human RAG 2 promoter. Mol Immunol 2000;37:391–402.
58. Wang QF, Lauring J, Schlissel MS. c-myb binds to a sequence in
the proximal region of the RAG-2 promoter and is essential for
promoter activity in T-lineage cells. Mol Cell Biol 2000;20:
9203–11.
59. Kishi H, Wei XC, Jin ZX, Fujishiro Y, Nagata T, Matsuda T, et al.
Lineage-specific regulation of the murine RAG-2 promoter:
GATA-3 in T cells and Pax-5 in B cells. Blood 2000;95:3845–52.
60. Li Z, Dordai DI, Lee J, Desiderio S. A conserved degradation
signal regulates RAG-2 accumulation during cell division and links
V(D)J recombination to the cell cycle. Immunity 1996;5:575–89.
61. Tian J, Okabe T, Miyazaki T, Takeshita S, Kudo A. Pax-5 is
identical to EBB-1/KLP and binds to the VpreB and lambda5
promoters as well as the KI and KII sites upstream of the J␬ genes.
Eur J Immunol 1997;27:750–5.
62. Fuller K, Storb U. Identification and characterization of the
murine Rag1 promoter. Mol Immunol 1997;34:939–54.
Документ
Категория
Без категории
Просмотров
0
Размер файла
254 Кб
Теги
expressions, lupus, periphery, patients, systemic, activation, erythematosus, genes, recombination, cells
1/--страниц
Пожаловаться на содержимое документа