close

Вход

Забыли?

вход по аккаунту

?

Identification in human osteoarthritic chondrocytes of proteins binding to the novel regulatory site AGRE in the human matrix metalloprotease 13 proximal promoter.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 54, No. 8, August 2006, pp 2471–2480
DOI 10.1002/art.21961
© 2006, American College of Rheumatology
Identification in Human Osteoarthritic Chondrocytes of
Proteins Binding to the Novel Regulatory Site AGRE in the
Human Matrix Metalloprotease 13 Proximal Promoter
Zhiyong Fan,1 Ginette Tardif,1 Christelle Boileau,1 Joseph P. Bidwell,2 Changshan Geng,1
David Hum,1 Alexander Watson,1 Jean-Pierre Pelletier,1 Martin Lavigne,3 and
Johanne Martel-Pelletier1
Objective. Matrix metalloprotease 13 (MMP-13)
plays a major role in osteoarthritic (OA) processes. We
previously identified the AG-rich element (AGRE) regulatory site (GAAAAGAAAAAG) in the proximal promoter of this gene. Electrophoretic mobility shift assays
(EMSAs) done with nuclear extracts from OA chondrocytes showed the presence of 2 AGRE protein–binding
complexes, the formation of which depended on the
pathophysiologic state (high or low) of the cells; the low
OA (L-OA) chondrocytes have low MMP-13 basal levels
and high interleukin-1␤ (IL-1␤) inducibility, and the
high OA (H-OA) chondrocytes have high MMP-13 basal
levels and low IL-1␤ inducibility. In this study, we
sought to determine the importance of individual AGRE
bases in promoter activity and to identify AGRE binding
proteins from L-OA and H-OA chondrocyte complexes.
Methods. Promoter activity was determined following transient transfection into human OA chondrocytes. AGRE binding proteins were identified by mass
spectroscopy.
Results. Individual mutations of the AGRE site
differentially modulated promoter activity, indicating
that the intact AGRE site is required for optimal
MMP-13 expression. Damage-specific DNA binding
protein 1 (DDB-1) was identified in the L-OA
chondrocyte–binding complex. EMSA experiments performed with the mutation of the left AGRE site (GTGCTGAAAAAG) and nuclear extracts of L-OA chondrocytes reproduced the pattern seen in the H-OA
chondrocytes. Mass spectroscopy identified p130cas as
one of the proteins in this complex. Supershift experiments showed the presence of p130cas and nuclear
matrix transcription factor 4 (NMP-4) in the wild-type
AGRE/H-OA chondrocyte complex.
Conclusion. These data suggest that the binding
of p130cas and NMP-4 to the AGRE site regulates
MMP-13 expression and may trigger the change in
human chondrocytes from the L-OA state to the H-OA
state.
Matrix metalloprotease 13 (MMP-13; collagenase 3) is a potent protease capable of degrading a wide
range of collagenous and noncollagenous extracellular
matrix macromolecules, including types I, II, III, IV, IX,
X, and XI collagens (with higher activity for type II
collagen), gelatin, laminin, tenascin, aggrecan, fibrinogen, and connective tissue growth factor (1–8). In contrast to many human MMPs, the distribution pattern of
MMP-13 is restrictive in normal tissues and selective in
tissues with pathologic conditions. The physiologic expression of MMP-13 is limited to situations in which
rapid and effective remodeling of collagen is required,
such as in fetal bone development and postnatal bone
remodeling (9,10). In pathologic conditions, MMP-13 is
expressed at sites of excessive degradation of the extra-
Supported by a grant from the Canadian Institutes of Health
Research (CIHR) and by a student bursary funded in part by an
unrestricted grant from Amgen Canada and in part by a grant from the
CIHR/MENTOR training program.
1
Zhiyong Fan, MD, MSc, Ginette Tardif, PhD, Christelle
Boileau, PhD, Changshan Geng, MD, MSc, David Hum, MSc, Alexander Watson, MSc, Jean-Pierre Pelletier, MD, Johanne MartelPelletier, PhD: Centre Hospitalier de l’Université de Montréal, Hôpital Notre-Dame, Montreal, Quebec, Canada; 2Joseph P. Bidwell, PhD:
Indiana University School of Medicine, Indianapolis; 3Martin Lavigne,
MD: Hôpital Maisonneuve-Rosemont, Montreal, Quebec, Canada.
Address correspondence and reprint requests to Johanne
Martel-Pelletier, PhD, Osteoarthritis Research Unit, Centre Hospitalier de l’Université de Montréal, Hôpital Notre-Dame, 1560 rue
Sherbrooke Est, Montreal, Quebec H2L 4M1, Canada. E-mail:
jm@martelpelletier.ca.
Submitted for publication September 28, 2005; accepted in
revised form April 6, 2006.
2471
2472
cellular matrix, such as in cartilage from patients with
osteoarthritis (OA) and patients with rheumatoid arthritis (RA) (2–4,11,12), in RA synovium (13), and in
various carcinomas (14).
MMP-13 expression is modulated by numerous
agents, including proinflammatory cytokines
(interleukin-1␤ [IL-1␤], tumor necrosis factor ␣, IL-17),
growth factors (transforming growth factor ␤, hepatocyte growth factor), fibronectin fragments, and mechanical stimuli (2,15–20). The signals triggered by these
factors are relayed to the nucleus and activate different
transcription factors. Many binding sites for transcription factors have been identified in the human MMP-13
promoter (21–23). The activator protein 1 (AP-1), Ets/
polyomavirus enhancer 3 (PEA-3), and osteoblastspecific element 2 (OSE-2) sites are present in the
proximal promoter. Functional analysis of the promoter
revealed that the AP-1 site is essential for both basal and
proinflammatory cytokine–induced transcription and
that the PEA-3 site exerts a cooperative effect (17,18).
The OSE-2 site, which binds core-binding factor ␣1
(CBF␣1), is required for IL-1␤ induction of MMP-13 in
stably transfected chondrocytic cells (24). Recently, we
identified in the human MMP-13 proximal promoter a
novel regulatory element GAAAAGAAAAAG, designated AG-rich element (AGRE), that appears to be
involved in basal expression of MMP-13 (25). Interestingly, the AGRE site is not found as such in the proximal
promoter sequence of other human MMP genes, although the proximal promoter region of some MMPs
contains AGRE-like sequences.
In a previous study (26), we identified 2 subpopulations of OA chondrocytes: low (L), which have a low
basal level of MMP-13 and high IL-1␤ inducibility, and
high (H), which have a high basal level of MMP-13 and
low IL-1␤ inducibility (26). We have found, by electrophoretic mobility shift assay (EMSA) experiments, that
different proteins bind to the AGRE site and form 2
different migrating complexes, depending on whether
the nuclear proteins are extracted from OA chondrocytes of the slow-migrating complex (L) or the fastmigrating complex (H) state (25).
In this study, we examined MMP-13 regulation at
the AGRE site and identified AGRE binding proteins
from L-OA and H-OA chondrocyte complexes. We
found that the intact AGRE site is required for optimal
expression of MMP-13. Damage-specific DNA binding
protein 1 (DDB-1) was identified in the AGRE complex
formed in L-OA chondrocyte complexes, and p130cas
and nuclear matrix transcription factor 4 (NMP-4) were
identified in the H-OA chondrocyte complexes. These
FAN ET AL
findings are important and may explain the differential
regulation of MMP-13 expression in human OA, in
addition to providing a new basis for the rationalization
of a therapeutic strategy.
MATERIALS AND METHODS
Specimen selection. Articular cartilage samples (n ⫽
36) from femoral condyles and tibial plateaus and synovial
membrane samples (n ⫽ 25) were obtained from OA patients
(mean ⫾ SD age 71 ⫾ 9 years) who were undergoing total knee
arthroplasty. All patients had been evaluated by a certified
rheumatologist and diagnosed as having OA according to the
American College of Rheumatology criteria (27). The specimens represented moderate-to-severe OA, as defined according to macroscopic criteria (28). At the time of surgery, the
patients had symptomatic disease requiring medical treatment
(acetaminophen, nonsteroidal antiinflammatory drugs, or selective cyclooxygenase 2 inhibitors). The institutional Ethics
Committee Board of the Hôpital Notre-Dame approved the
use of the human articular tissues.
Cell culture. Chondrocytes and synovial fibroblasts
were released from full-thickness strips of cartilage and synovial membrane, respectively, followed by sequential enzymatic
digestion at 37°C as previously described (2). The chondrocytes
were extracted from whole OA cartilage. The isolated cells
were seeded at high density (105 cells/cm2) in tissue culture
flasks and cultured to confluence in Dulbecco’s modified
Eagle’s medium supplemented with 10% heat-inactivated fetal
calf serum and an antibiotics mixture (100 units/ml of penicillin
base and 100 ␮g/ml of streptomycin base) (all from GibcoBRL Life Technologies, Burlington, Ontario, Canada) at 37°C
in a humidified atmosphere of 5% CO2/95% air. To ensure
phenotype, only first-passage cultured chondrocytes were used.
Synovial fibroblasts were used at the second or third passage.
Identification of L-OA and H-OA chondrocytes. L-OA
and H-OA chondrocytes were identified as described previously (18,26), by incubating the cells for 48 hours in the
presence or absence of IL-1␤ (100 pg/ml). The MMP-13
released into the culture medium was quantified by a specific
enzyme-linked immunosorbent assay (Amersham Biosciences,
Baie d’Urfé, Quebec, Canada). Chondrocytes with low basal
levels of MMP-13 and a ⬎2-fold increase following treatment
with IL-1␤ were classified as L-OA. Those with high basal
levels of MMP-13 and a ⬍2-fold increase following treatment
with IL-1␤ were classified as H-OA. Of note, this classification
discriminates specimens from different patients but not cells
from the same patient. The proportion of L-OA pattern
chondrocytes to H-OA pattern chondrocytes is ⬃10:1.
Plasmids and site-directed mutagenesis. Plasmid
–175Luc consists of the first proximal 175 bp of the human
MMP-13 promoter containing the OSE-2, AGRE, PEA-3, and
AP-1 sites as well as the TATA box cloned into the pGL3
luciferase reporter plasmid (Promega, Madison, WI) (Figure
1). Plasmid –137Luc is identical to plasmid –175Luc except
that it has only the first proximal 137 bp and lacks the OSE-2
site (Figure 1).
The human MMP-1 promoter includes basepairs –512
to ⫹63 cloned into the PXP2 luciferase vector (kindly provided
IDENTIFICATION OF AGRE BINDING PROTEINS IN HUMAN OA CHONDROCYTES
Figure 1. Proximal promoter sequence of the human matrix metalloprotease 13 (MMP-13) gene. The transcription start site (⫹1) is
indicated by an arrow. The locations of the binding sites are numbered
from the transcription start site and are underlined. The MMP-13
promoter sequence was linked to the luciferase reporter gene to
construct plasmid –175Luc. Plasmid –137Luc is identical to plasmid
–175Luc, except that it terminates at the base indicated by the asterisk.
STAT ⫽ signal transducer and activator of transcription; OSE-2 ⫽
osteoblast-specific element 2; AGRE ⫽ AG-rich element; PEA-3 ⫽
polyomavirus enhancer 3; AP-1 ⫽ activator protein 1.
by Dr. Herman Cheung, University of Miami School of
Medicine, Miami, FL) (29). A 501-bp fragment of the MMP-2
proximal promoter was generated by polymerase chain reaction using human chromosomal DNA as substrate and the
primers 5⬘-CCCAGGAGCTCTCTGTCCC-3⬘ (sense), and
5⬘-GTAAGATCTGGATGCAGCGGAAACAAG-3⬘ (antisense). A 420-bp fragment of the MMP-14 promoter was
similarly generated with the primers 5⬘-ACCATCCCACACTCTGAGCTCCTC-3⬘ (sense), and 5⬘-CTTAGATCTTTCTTCTGCTTAGTCGGCG-3⬘ (antisense). Both sense
primers were designed with a Sac I site and antisense primers
with a Bgl II site to facilitate cloning into the pGL-3 basic
luciferase vector (Promega).
The mutations were done using a QuickChange SiteDirected Mutagenesis kit (Stratagene, La Jolla, CA) as described by the manufacturer. All mutated constructs were
verified by DNA sequencing using the BigDye Terminator v3.1
Cycle Sequencing kit (Applied Biosystems, Foster City, CA).
Transient transfection assays. Transient transfection
assays were performed by the calcium phosphate coprecipitation method as previously described (18,21,25). Chondrocytes
were seeded at 80% confluency and transfected with a DNA–
calcium preparation consisting of 125 mM CaCl2 and 3 ␮g of
the plasmids. Plasmid pCMV-␤-galactosidase (VR1412; Vical,
San Diego, CA) was used to monitor transfection efficiency.
The cells were incubated for 48 hours, after which they were
lysed in Reporter lysis buffer (Promega). Luciferase activity
was measured with the Lumat LB 9507 luminometer (EG&G
Berthold, Bad Wildbad, Germany). Total protein was quantitated by the bicinchoninic acid method (Pierce, Rockford, IL).
Promoter activity was calculated as relative luciferase units per
microgram of protein and expressed as a percentage of the
control, which was assigned a value of 100%.
EMSA and supershift assay. EMSA and supershift
assays were performed as previously described (18,25). Nuclear proteins (10 ␮g) from human OA chondrocytes were
incubated with wild-type and mutated AGRE-containing oligonucleotides end-labeled with ␥32P-ATP. Binding complexes
were resolved on nondenaturing 6% polyacrylamide gels, after
2473
which the gels were fixed, dried, and exposed to Kodak XAR-5
film (Eastman Kodak, Rochester, NY). The antibodies used in
the supershift reactions were 0.5 ␮g of mouse monoclonal
anti-human p130cas (no. 610272; BD Transduction Laboratories, Mississauga, Ontario, Canada) and 2 ␮l of rabbit polyclonal anti-rat NMP-4 (30).
DNA affinity chromatography. Magnetic beads (BioMag Nuclease-Free Streptavidin; Qiagen, Valencia, CA) were
coupled to wild-type or mutated (GAAGAGACAAAG [boldfacing indicates mutated bases]) 5⬘-biotinylated AGREcontaining oligonucleotides. The double-stranded oligonucleotides were coupled to magnetic beads (100 pmoles/5 mg, in 20
mM Tris HCl, 1 mM EDTA, and 0.02% Triton X-100, pH 7.8),
incubated for 15 minutes at room temperature, and washed 3
times with the above buffer. Since preliminary experiments
showed that nuclear extracts from all human OA synoviocytes induce the same slow-migrating protein complex seen
in the normal and L-OA chondrocytes (25), OA synoviocytes were then used as the source of nuclear extracts for
this experiment.
Nuclear extracts were incubated with the wild-type
and mutated AGRE oligonucleotides/magnetic beads in a
Tris buffer (20 mM Tris HCl, 0.5M NaCl, pH 8.0) at 4°C for
30 minutes. The solution was washed extensively with the
buffer to remove unbound proteins, heated at 56°C for 5
minutes to release the bound proteins, and the beads were
removed with a magnetic field. The samples were desalted,
concentrated with an Amicon membrane (Amicon, Stonehouse, UK), precipitated using a 2D Cleaners kit from Amersham Biosciences, dried, and recovered in Destreak Rehydration buffer (Amersham Biosciences). The proteins were
separated on 2-dimensional electrophoresis gel using a SureLock system kit (Invitrogen, San Diego, CA). The proteins
were first focused on pH 3–10NL strips for a total of 2,200
volts/hour. The strips were then reduced with 2% dithiothreitol, alkylated with 2% iodoacetamide, and equilibrated with
sodium dodecyl sulfate. The second dimension was done on a
10% acrylamide Bis–Tris precast gel at 200 volts for 50
minutes. The gels were fixed, stained with silver nitrate (31),
and scanned and analyzed with ImageMaster software (Amersham Biosciences). Protein patterns obtained from wild-type
and mutated oligonucleotides were compared and were analyzed by mass spectroscopy.
Extraction of proteins from EMSA complexes. Protein/
AGRE binding reactions were electrophoresed as described
above. The gel was sliced in the zone containing the EMSA
binding complex, digested by trypsin (6 ng/␮l for 5 hours), and
processed on the MassSpec robotic workstation (PerkinElmer,
Boston, MA). Peptides were extracted in 0.5% formic acid and
9% acetonitrile and analyzed by mass spectrometry (Q-Trap
4000 ion trap) using BioAnalyst 1.4 software (both from
Applied Biosystems). The results were submitted to the Mascot search engine (Matrix Science, Boston, MA) for identification and compared with the National Center for Biotechnology Information database.
Statistical analysis. Values are expressed as the
mean ⫾ SEM. When applicable, statistical analysis was performed using Student’s 2-tailed t-test. P values less than 0.05
were considered significant.
2474
FAN ET AL
Figure 2. Effect of different AG-rich element (AGRE) mutations on matrix metalloprotease 13 (MMP-13) promoter activity in the low subpopulation (low basal level of MMP-13
and high interleukin-1␤ inducibility) of human osteoarthritic (OA) chondrocytes (L-OA
chondrocytes). Plasmid –175Luc containing wild-type (WT) or mutated (M) AGRE sites
was transfected into L-OA chondrocytes (n ⫽ 7–11), and promoter activity was measured
by luciferase activity. The promoter activity of the wild-type AGRE-containing plasmid was
given an arbitrary value of 100%. Values are the mean and SEM. The mutated bases are
indicated in boldface. P values are versus the wild-type, as determined by Student’s 2-tailed
t-test.
RESULTS
Effect of AGRE mutations on basal MMP-13
promoter activity. The AGRE site was mutated at
different bases to identify those involved in promoter
activity. Plasmid –175Luc was mutated at its AGRE site,
L-OA chondrocytes were transfected, and promoter
activity was determined. The data showed that most
AGRE mutations induced a significant decrease in
MMP-13 promoter activity (Figure 2). The highest decrease (90% [P ⬍ 0.0001]) was seen with the mutation in
the left side GAAGAGAAAAAG (the M-2 mutation).
Mutations in the right side (GAAAAGAAGAAG and
GAAAAGACAAAG [the M-5 and M-3 mutations, respectively]) resulted in decreases of 46% (P ⬍ 0.03) and
75% (P ⬍ 0.0001), respectively. Mutations in both sides
(GAAGAGACAAAG [the M-1 mutation]) resulted in a
74% decrease in promoter activity (P ⬍ 0.0001). The
mutation GAAAAGCAAAAG (the M-4 mutation) reduced promoter activity by 21%. Surprisingly, only the
mutation GTGCTGAAAAAG (the M-6 mutation) resulted in a significant increase in promoter activity (P ⬍
0.0001).
Activity of AGRE-like sequences in the promoters of other human MMPs. To determine whether the
AGRE site was unique to the human MMP-13 promoter, we searched the GenBank database for its pres-
ence in the proximal promoter sequence (up to 400 bp
upstream of the reported transcription start site) of
several human MMP genes. We identified AGRE-like
sequences in some promoters. The single GAAAA motif
was found in the promoters of human MMP-1 (⫺237 to
⫺233 bp) (32), MMP-3 (⫺251 to ⫺247 bp) (33), MMP-7
(⫺126 to ⫺122 bp) (34), and MMP-12 (3 copies at
positions ⫺409 to ⫺405, ⫺329 to ⫺325, and ⫺305 to ⫺301
bp) (35). The sequence AAAAG was found in MMP-1
(⫺311 to ⫺307 bp) (32), MMP-3 (⫺301 to ⫺297 bp) (33),
MMP-7 (⫺89 to ⫺85 bp) (34), MMP-11 (⫺81 to ⫺77 bp)
(36), MMP-8 (2 copies at ⫺190 to ⫺186 and ⫺213 to ⫺209
bp) (GenBank accession no. AF059679), MMP-9 (2 copies
at ⫺434 to ⫺430 and ⫺506 to ⫺502 bp) (37), and MMP-2
promoters (3 copies at ⫺160 to ⫺156, ⫺140 to ⫺136, and
⫺130 to ⫺126 bp) (38). The sequence CAAAAAG (⫺207
to ⫺201 bp) was found in the MMP-14 promoter (39).
To determine whether these motifs have the
same transcriptional role as the whole AGRE site, we
mutated the AGRE-like sequences in the proximal
promoters of MMP-1, MMP-2, and MMP-14 and transfected L-OA chondrocytes with the mutated or wild-type
plasmids. The data showed that their mutation did not
significantly affect promoter activities, although a slight
decrease was noted for the second mutation of the
MMP-14 promoter (Figure 3).
IDENTIFICATION OF AGRE BINDING PROTEINS IN HUMAN OA CHONDROCYTES
Figure 3. Activities of wild-type and mutated AG-rich element–like sequences in the
promoters of different matrix metalloproteases (MMPs). The wild-type (WT) and mutated
(MUT) plasmids were constructed as described in Materials and Methods, transfected into
the low subpopulation (low basal level of MMP-13 and high interleukin-1␤ inducibility) of
osteoarthritic (OA) chondrocytes (n ⫽ 5–12), and promoter activity was measured by
luciferase activity. Promoter activity of the wild-type plasmids was given an arbitrary value
of 100%. The mutated bases are indicated in boldface. Values are the mean and SEM.
Figure 4. Effect of wild-type (WT) (ACCACAAACCACA) and mutated (MUT) (ACCGCAAACCGCA) osteoblast-specific element 2 (OSE-2) sites on matrix metalloprotease 13
(MMP-13) promoter activity in the low subpopulation (low basal level of MMP-13 and high
interleukin-1␤ inducibility) of human osteoarthritic (OA) chondrocytes (L-OA chondrocytes). Plasmids –175Luc, which contain permutations of wild-type and mutated AR-rich
element (AGRE) and OSE-2 sites, were transfected into L-OA chondrocytes (n ⫽ 10).
Plasmid –137Luc, which does not have the OSE-2 site, was included as a reference.
Promoter activities were measured by luciferase activity. The promoter activity of wild-type
–175Luc was given an arbitrary value of 100%. Values are the mean and SEM. P values are
versus the wild-type, as determined by Student’s t-test.
2475
2476
Figure 5. Representative electrophoretic mobility shift assay (EMSA)
patterns of AG-rich element (AGRE)–binding complexes of osteoarthritic (OA) chondrocytes. A, EMSA performed with the oligonucleotide containing the wild-type (WT) AGRE site (GAGGGAAAAGAAAAAGTCGCC) and nuclear extracts from the low subpopulation
(low basal level of matrix metalloprotease 13 [MMP-13] and high
interleukin-1␤ [IL-1␤] inducibility) and the high subpopulation (high
basal level of MMP-13 and low IL-1␤ inducibility) of OA chondrocytes
(L-OA and H-OA chondrocytes, respectively), as described in Materials and Methods. As previously reported (25), the L-OA chondrocytes have a slow-migrating band (L), and the H-OA chondrocytes
have a fast-migrating band (H); ns indicates a nonspecific band. B,
EMSAs (n ⫽ 4) performed with wild-type or mutated (M) AGREcontaining oligonucleotides and nuclear proteins from L-OA chondrocytes. C, Sequences of the wild-type and mutated AGRE sites. The
mutated bases are indicated in boldface.
Effect of OSE-2 mutation on basal MMP-13
promoter activity. To evaluate a possible interaction
between the proteins binding the AGRE and OSE-2
sites, the –175Luc plasmid was mutated in the OSE-2
site either alone (ACCGCAAACCGCA) or conjointly
with AGRE (GAAGAGACAAAG). For comparison
purposes, the wild-type –137Luc plasmid (Figure 1) was
also included. L-OA chondrocytes were transfected with
wild-type and mutated plasmids (Figure 4). The results
showed that the mutation in the OSE-2 site alone did
not significantly affect MMP-13 promoter activity, but
that the AGRE mutation, whether alone or in conjunction with OSE-2, significantly decreased promoter activity (by 70% [P ⬍ 0.0001] and 43% [P ⬍ 0.01], respectively). The promoter activity of –137Luc was slightly
lower than that of –175Luc, but the difference was not
significant.
Protein-binding potential of mutated AGRE
sites. The AGRE site was mutated at different bases to
identify those involved in the formation of proteinbinding complexes. EMSA experiments were performed
FAN ET AL
with oligonucleotides containing wild-type and mutated
AGRE sites and nuclear extracts from L-OA chondrocytes. The results showed that the migration pattern of
the complex associated with H-OA chondrocytes could
be reproduced with oligonucleotides containing the
AGRE site mutated in its left side and nuclear extracts
from L-OA chondrocytes (Figure 5); this fast-migrating
complex was more pronounced with the mutation GTGCTGAAAAAG (the M-6 mutation) than with the
mutation GAAGAGAAAAAG (the M-2 mutation).
This binding complex was specific and depended upon
the presence of the right side sequence of AGRE, since
the mutation GTGCTGACAAAG abolished the formation of this complex (data not shown).
The GTGCTGAAAAAG/binding complex was
excised from the gel, and the proteins were analyzed by
mass spectroscopy. Two peptides matched the protein
p130cas, a docking protein known to bind the transcrip-
Figure 6. Supershift assay pattern of AG-rich element (AGRE)–
protein complexes of osteoarthritic (OA) chondrocytes. Nuclear extracts from the high subpopulation (high basal level of matrix metalloprotease 13 and low interleukin-1␤ inducibility) of OA chondrocytes
(H-OA chondrocytes) were incubated with the wild-type (WT)
AGRE-containing oligonucleotide (GAGGGAAAAGAAAAAGTCGCC) in the absence (WT) or presence of specific antibodies
against nuclear matrix transcription factor 4 (NMP-4) and p130cas.
Competition (Comp) was performed by the addition of a 50-fold molar
excess of the cold AGRE oligonucleotide. Arrows indicate the supershifted bands; H indicates the fast-migrating complex of the H-OA
chondrocytes; ns indicates a nonspecific band.
IDENTIFICATION OF AGRE BINDING PROTEINS IN HUMAN OA CHONDROCYTES
tion factor NMP-4/CIZ, which binds the consensus site
(G/C)AAAAA (40), a sequence present in the right side
of the AGRE site.
Identification of AGRE binding proteins in the
complex formed between the wild-type AGRE site and
H-OA chondrocyte proteins. The previous experiment
showed that p130cas was present in the complex formed
by a mutated AGRE site and nuclear extracts from
L-OA chondrocytes. To confirm that p130cas was present
in the wild-type AGRE/H-OA chondrocyte complex, a
specific p130cas antibody was added to the H-OA chondrocyte EMSA reaction mixture. Because p130cas is a
cofactor of NMP-4, we also used a specific antibody to test
for the presence of NMP-4 in the H-OA complex. As
illustrated in Figure 6, both NMP-4 and p130cas antibodies
supershifted the AGRE–protein H-OA complex. The
specificity was verified by the addition of a 50-fold molar
excess of the cold AGRE oligonucleotide (Figure 6).
Identification of AGRE binding proteins in the
complex formed between the wild-type AGRE site and
L-OA chondrocyte proteins. Identification of the proteins formed in the L-OA chondrocyte/AGRE complex
was performed by DNA affinity chromatography with
nuclear extracts incubated with magnetic beads bound to
the wild-type or mutated (GAAGAGACAAAG; the
M-1 mutation) AGRE-containing oligonucleotides. The
protein DDB-1 was identified following 2-dimensional
gel electrophoresis and mass spectroscopy.
DISCUSSION
In our previous study (25), we showed that the
AGRE site in the proximal promoter of MMP-13 plays
an important role in its regulation. The objective of this
study was to complement the previously acquired data
and to identify proteins that bind to this site.
Most mutations of the different bases of the
AGRE site in the –175Luc plasmid resulted in decreased
promoter activities, suggesting that the whole AGRE
site is required for full MMP-13 basal activity and that
the proteins binding the site have a stimulatory role in
basal transcription under the conditions used. The fact
that the whole AGRE site needs to be intact for optimal
MMP-13 activity is supported by the results obtained by
the mutation of the AGRE-like sequences present in the
proximal promoter of other MMPs. We found that the
mutated sequences did not significantly alter basal promoter activity, although we cannot rule out a role of
these sites in conditions in which MMPs are induced.
The only mutation that resulted in increased
promoter activity was the M-6 mutation, which totally
2477
abolished the left side of AGRE and resulted in the
strongest H-OA type binding, as determined by EMSA.
This was unexpected, since the M-2 mutation, which also
has the intact right side with the consensus NMP-4
binding site, decreased rather than increased promoter
activity. It should be noted, however, that neither the
wild-type AGRE nor the M-2 mutation showed an
H-OA type binding as strong as the M-6 mutation. In
these last 2 cases, the NMP-4 binding site is intact;
however, the binding of other proteins present in higher
amounts or having greater affinity for the site may
impede the binding of NMP-4. The M-6 mutation created an optimal binding site for NMP-4/p130cas, leading
to an up-regulation of promoter activity.
The L-OA proteins seem to have a more potent
stimulatory effect than the H-OA proteins, with most
AGRE mutations reducing activity by 5–10-fold. L-OA
proteins likely bind either or both sides of AGRE:
mutations in the left side (M-2), the right side (M-3 and
M-5), or both sides (M-1) all reduce promoter activity.
Thus, the H-OA chondrocytes may result from the
strong binding of NMP-4/p130cas to AGRE, resulting in
a 2-fold stimulation of transcription, in contrast to the
L-OA state, where the binding by the L-OA proteins
would contribute to a higher degree of basal transcription. The stimulating capacities of the H-OA and L-OA
binding proteins may be different, or alternatively, the
H-OA complex, in addition to NMP-4/p130cas, may
recruit a cofactor that could limit the stimulatory effect.
These results showing that the AGRE binding
proteins stimulate transcription contrast with our previous study (25), in which we showed that the AGRE
mutation or deletion resulted in a significant increase in
basal MMP-13 transcription. However, the plasmid used
in the previous study was smaller by 38 bp. The extra
DNA in plasmid –175Luc contains an OSE-2 site as well
as a putative STAT site (Figure 1), which has yet to be
described or analyzed with respect to its involvement in
MMP-13 transcription. Since the mutation of the OSE-2
site does not seem to make a significant difference in
basal promoter activity, it is possible that the STAT site
may play a role in MMP-13 transcription. It has previously been reported that interferon-␥–induced phosphorylation of STAT-1 inhibits MMP-13 expression in
transformed human epidermal keratinocytes (41). It
remains to be determined, however, whether this putative STAT site is involved in basal MMP-13 modulation
in human chondrocytes.
The mutation of the OSE-2 site, located 9 bp
upstream of the AGRE site, did not affect basal
MMP-13 promoter activity. The transcription factor
2478
CBF␣1, which binds OSE-2, is known to be involved in
chondrocyte and osteoblast differentiation and bone
formation, and it is also up-regulated in fibrillated OA
cartilage (42,43). However, the increased expression of
CBF␣1 in OA cartilage does not seem to be sufficient to
affect MMP-13 expression without growth factor activation (43). Moreover, and consistent with our data, there
was no significant increase in MMP-13 in serum-free
culture medium derived from human chondrocytes infected with the recombinant CBF␣1 adenovirus. In
another study (23), increased promoter activity was
observed when HeLa cells were cotransfected with a
CBF␣1 expression plasmid and an OSE-2–containing
MMP-13 promoter plasmid. However, there was no
difference in the basal activity between MMP-13 promoter plasmids with and those without the OSE-2 site,
which is consistent with our results. Although CBF␣1 is
important in developmental processes and is involved in
the stimulatory pathways of some factors, it may not be
activated or expressed at a level high enough to affect
basal MMP-13 expression in human OA chondrocytes.
MMP-13 promoter activity was reduced by
AGRE mutations in the plasmid –175Luc. The mutated
sites were also found to have different protein-binding
capacities in vitro. An interesting result was that we were
able to reproduce the H-OA binding complex with
L-OA nuclear extracts and the AGRE site mutated in its
left side. This suggests that the proteins that form the
H-complex are present in the L-OA chondrocytes but
are not capable of binding to AGRE. It is possible that
the concentration of L-proteins is much higher in L-OA
chondrocytes than in H-OA chondrocytes and that the
presence of the L-proteins on the AGRE site prevents
the H-proteins from binding.
Although we have identified DDB-1 by affinity
chromatography, it is likely that other proteins are
involved in the L-OA complex. DDB-1 (127 kd) and
DDB-2 (48 kd) are part of the DDB complex that binds
ultraviolet light–damaged DNA in mammalian cells
(44). DDB is not known to bind the specific AGRE
sequence but has been reported to function as a transcriptional partner of the transcription factor E2F1,
which suggests a role of DDB in the cell cycle (45). It
remains to be determined whether DDB-1 can form a
complex with other transcription factors and transactivate MMP-13 expression. Although not related to
the AGRE site, another DNA damage–inducible protein, growth arrest and DNA damage–induced 45␤, was
shown to stimulate MMP-13 promoter activity in chondrocytes (46).
We have identified the proteins p130cas and
FAN ET AL
NMP-4 in the H-complex. The p130cas protein does not
bind DNA directly but is known to interact with the
transcription factor NMP-4 (40). This is the first report
of the implication of p130cas as a possible transcription
modulator. The p130cas protein is a docking protein
found in focal adhesion points, and it is involved in
cellular processes such as migration, proliferation, and
apoptosis (47–49).
The CIZ protein was originally identified in rat
cells through its interaction with p130cas (40). It is a
nucleocytoplasmic shuttling protein that binds the consensus sequence G/CAAAAA. Overexpression of this
protein up-regulates MMP-1, MMP-3, and MMP-7 transcription (40). At about the same time, NMP-4 complementary DNA splice variants were identified, also from
rat cells, and some of these variants were identical to the
CIZ proteins (30).
Shah et al (50) showed that NMP-4/CIZ binds the
homopolymeric (dA-dT) element within the MMP-13
promoter and promotes basal expression in rat cells. The
regulatory role of NMP-4 in MMP-13 expression may
differ in rat and human cells. The NMP-4 binding site
in the rat MMP-13 promoter does not contain an
AGRE site per se, but does contain the sequence
GAAAAAAAAAA, to which NMP-4 can bind; this
sequence is located near an OSE-2 site in the same
region of the AGRE site of the human promoter.
Although a similar sequence is also found in the human
MMP-13 promoter (CAAAAAAAAAAA), which could
possibly bind NMP-4, it is located approximately 170 bp
upstream of the AGRE site (21) and is not included in
plasmid –175Luc. In this study, we found that NMP-4
was part of the H-complex formed with AGRE. Unlike
the rat MMP-13 promoter, the human promoter may
offer 2 levels of regulation of MMP-13 by NMP-4: one at
the sequence similar to the rat binding site and the other
at the AGRE site where 2 different sets of proteins (L
and H) would act.
The L-OA and H-OA chondrocytes may represent cells at different stages of the disease process.
Although the initiating event responsible for the 2
different populations is not yet known, the H-OA chondrocytes may represent cells in a later stage of the
disease, during which there is a greater need for
MMP-13 in the remodeling/repair processes. NMP-4
and p130cas may be involved in the switch from L-OA to
H-OA chondrocytes. Because of increased synthesis
and/or activation, these proteins would replace the
L-proteins on the AGRE site. Their presence on this site
may lead to increased basal levels but limit IL-1␤
inducibility, perhaps by interfering with proteins binding
IDENTIFICATION OF AGRE BINDING PROTEINS IN HUMAN OA CHONDROCYTES
at the AP-1 site. NMP-4 has been reported to interfere
with transcription induction. In rodent osteoblast cells, it
suppresses bone morphogenetic protein 2–induced expression of alkaline phosphatase, osteocalcin, and type I
collagen genes (51) and parathyroid hormone–induced
increase in MMP-13 (50). The study of the regulation of
NMP-4 and p130cas in OA chondrocytes is ongoing.
In summary, the AGRE site and its binding
proteins play important roles in the regulation of
MMP-13 and may be involved in the change of OA
chondrocytes from the L state to the H state. Data from
this study offer a better understanding of the regulation
of MMP-13, and the knowledge acquired will open up
potential novel avenues in the development of therapeutic strategies targeting MMP-13.
ACKNOWLEDGMENTS
We are grateful to Herman Cheung, PhD (University
of Miami, Miami, FL) for providing the MMP-1 promoter
construct and to Pierre Pépin, MSc (Sheldon Biotechnology
Centre, Montreal, Quebec, Canada) for assistance in the
protein sequencing. We also thank Santa Fiori and Virginia
Wallis for assistance in the manuscript preparation.
REFERENCES
1. Freije JM, Diez-Itza I, Balbin M, Sanchez LM, Blasco R, Tolivia J,
et al. Molecular cloning and expression of collagenase-3, a novel
human matrix metalloproteinase produced by breast carcinomas.
J Biol Chem 1994;269:16766–73.
2. Reboul P, Pelletier JP, Tardif G, Cloutier JM, Martel-Pelletier J.
The new collagenase, collagenase-3, is expressed and synthesized
by human chondrocytes but not by synoviocytes: a role in osteoarthritis. J Clin Invest 1996;97:2011–19.
3. Mitchell PG, Magna HA, Reeves LM, Lopresti-Morrow LL,
Yocum SA, Rosner PJ, et al. Cloning, expression, and type II
collagenolytic activity of matrix metalloproteinase-13 from human
osteoarthritic cartilage. J Clin Invest 1996;97:761–8.
4. Billinghurst RC, Dahlberg L, Ionescu M, Reiner A, Bourne R,
Rorabeck C, et al. Enhanced cleavage of Type II collagen by
collagenases in osteoarthritic articular cartilage. J Clin Invest
1997;99:1534–45.
5. Knauper V, Cowell S, Smith B, Lopez-Otin C, O’Shea M, Morris
H, et al. The role of the C-terminal domain of human collagenase-3 (MMP-13) in the activation of procollagenase-3, substrate
specificity, and tissue inhibitor of metalloproteinase interaction.
J Biol Chem 1997;272:7608–16.
6. Fosang AJ, Last K, Knauper V, Murphy G, Neame PJ. Degradation of cartilage aggrecan by collagenase-3 (MMP-13). FEBS Lett
1996;380:17–20.
7. Hashimoto G, Inoki I, Fujii Y, Aoki T, Ikeda E, Okada Y. Matrix
metalloproteinases cleave connective tissue growth factor and
reactivate angiogenic activity of vascular endothelial growth factor
165. J Biol Chem 2002;277:36288–95.
8. Hiller O, Lichte A, Oberpichler A, Kocourek A, Tschesche H.
Matrix metalloproteinases collagenase-2, macrophage elastase,
collagenase-3, and membrane type 1-matrix metalloproteinase
impair clotting by degradation of fibrinogen and factor XII. J Biol
Chem 2000;275:33008–13.
2479
9. Johansson N, Saarialho-Kere U, Airola K, Herva R, Nissinen L,
Westermarck J, et al. Collagenase-3 (MMP-13) is expressed by
hypertrophic chondrocytes, periosteal cells, and osteoblasts during
human fetal bone development. Dev Dyn 1997;208:387–97.
10. Stahle-Backdahl M, Sandstedt B, Bruce K, Lindahl A, Jimenez
MG, Vega JA, et al. Collagenase-3 (MMP-13) is expressed during
human fetal ossification and re-expressed in postnatal bone remodeling and in rheumatoid arthritis. Lab Invest 1997;76:717–28.
11. Bau B, Gebhard PM, Haag J, Knorr T, Bartnik E, Aigner T.
Relative messenger RNA expression profiling of collagenases and
aggrecanases in human articular chondrocytes in vivo and in vitro.
Arthritis Rheum 2002;46:2648–57.
12. Moldovan F, Pelletier JP, Hambor J, Cloutier JM, Martel-Pelletier
J. Collagenase-3 (matrix metalloprotease 13) is preferentially
localized in the deep layer of human arthritic cartilage in situ: in
vitro mimicking effect by transforming growth factor ␤. Arthritis
Rheum 1997;40:1653–61.
13. Moore BA, Aznavoorian S, Engler JA, Windsor LJ. Induction of
collagenase-3 (MMP-13) in rheumatoid arthritis synovial fibroblasts. Biochim Biophys Acta 2000;1502:307–18.
14. Pendas AM, Uria JA, Jimenez MG, Balbin M, Freije JP, LopezOtin C. An overview of collagenase-3 expression in malignant
tumors and analysis of its potential value as a target in antitumor
therapies. Clin Chim Acta 2000;291:137–55.
15. Forsyth CB, Pulai J, Loeser RF. Fibronectin fragments and
blocking antibodies to ␣2␤1 and ␣5␤1 integrins stimulate mitogenactivated protein kinase signaling and increase collagenase 3
(matrix metalloproteinase 13) production by human articular
chondrocytes. Arthritis Rheum 2002;46:2368–76.
16. Loeser RF, Forsyth CB, Samarel AM, Im HJ. Fibronectin fragment activation of proline-rich tyrosine kinase PYK2 mediates
integrin signals regulating collagenase-3 expression by human
chondrocytes through a protein kinase C-dependent pathway.
J Biol Chem 2003;278:24577–85.
17. Tardif G, Reboul P, Dupuis M, Geng C, Duval N, Pelletier JP, et
al. Transforming growth factor-␤ induced collagenase-3 production in human osteoarthritic chondrocytes is triggered by Smad
proteins: cooperation between activator protein-1 and PEA-3
binding sites. J Rheumatol 2001;28:1631–9.
18. Benderdour M, Tardif G, Pelletier J, Di Battista JA, Reboul P,
Ranger P, et al. Interleukin-17 (IL-17) induces collagenase-3
production in human osteoarthritic chondrocytes via an AP-1
dependent activation: differential activation of AP-1 members by
IL-17 and IL-1␤. J Rheumatol 2002;29:1262–72.
19. Guevremont M, Martel-Pelletier J, Massicotte F, Tardif G, Pelletier JP, Ranger P, et al. Human adult chondrocytes express
hepatocyte growth factor (HGF) isoforms but not HGF: potential
implication of osteoblasts on the presence of HGF in cartilage.
J Bone Miner Res 2003;18:1073–81.
20. Yokota H, Goldring MB, Sun HB. CITED2-mediated regulation
of MMP-1 and MMP-13 in human chondrocytes under flow shear.
J Biol Chem 2003;278:47275–80.
21. Tardif G, Pelletier JP, Dupuis M, Hambor JE, Martel-Pelletier J.
Cloning, sequencing and characterization of the 5⬘-flanking region
of the human collagenase-3 gene. Biochem J 1997;323:13–6.
22. Pendas AM, Balbin M, Llano E, Jimenez MG, Lopez-Otin C.
Structural analysis and promoter characterization of the human
collagenase-3 gene (MMP-13). Genomics 1997;40:222–33.
23. Jimenez MJ, Balbin M, Lopez JM, Alvarez J, Komori T, LopezOtin C. Collagenase 3 is a target of Cbfa1, a transcription factor of
the runt gene family involved in bone formation. Mol Cell Biol
1999;19:4431–42.
24. Mengshol JA, Vincenti MP, Brinckerhoff CE. IL-1 induces collagenase-3 (MMP-13) promoter activity in stably transfected chondrocytic cells: requirement for Runx-2 and activation by p38
MAPK and JNK pathways. Nucleic Acids Res 2001;29:4361–72.
25. Benderdour M, Tardif G, Pelletier JP, Dupuis M, Geng C,
2480
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Martel-Pelletier J. A novel negative regulatory element in the
human collagenase-3 proximal promoter region. Biochem Biophys
Res Commun 2002;291:1151–9.
Tardif G, Pelletier JP, Dupuis M, Geng C, Cloutier JM, MartelPelletier J. Collagenase 3 production by human osteoarthritic
chondrocytes in response to growth factors and cytokines is a
function of the physiological state of the cells. Arthritis Rheum
1999;42:1147–58.
Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, et
al. Development of criteria for the classification and reporting of
osteoarthritis: classification of osteoarthritis of the knee. Arthritis
Rheum 1986;29:1039–49.
Mankin HJ, Dorfman H, Lippiello L, Zarins A. Biochemical and
metabolic abnormalities in articular cartilage from osteo-arthritic
human hips. II. Correlation of morphology with biochemical and
metabolic data. J Bone Joint Surg Am 1971;53:523–37.
Rutter JL, Benbow U, Coon CI, Brinckerhoff CE. Cell-type
specific regulation of human interstitial collagenase-1 gene expression by interleukin-1 ␤ (IL-1 ␤) in human fibroblasts and BC-8701
breast cancer cells. J Cell Biochem 1997;66:322–36.
Thunyakitpisal P, Alvarez M, Tokunaga K, Onyia JE, Hock J,
Ohashi N, et al. Cloning and functional analysis of a family of
nuclear matrix transcription factors (NP/NMP4) that regulate type
I collagen expression in osteoblasts. J Bone Miner Res 2001;16:
10–23.
Shevchenko A, Wilm M, Vorm O, Mann M. Mass spectrometric
sequencing of proteins silver-stained polyacrylamide gels. Anal
Chem 1996;68:850–8.
Angel P, Baumann I, Stein B, Delius H, Rahmsdorf HJ, Herrlich
P. 12-O-tetradecanoyl-phorbol-13-acetate induction of the human
collagenase gene is mediated by an inducible enhancer element
located in the 5⬘-flanking region. Mol Cell Biol 1987;7:2256–66.
Quinones S, Saus J, Otani Y, Harris ED Jr, Kurkinen M. Transcriptional regulation of human stromelysin. J Biol Chem 1989;
264:8339–44.
Gaire M, Magbanua Z, McDonnell S, McNeil L, Lovett DH,
Matrisian LM. Structure and expression of the human gene for the
matrix metalloproteinase matrilysin. J Biol Chem 1994;269:
2032–40.
Belaaouaj A, Shipley JM, Kobayashi DK, Zimonjic DB, Popescu
N, Silverman GA, et al. Human macrophage metalloelastase.
Genomic organization, chromosomal location, gene linkage, and
tissue-specific expression. J Biol Chem 1995;270:14568–75.
Anglard P, Melot T, Guerin E, Thomas G, Basset P. Structure and
promoter characterization of the human stromelysin-3 gene. J Biol
Chem 1995;270:20337–44.
Huhtala P, Tuuttila A, Chow LT, Lohi J, Keski-Oja J, Tryggvason
K. Complete structure of the human gene for 92-kDa type IV
collagenase: divergent regulation of expression for the 92- and
72-kilodalton enzyme genes in HT-1080 cells. J Biol Chem 1991;
266:16485–90.
Bian J, Sun Y. Transcriptional activation by p53 of the human type
FAN ET AL
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
IV collagenase (gelatinase A or matrix metalloproteinase 2)
promoter. Mol Cell Biol 1997;17:6330–8.
Lohi J, Lehti K, Valtanen H, Parks WC, Keski-Oja J. Structural
analysis and promoter characterization of the human membranetype matrix metalloproteinase-1 (MT1-MMP) gene. Gene 2000;
242:75–86.
Nakamoto T, Yamagata T, Sakai R, Ogawa S, Honda H, Ueno H,
et al. CIZ, a zinc finger protein that interacts with p130cas and
activates the expression of matrix metalloproteinases. Mol Cell
Biol 2000;20:1649–58.
Ala-aho R, Johansson N, Grenman R, Fusenig NE, Lopez-Otin C,
Kahari VM. Inhibition of collagenase-3 (MMP-13) expression in
transformed human keratinocytes by interferon-␥ is associated
with activation of extracellular signal-regulated kinase-1,2 and
STAT1. Oncogene 2000;19:248–57.
Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/
Cbfa1: a transcriptional activator of osteoblast differentiation. Cell
1997;89:747–54.
Wang X, Manner PA, Horner A, Shum L, Tuan RS, Nuckolls GH.
Regulation of MMP-13 expression by RUNX2 and FGF2 in
osteoarthritic cartilage. Osteoarthritis Cartilage 2004;12:963–73.
Dualan R, Brody T, Keeney S, Nichols AF, Admon A, Linn S.
Chromosomal localization and cDNA cloning of the genes (DDB1
and DDB2) for the p127 and p48 subunits of a human damagespecific DNA binding protein. Genomics 1995;29:62–9.
Hayes S, Shiyanov P, Chen X, Raychaudhuri P. DDB, a putative
DNA repair protein, can function as a transcriptional partner of
E2F1. Mol Cell Biol 1998;18:240–9.
Ijiri K, Zerbini LF, Peng H, Correa RG, Lu B, Walsh N, et al. A
novel role for GADD45␤ as a mediator of MMP-13 gene expression during chondrocyte terminal differentiation. J Biol Chem
2005;280:38544–55.
Sakai R, Iwamatsu A, Hirano N, Ogawa S, Tanaka T, Mano H, et
al. A novel signaling molecule, p130, forms stable complexes in
vivo with v-Crk and v-Src in a tyrosine phosphorylation-dependent
manner. EMBO J 1994;13:3748–56.
Kim W, Kook S, Kim DJ, Teodorof C, Song WK. The 31-kDa
caspase-generated cleavage product of p130cas functions as a
transcriptional repressor of E2A in apoptotic cells. J Biol Chem
2004;279:8333–42.
O’Neill GM, Fashena SJ, Golemis EA. Integrin signalling: a new
Cas(t) of characters enters the stage. Trends Cell Biol 2000;10:
111–9.
Shah R, Alvarez M, Jones DR, Torrungruang K, Watt AJ,
Selvamurugan N, et al. Nmp4/CIZ regulation of matrix metalloproteinase 13 (MMP-13) response to parathyroid hormone in
osteoblasts. Am J Physiol Endocrinol Metab 2004;287:E289–96.
Shen ZJ, Nakamoto T, Tsuji K, Nifuji A, Miyazono K, Komori T,
et al. Negative regulation of bone morphogenetic protein/Smad
signaling by Cas-interacting zinc finger protein in osteoblasts.
J Biol Chem 2002;277:29840–6.
Документ
Категория
Без категории
Просмотров
4
Размер файла
233 Кб
Теги
site, matrix, osteoarthritis, identification, agree, human, proximal, promote, regulatory, protein, novem, binding, chondrocyte, metalloprotease
1/--страниц
Пожаловаться на содержимое документа