close

Вход

Забыли?

вход по аккаунту

?

Identification of two piwi genes and their expression profile in honeybee Apis mellifera.

код для вставкиСкачать
A r t i c l e
IDENTIFICATION OF TWO PIWI
GENES AND THEIR EXPRESSION
PROFILE IN HONEYBEE,
Apis mellifera
Zhen Liao, Qidong Jia, Fei Li, and Zhaojun Han
Department of Entomology, Nanjing Agricultural University/Key
Laboratory of Monitoring and Management of Crop Diseases and Pest
Insects, Ministry of Agriculture, Nanjing, China
Piwi genes play an important role in regulating spermatogenesis and
oogenesis because they participate in the biogenesis of piRNAs, a new
class of noncoding RNAs. However, these genes are not well understood
in most insects. To understand the function of piwi genes in honeybee
reproduction, we amplified two full-length piwi-like genes, Am-aub and
Am-ago3. Both the cloned Am-aub and Am-ago3 genes contained typical
PAZ and PIWI domains and active catalytic motifs ‘‘Asp-Asp-Asp/His/
Glu/Lys,’’ suggesting that the two piwi-like genes possessed slicer activity.
We examined the expression levels of Am-aub and Am-ago3 in workers,
queens, drones, and female larvae by quantitative PCR. Am-aub was
more abundant than Am-ago3 in all the tested samples. Both Am-aub
and Am-ago3 were highly expressed in drones but not in workers and
queens. The significant finding was that the larval food stream
influenced the expression of Piwi genes in adult honeybees. This helps to
understand the nutritional control of reproductive status in honeybees at
C 2010 Wiley Periodicals, Inc.
the molecular level. Keywords: Piwi; Apis mellifera; gene expression; worker and queen;
nutritional control
Grant sponsor: National Basic Research Program of China; Grant numbers: 2009CB125902; 2010CB126200;
Grant sponsor: National Science Foundation of China; Grant numbers: 30771417; 30871636; Grant sponsor:
National Science Foundation of Jiangsu Province; Grant number: BK2007524.
Correspondence to: Fei Li, PhD, Professor, Department of Entomology, Nanjing Agricultural Unviersity,
Nanjing 210095, Jiangsu province, China. E-mail: lifei@njau.edu.cn
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 74, No. 2, 91–102 (2010)
Published online in Wiley InterScience (www.interscience.wiley.com).
& 2010 Wiley Periodicals, Inc. DOI: 10.1002/arch.20362
92
Archives of Insect Biochemistry and Physiology, June 2010
INTRODUCTION
Argonaute protein is the core factor of RNA-induced silencing complex (RISC) in RNA
interference (Hammond et al., 2001). It is characterized by two conserved domains,
PAZ (Piwi-Argonaute-Zwille) and PIWI. The PAZ domain can bind with single-stranded
nucleic acid (Song et al., 2003; Szymczyna et al., 2003; Yan et al., 2003) and the PIWI
domain possesses RNase H activity (Song et al., 2004). Generally, the argonaute protein
family is divided into two sub-clades, the Ago and the Piwi subfamilies. The Piwi subfamily is named after Drosophila Piwis, which have three members, piwi, aub, and ago3.
Normally, PIWI means the functional domain of piwi genes.
Ago genes are expressed ubiquitously in all tissues (Hammond et al., 2000; Mourelatos
et al., 2002), whereas Piwi gene expression is limited to germline cells and stem cells in
Drosophila (Cox et al., 1998). Piwi genes are involved in the biogenesis of a novel type of
small RNAs named piwi-interacting small RNA (piRNA). piRNAs are different from
miRNAs and siRNAs in length and biosynthesis mechanisms (Houwing et al., 2007; Malone
et al., 2009). In most species, there are 2 or 3 members of the Piwi sub-family (Zhou et al.,
2007), although humans have four Piwi-like proteins (Qiao et al., 2002; Sasaki et al., 2003).
The piwi subfamily plays important roles in spermatogenesis regulation, germline
determination (Harris and Macdonald, 2001; Megosh et al., 2006), stem cell self-renewal
(Moussian et al., 1998; Unhavaithaya et al., 2009), transposon silencing (Brennecke et al.,
2008; Houwing et al., 2007), and DNA methylation of retrotransposons (KuramochiMiyagawa et al., 2008). Expression and mobilization of mdg1 retrotransposon were
altered in piwi-mutated Drosophila (Kalmykova et al., 2005). Mili and Miwi2 in mouse,
Mus musculus, regulate retrotransposon expression by impairing DNA methylation in the
regulatory region at the level of de novo methylation (Aravin et al., 2008).
Compared with their counterparts in vertebrates, insect piwis remain understudied. Our current understanding of piwis in insects is limited to model organisms
such as Drosophila species and Bombyx mori (Kawaoka et al., 2008). Honeybee piwis have
not been investigated, although reproduction in honeybees differs from the model
insect species. In a honey bee colony, there are several drones, thousands of sterile
workers, and one queen. The queen is the only fertile female in the colony. The female
workers and queen differ morphologically and physiologically in the adult stage.
Larval diet determines queen (royal jelly) and worker (honey and pollen) fates.
Juvenile hormone, the insulin signaling pathway and TOR pathway are involved in the
queen/worker differentiation (de Azevedo and Hartfelder, 2008). DNA methyltransferase Dnmt3 participates in the development of female larvae (Kucharski et al., 2008).
Piwi genes also participate in regulating DNA methylation, but our interest is in
whether piwi genes are expressed differently in honey bee workers and queens. Here
we amplified two full-length genes, Am-aub and Am-ago3, and investigated their
expression levels in honey bees with quantitative PCR.
MATERIALS AND METHODS
Insects
A. mellifera colonies were collected from the Jiangpu Farm, Nanjing, China. Drones,
queens, and workers were separately frozen in liquid nitrogen. In Nanjing area, the
Archives of Insect Biochemistry and Physiology
Expression of Two Piwi Genes in Honeybee
93
larval stage of queens and workers lasts for 9 days. The worker and queen pupal stages
take 8 and 5 days, respectively. To estimate the mRNA abundance at different stages,
we collected larvae on day 5 and day 8, pupae on day 3 and day 6 fed with honey/
pollen at the larval stage, and pupae on day 2 and day 4 fed with royal jelly.
RNA Isolation and cDNA Synthesis
Total RNA was extracted by homogenizing larvae, pupae, or adult honeybees in
TrizolTM reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions.
The cDNA was synthesized with 1 mg total RNA as template and Oligo (dT) 18 primer
as anchor primers. Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase
(Takara, Bio Inc., Shiga, Japan) was used at 371C for 50 min. The reaction was stopped
by heating at 701C for 15 min. All experiments were repeated in triplicates.
RACE Amplification
To get the full-length sequence of piwis in honeybees, Rapid Amplification of cDNA
End (RACE) PCRs was performed using SMARTTM RACE cDNA Amplification Kit
(Takara, Bio Inc., Shiga, Japan) for 30 end amplification of Am-ago3 and GeneRacer kit
(Invitrogen) for 30 end of Am-aub and 50 ends of both genes. The full-length transcripts
were assembled with RACE results and then confirmed by end-to-end PCRs using
primers designed at both ends (Table 1). The amino acid sequences were determined
by an ORF finder in NCBI and Gene-explorer using the full-length cDNA sequences
(http://www.ncbi.nlm.nih.gov/projects/gorf/). Gene structures of both piwis were
Table 1. Primers Used for RT-PCR, RACE, and Real-Time PCR
Method
Gene name
Primer name
RT-PCR
Amaub
Fragment_forward
Fragment_reverse
Fragment_forward
Fragment_reverse
End to end_forward
End to end_reverse
End to end_forward
End to end_reverse
50 race_gsp
50 race_ngsp
30 race_gsp
30 race_ngsp
50 race_gsp
50 race_ngsp
30 race_gsp
30 race_ngsp
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Amago3
Amaub
Amago3
RACE
Amaub
Amago3
Real-time PCR
Krh 1
Amaub
Amago3
Rp49
Archives of Insect Biochemistry and Physiology
Sequence
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
50
TCCAGGGCATAAAGAAGAAA 30
GTGCAACCAAAAAAGCAAGT 30
TCAAGGAACTGAGGGGGAGC 30
ACATCGGGCATTGGGAGACA 30
CCCAACCGAACGATCAATTC 30
TGGTGGACGACGCACAAACT 30
GCACTTGGACGAACAAAGGTATT 30
TGCATATTGACAAGGAGCAGGTAC 30
CGAACCGCAGTGCGATCTTCTTCCG 30
CGTCTACCTCGCATAGCACCTCTTCCCA 30
TCGTGATGGCGTAGGTGAGGGTCAGGT 30
ACCGTTAGAGTACCTGCGCCTTGCCA 30
CATCACATCGGGCATTGGGAGACATT 30
ACGTACTGTTTCTGTCCGCATGAC 30
AAATGTCTCCCAATGCCCGATGTGATG 30
AAGCAGTGGTATCAACGCAGAGT 30
GCCAGGAAATGATGCTCGTAGAAG 30
AGGTACAGGACTCACAGGATTGC 30
TTACCAACGCCTCTCAACCAATG 30
AGATATACCAATTCGGCTTGACCAG 30
GCAAGTTTGAGCGACAGTATTC 30
ATACATCACATCGGGCATTGG 30
CGTCATATGTTGCCAACTGGTT 30
GATTTACGTTTTTTACTGCTCCCC 30
94
Archives of Insect Biochemistry and Physiology, June 2010
analyzed by using the BLAT program in the UCSC database with default parameters
with the putative amino acid sequences as the queries (http://genome.ucsc.edu).
Real-Time PCR
The mRNA abundance of piwi genes was estimated by quantitative real-time PCR
(qPCR) using ABI Prism 7300 (ABI, Foster City, CA). The qPCR reactions were carried
out with SYBR Premix Ex TaqTM (Takara, Bio Inc., Shiga, Japan) following the
manufacturer’s protocol. The housekeeping gene krh1 was used as the internal
control for normalization. The primers for qPCR were designed with Beacon Designer
7.0. The sequences of primers are given in Table 1. The qPCR reactions were initiated
at 951C for 10 sec, followed by 40 cycles of 951C for 5 sec, and 601C for 31 sec. The
specificity of the PCR reactions was verified with gel electrophoresis and with melting
curve analysis using the Sequence Detection System (SDS). The PCR products were
confirmed by direct sequencing. Amplification efficiencies were determined by the
method of template dilution. The relative copy numbers of piwi genes were calculated
according to the 2DDCt method (Pfaffl, 2001). The mRNA levels of piwi genes in
different developmental stages were analyzed using the Data Processing System (DPS).
The difference was considered significant when Po0.05 in the Student’s t-test.
Phylogenetic Analysis
The conserved domains were predicted by the NCBI CDS-Conserved-Domainsprediction-sever (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) using the
deduced amino acid sequences. The multiple Piwi protein sequence alignments were
performed by CLUSTALX (version 1.83). The consensus alignment sequences were
used in MEGA 4.0 software to construct a phylogenetic tree using Neighbor Joining.
RESULTS
The Full Length of Two piwi Genes in Honey Bee
There were two piwi genes of A. mellifera in the GenBank database (XM_395884,
XM_001120996). However, they were incomplete on the 50 end and lacked both
50 UTR and 30 UTR, for they were predicted by automated computational analysis from
the genomic sequence. To better understand piwi genes in honeybees, we amplified
two full-length piwi genes with RACE strategy. Based on their similarity with other
known piwi genes, the piwi genes here were named Am-aub and Am-ago3 after Piwi
genes in D. melanogaster. The full length of Am-aub was 3,754 bp including a 2,484-bp
open reading frame (ORF) and a 23-bp poly (A) tail. The deduced protein sequence
contained 828 amino acid residues (GenBank accession number: GQ444142). The full
length of Am-ago3 genes was 3,005 bp including a 2,739-bp ORF and a 31-bp poly (A)
tail. The deduced protein sequence contained 912 amino acid residues (GenBank
accession number: GQ444137).
In the end-to-end PCRs, we detected several alternatively spliced isoforms of both
Am-aub and Am-ago3. Another transcript of Am-aub was found and it was 162 bp
shorter near the 50 end, which made 50 UTR longer, at 844 bp, and ORF
shorter, encoding only 799aa (GenBank accession number: GQ444143. Fig. 1A). For
Am-ago3 genes, there were five alternatively spliced transcripts (GenBank accession
Archives of Insect Biochemistry and Physiology
Expression of Two Piwi Genes in Honeybee
95
Figure 1. Genomic structure of Am-aub and Am-ago3 in A. mellifera. Exons were indicated with blue box,
and introns were shown as blue line. 50 UTR and 30 UTR were marked with red color. A: Genomic structure
of Am-aub. Seven exons exist in the full transcripts. There are two isoforms detected by end-to-end PCRs.
B: Genomic structure of Am-ago3. There were 13 exons in the full transcript. Five alternative isoforms were
detected.
numbers: GQ444138, GQ444139, GQ444140, GQ444141). The alternatively spliced
regions were mainly at the fifth, sixth, seventh, and ninth exons. Interestingly, only
one isoform contained an intact ORF (Fig. 1B). The roles of different and alternatively
spliced transcripts were unclear and required further investigation.
Genomic Structure and Domain Analysis
The genomic structures of Am-aub and Am-ago3 were determined by comparing the
deduced protein sequences with A. mellifera genomic sequence in the UCSC database
using the BLAT program. Am-aub possessed seven exons and Am-ago3 had 13 exons.
The locations of each exon are given in Table 2. Am-aub was at the plus strand and
Am-ago3 was at the minus strand.
We used the NCBI CDS-Conserved-Domains-prediction-sever to analyze Am-aub
and Am-ago3. The results indicated that both genes in Piwi subfamily contained typical
PAZ and PIWI domains (Fig. 2). The predicted PAZ domain of Am-aub was 116aa,
positioned between 246 to 361 of Am-aub. The PAZ domain of Am-ago3 was 119aa,
positioned between 332 to 440 of Am-ago3. The PIWI domains of Am-aub and Am-ago3
were 442aa and 448aa, respectively. PAZ and PIWI domains were located at the
C-terminal of genes, which was consistent with known Piwi subfamilies. Both Am-aub
Archives of Insect Biochemistry and Physiology
96
Archives of Insect Biochemistry and Physiology, June 2010
Table 2. Genomic Location of Exons in CDS
Position
Genes
Chromosome
Strand
Exons in the CDS region
Start
End
Am-ago3
Group-13
Am-aub
Group-Un
1
Exon 1
Exon 2
Exon 3
Exon 4
Exon 5
Exon 6
Exon 7
Exon 8
Exon 9
Exon 10
Exon 11
Exon 12
Exon 1
Exon 2
Exon 3
Exon 4
Exon 5
Exon 6
Exon 7
7,903,121
7,852,928
7,851,948
7,851,702
7,851,359
7,850,967
7,850,620
7,850,202
7,849,885
7,849,667
7,849,311
7,849,046
10,195,228
10,195,456
10,195,672
10,195,956
10,196,274
10,196,513
10,196,922
7,902,929
7,852,903
7,851,790
7,851,504
7,851,046
7,850,706
7,850,270
7,849,952
7,849,735
7,849,467
7,849,120
7,848,717
10,195,316
10,195,593
10,195,880
10,196,141
10,196,441
10,196,794
10,198,330
Figure 2. Conserved PAZ and PIWI domains of Am-aub and Am-ago3 in A. mellifera. RNA-binding interface
in PAZ domain is marked by yellow arrowheads. 50 RNA guide strand anchoring sites and slicer-active sites
are indicated with green and blue arrowheads, respectively. The intact catalytic triad DDH existed in both
Am-aub and Am-ago3.
and Am-ago3 were slicer-like as they possessed degenerate active catalytic motifs ‘‘AspAsp-Asp/His/Glu/Lys’’ (DDH).
Phylogenetic Analysis of piwi-Subfamily
We collected 17 genes of Piwi subfamily including 15 previously reported Piwis from
Homo sapiens, Mus musculus, Rattus norvegicus, Danio rerio, D. melanogaster, and Bombyx
mori (See Table S2, which is available online). The phylogenetic tree was built with
MEGA 4.0 software using the Neighbor Joining method. Bootstrap support values (in
percent) based on 1,000 replicates are shown in the tree. As expected, two Piwis in
honey bees belonged to an insect cluster (Fig. 3). Honeybee Piwi genes were closer to
B. mori than D. melanogaster. Interestingly, Hili, Mili, and Zili were in the same cluster
with insect Ago3, suggesting that they might have similar functions to those of insect
Ago3.
Archives of Insect Biochemistry and Physiology
Expression of Two Piwi Genes in Honeybee
97
Figure 3. Evolutional tree of the Piwi subfamily. The tree was constructed using 17 piwi subfamily
members, including 15 known piwis and Am-aub and Am-ago3 in A. mellifera. GenBank Accession numbers of
these genes are: Mili (BAA93706), Miwi (BAA93705), Miwi2 (AAN75583), Ziwi (NP_899181), Zili
(ACH96370), Riwi (XP_344106), Hiwi (AAC97371), Hiwi2 (BAC81341), Piwil3 (BAC81343), Hili
(BAC81342), Piwi (AAD08705), Ago3 (ABO26294), Aubergine (NP_476734), Siwi (AB372006), and Bmago3
(AB372007).
High Expression of Am-aub and Am-ago3 in Drone
The mRNA abundance of Am-aub and Am-ago3 in workers, drones, and queens was
estimated with quantitative real-time PCR. The relative mRNA levels were calculated
using the 2DDCt method and normalized with housekeeping gene krh1. The
amplification efficiency of each pair of primers was estimated by a series of dilutions
of the cDNA template. The results indicated that these primer pairs had similar
amplification efficiency. Therefore, the qRT-PCR results produced from these primers
were comparable. Generally, Am-aub was more abundant than Am-ago3. The highest
expression of Am-aub and Am-ago3 was observed in drones, and the lowest expression
was found in workers. The abundance of Am-aub and Am-ago3 in drones was 28- and
12-fold higher than that in workers (Fig. 4). Both Am-aub and Am-ago3 were more
abundant in queens than workers.
The Impact of Different Foods Fed at Larval Stage on the Expression of Piwi Subfamily
The mRNA levels of Am-aub and Am-ago3 in the aforementioned developmental stages
were estimated with quantitative real time PCR. Generally, the expression changes of
Am-aub and Am-ago3 displayed similar trends to those in queens and workers. The
mRNA levels increased from the larval stage to the pupal stage, but decreased at the
adult stage. However, differences were also observed between queens and workers
(Fig. 5). In queens, the changes of Am-aub and Am-ago3 were nearly the same. The
Archives of Insect Biochemistry and Physiology
98
Archives of Insect Biochemistry and Physiology, June 2010
Figure 4. Expression of Am-aub and Am-ago3 in worker, drone, and queen. The relative mRNA abundance
was calculated using the 2DDCt method and normalized with the housekeeping krh1 gene. Am-aub and
Am-ago3 genes are expressed in all three types of adult honeybee.
mRNA reached its highest level in pupae on the second day, about 21- and 18-fold
higher than those in larvae on the fifth day (Fig. 5A). In workers, there was a
significant difference between Am-aub and Am-ago3. The expression of Am-ago3
reached the highest level at the late pupal stage. The relative amount of Am-ago3 was
significantly higher than that of Am-aub in workers. The mRNA level of Am-ago3 in
pupae on the sixth day was 16-fold higher than that in larvae on the fifth day. Different
from Am-ago3, the mRNA level of Am-aub in pupae on the sixth day was only 4-fold
higher than that in larvae on the fifth day. Our work indicated that different foods fed
at the larval stage led to different expressions of Piwi genes. This was an interesting
discovery.
DISCUSSION
Though the Piwi subfamily was discovered over ten years ago, it did not receive
extensive attention until recently. In 2006, Piwi genes were reported to participate in
the biogenesis of Piwi-interacting RNA (piRNA) (Girard et al., 2006; Grivna et al.,
2006; Kim, 2006). The main function of piRNA is to control transposon activity in the
gremmie line by the Ping-Pong model in which piwi/aub binds itself with antisense
piRNA that directs the cleavage of sense piRNA. And Ago3 binds itself with sense
piRNA, which guides the cleavage of antisense piRNA. Though three members of the
Piwi subfamily were reported in Drosophila species and even four in humans, there are
only two piwi genes found in most insect species. For example, two Piwi genes, Siwi
and BmAgo3, were reported in silkworms (Kawaoka et al., 2009). In the Xenopus
female germline, only two piwi genes, Xiwi and Xili, were expressed (Wilczynska et al.,
2009). In this study, genome-wide searching for Piwi genes resulted in the detection of
only two piwi genes, Am-aub and Am-ago3, in honeybees. Phylogenetic analysis
indicated that the Piwi subfamily could be divided into three clusters, Piwi, Aubergine
(Aub), and Ago3. Our previous work proved that Piwi and Aub were not only in the
same clade of evolutional tree but also located adjacently in insect genomes, suggesting
that Piwi and Aub originated from a recent duplication in some insect species (Zhou
et al., 2007). Ago3 is indispensible for the Ping-Pong model. However, only Piwi or
Archives of Insect Biochemistry and Physiology
Expression of Two Piwi Genes in Honeybee
99
Figure 5. Expressional difference of Am-aub and Am-ago3 between larvae, pupa, and adult stage of worker
and queen. A: Expression of Am-aub and Am-ago3 in different stages of the worker feeding on pollen/honey.
The mRNA changes are different between Am-aub and Am-ago3. B: Expression of Am-aub and Am-ago3 in
different stages of the queen feeding on the royal jelly. The mRNA changes are quite similar between Am-aub
and Am-ago3.
Aub is necessary for the Ping-Pong model, although they are both present in some
species. We inferred from our results that the evolution of the Piwi subfamily was an
important indicator of that of piRNA-associated gene regulation. Compared with
insects, mammals have more Piwi genes, suggesting that the Ping-Pong model
becomes complex in the mammalian.
The Piwi subfamily was mostly studied in the male germline because almost all
Piwi proteins were expressed in male testis but only a few were found in oocytes. For
example, only Mili was expressed in mouse oocytes but Mili, Miwi, and Miwi2 were all
found in mouse testis (Aravin and Hannon, 2008; Watanabe et al., 2008). Here, we
presented a piece of evidence that two Piwi genes were detected in female honeybees.
The Piwi subfamily was also observed in the female oocytes of Xenopus (Wilczynska
Archives of Insect Biochemistry and Physiology
100
Archives of Insect Biochemistry and Physiology, June 2010
et al., 2009), in the Bombyx ovary-derived cell line BmN4 (Kawaoka et al., 2009), in
Drosophila ovary (Lau et al., 2009), and in the female gonad of Zebrafish (Houwing
et al., 2007). In addition, piRNAs were also cloned from the ovary or ovary-derived cell
line of the aforementioned organisms. The roles of Piwi proteins and their associated
piRNAs in the female ovary are still required elucidation.
Our work also found the difference of piwi genes’ expression between queens and
workers. This difference is very likely due to the differentiation between the queens
and the workers. Since the larvae of queens and workers were fed with different food,
we deduced that the food taken at the larval stage had an important influence on the
expression of the Piwi subfamily in female honeybees. However, the molecular
mechanism of nutrition control of reproductive status remains unclear. Recently, an
interesting report proved that RNA interference of Dnmt3 in newly hatched larvae led
to a royal jelly-like effect on larval reproductive development (Kucharski et al., 2008).
Our work suggested that the Piwi subfamily might also participate in the nutritional
control of honeybee larvae. Since the Piwi subfamily is an important regulator in
oogenesis, we argue that Piwi proteins are direct responders in the nutritional control
pathway. The roles of the Piwi subfamily in the nutritional control pathway are worthy
of further investigation.
ACKNOWLEDGMENTS
We thank Peng He and Xuchu Duan for their kind assistance in constructing the
phylogenetic tree and designing the qPCR primers. This work was in part supported
by National Basic Research Program of China (2009CB125902, 2010CB126200), the
National Science Foundation of China (30771417, 30871636) and National Science
Foundation of Jiangsu Province (BK2007524).
LITERATURE CITED
Aravin AA, Hannon GJ. 2008. Small RNA silencing pathways in germ and stem cells. Cold
Spring Harb Symp Quant Biol 73:283–290.
Aravin AA, Sachidanandam R, Bourc’his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
2008. A piRNA pathway primed by individual transposons is linked to de novo DNA
methylation in mice. Mol Cell 31:785–799.
Brennecke J, Malone CD, Aravin AA, Sachidanandam R, Stark A, Hannon GJ. 2008. An
epigenetic role for maternally inherited piRNAs in transposon silencing. Science
322:1387–1392.
Cox DN, Chao A, Baker J, Chang L, Qiao D, Lin H. 1998. A novel class of evolutionarily
conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev
12:3715–3727.
de Azevedo SV, Hartfelder K. 2008. The insulin signaling pathway in honey bee (Apis mellifera)
caste development: differential expression of insulin-like peptides and insulin receptors in
queen and worker larvae. J Insect Physiol 54:1064–1071.
Girard A, Sachidanandam R, Hannon GJ, Carmell MA. 2006. A germline-specific class of small
RNAs binds mammalian Piwi proteins. Nature 442:199–202.
Grivna ST, Beyret E, Wang Z, Lin H. 2006. A novel class of small RNAs in mouse spermatogenic
cells. Genes Dev 20:1709–1714.
Hammond SM, Bernstein E, Beach D, Hannon GJ. 2000. An RNA-directed nuclease mediates
post-transcriptional gene silencing in Drosophila cells. Nature 404:293–296.
Archives of Insect Biochemistry and Physiology
Expression of Two Piwi Genes in Honeybee
101
Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ. 2001. Argonaute2, a link
between genetic and biochemical analyses of RNAi. Science 293:1146–1150.
Harris AN, Macdonald PM. 2001. Aubergine encodes a Drosophila polar granule component
required for pole cell formation and related to eIF2C. Development 128:2823–2832.
Houwing S, Kamminga LM, Berezikov E, Cronembold D, Girard A, van den Elst H,
Filippov DV, Blaser H, Raz E, Moens CB, Plasterk RH, Hannon GJ, Draper BW,
Ketting RF. 2007. A role for Piwi and piRNAs in germ cell maintenance and transposon
silencing in Zebrafish. Cell 129:69–82.
Kalmykova AI, Klenov MS, Gvozdev VA. 2005. Argonaute protein PIWI controls mobilization of
retrotransposons in the Drosophila male germline. Nucleic Acids Res 33:2052–2059.
Kawaoka S, Minami K, Katsuma S, Mita K, Shimada T. 2008. Developmentally synchronized
expression of two Bombyx mori Piwi subfamily genes, SIWI and BmAGO3 in germ-line cells.
Biochem Biophys Res Commun 367:755–760.
Kawaoka S, Hayashi N, Suzuki Y, Abe H, Sugano S, Tomari Y, Shimada T, Katsuma S. 2009. The
Bombyx ovary-derived cell line endogenously expresses PIWI/PIWI-interacting RNA
complexes. RNA 15:1258–1264.
Kim VN. 2006. Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian
testes. Genes Dev 20:1993–1997.
Kucharski R, Maleszka J, Foret S, Maleszka R. 2008. Nutritional control of reproductive status in
honeybees via DNA methylation. Science 319:1827–1830.
Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Totoki Y, Toyoda A, Ikawa M, Asada N,
Kojima K, Yamaguchi Y, Ijiri TW, Hata K, Li E, Matsuda Y, Kimura T, Okabe M, Sakaki Y,
Sasaki H, Nakano T. 2008. DNA methylation of retrotransposon genes is regulated by Piwi
family members MILI and MIWI2 in murine fetal testes. Genes Dev 22:908–917.
Lau N, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC. 2009. Abundant primary
piRNAs, endo-siRNAs and microRNAs in a Drosophila ovary cell line. Genome Res
19:1776–1785.
Malone CD, Brennecke J, Dus M, Stark A, McCombie WR, Sachidanandam R, Hannon GJ.
2009. Specialized piRNA pathways act in germline and somatic tissues of the Drosophila
ovary. Cell 137:522–535.
Megosh HB, Cox DN, Campbell C, Lin H. 2006. The role of PIWI and the miRNA machinery in
Drosophila germline determination. Curr Biol 16:1884–1894.
Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M,
Dreyfuss G. 2002. miRNPs: a novel class of ribonucleoproteins containing numerous
microRNAs. Genes Dev 16:720–728.
Moussian B, Schoof H, Haecker A, Jurgens G, Laux T. 1998. Role of the ZWILLE gene in the
regulation of central shoot meristem cell fate during Arabidopsis embryogenesis. EMBO J
17:1799–1809.
Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time PCR. Nucleic
Acids Res 29:2002–2007.
Qiao D, Zeeman AM, Deng W, Looijenga LH, Lin H. 2002. Molecular characterization of hiwi, a
human member of the piwi gene family whose overexpression is correlated to seminomas.
Oncogene 21:3988–3999.
Sasaki T, Shiohama A, Minoshima S, Shimizu N. 2003. Identification of eight members of the
Argonaute family in the human genome small star, filled. Genomics 82:323–330.
Song JJ, Liu J, Tolia NH, Schneiderman J, Smith SK, Martienssen RA, Hannon GJ,
Joshua-Tor L. 2003. The crystal structure of the Argonaute2 PAZ domain reveals an RNA
binding motif in RNAi effector complexes. Nat Struct Biol 10:1026–1032.
Song JJ, Smith SK, Hannon GJ, Joshua-Tor L. 2004. Crystal structure of Argonaute and its
implications for RISC slicer activity. Science 305:1434–1437.
Archives of Insect Biochemistry and Physiology
102
Archives of Insect Biochemistry and Physiology, June 2010
Szymczyna BR, Bowman J, McCracken S, Pineda-Lucena A, Lu Y, Cox B, Lambermon M,
Graveley BR, Arrowsmith CH, Blencowe BJ. 2003. Structure and function of the PWI motif: a
novel nucleic acid-binding domain that facilitates pre-mRNA processing. Genes Dev 17:461–475.
Unhavaithaya Y, Hao Y, Beyret E, Yin H, Kuramochi-Miyagawa S, Nakano T, Lin H. 2009.
MILI, a PIWI-interacting RNA-binding protein, is required for germ line stem cell selfrenewal and appears to positively regulate translation. J Biol Chem 284:6507–6519.
Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, Obata Y, Chiba H,
Kohara Y, Kono T, Nakano T, Surani MA, Sakaki Y, Sasaki H. 2008. Endogenous siRNAs
from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 453:539–543.
Wilczynska A, Minshall N, Armisen J, Miska EA, Standart N. 2009. Two Piwi proteins, Xiwi and
Xili, are expressed in the Xenopus female germline. RNA 15:337–345.
Yan KS, Yan S, Farooq A, Han A, Zeng L, Zhou MM. 2003. Structure and conserved RNA
binding of the PAZ domain. Nature 426:468–474.
Zhou X, Liao Z, Jia Q, Cheng L, Li F. 2007. Identification and characterization of Piwi subfamily
in insects. Biochem Biophys Res Commun 362:126–131.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
1
Размер файла
258 Кб
Теги
expressions, two, profil, honeybee, identification, genes, apis, mellifera, piwi
1/--страниц
Пожаловаться на содержимое документа