close

Вход

Забыли?

вход по аккаунту

?

MicroRNA-146a contributes to abnormal activation of the type I interferon pathway in human lupus by targeting the key signaling proteins.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 60, No. 4, April 2009, pp 1065–1075
DOI 10.1002/art.24436
© 2009, American College of Rheumatology
MicroRNA-146a Contributes to Abnormal Activation of the
Type I Interferon Pathway in Human Lupus by
Targeting the Key Signaling Proteins
Yuanjia Tang,1 Xiaobing Luo,1 Huijuan Cui,1 Xuming Ni,1 Min Yuan,1 Yanzhi Guo,1
Xinfang Huang,1 Haibo Zhou,1 Niek de Vries,2 Paul Peter Tak,2 Shunle Chen,1 and Nan Shen1
Objective. MicroRNA have recently been identified as regulators that modulate target gene expression
and are involved in shaping the immune response. This
study was undertaken to investigate the contribution of
microRNA-146a (miR-146a), which was identified in the
pilot expression profiling step, to the pathogenesis of
systemic lupus erythematosus (SLE).
Methods. TaqMan microRNA assays of peripheral blood leukocytes were used for comparison of
expression levels of microRNA between SLE patients
and controls. Transfection and stimulation of cultured
cells were conducted to determine the biologic function
of miR-146a. Bioinformatics prediction and validation
by reporter gene assay and Western blotting were performed to identify miR-146a targets.
Results. Profiling of 156 miRNA in SLE patients
revealed the differential expression of multiple microRNA, including miR-146a, a negative regulator of
innate immunity. Further analysis showed that underexpression of miR-146a negatively correlated with clinical disease activity and with interferon (IFN) scores in
patients with SLE. Of note, overexpression of miR-146a
reduced, while inhibition of endogenous miR-146a increased, the induction of type I IFNs in peripheral blood
mononuclear cells (PBMCs). Furthermore, miR-146a
directly repressed the transactivation downstream of
type I IFN. At the molecular level, miR-146a could
target IFN regulatory factor 5 and STAT-1. More importantly, introduction of miR-146a into the patients’
PBMCs alleviated the coordinate activation of the type
I IFN pathway.
Conclusion. The microRNA miR-146a is a negative regulator of the IFN pathway. Underexpression of
miR-146a contributes to alterations in the type I IFN
pathway in lupus patients by targeting the key signaling
proteins. The findings provide potential novel strategies
for therapeutic intervention.
Supported in part by the National Basic Research Program of
China (973 Program, grant 2007CB947900), the National High Technology Research and Development Program of China (863 Program,
grant 2007AA02Z123), the National Natural Science Foundation of
China (grant 30700734), the Key Basic Program of the Shanghai
Commission of Science and Technology (grants 06JC14050 and
08JC1414700), and the Program of Shanghai Subject Chief Scientist
(grant 07XD14021).
1
Yuanjia Tang, PhD, Xiaobing Luo, PhD, Huijuan Cui, MD,
Xuming Ni, BS, Min Yuan, MD, Yanzhi Guo, MD, Xinfang Huang,
MD, Haibo Zhou, PhD, Shunle Chen, MD, Nan Shen, MD: Joint
Molecular Rheumatology Laboratory of the Institute of Health Sciences and Shanghai Renji Hospital, Shanghai Institutes for Biological
Sciences, Chinese Academy of Sciences, and Shanghai Jiaotong University School of Medicine, Shanghai, China; 2Niek de Vries, MD,
PhD, Paul Peter Tak, MD, PhD: Academic Medical Center, University
of Amsterdam, Amsterdam, The Netherlands.
Drs. Tang, Luo, and Cui contributed equally to this work.
Address correspondence and reprint requests to Nan Shen,
MD, Department of Rheumatology, Renji Hospital, Shanghai Jiaotong University School of Medicine, 145 Shan Dong Road (Central),
Shanghai 200001, China. E-mail: shennand@online.sh.cn.
Submitted for publication March 17, 2008; accepted in revised
form January 10, 2009.
Systemic lupus erythematosus (SLE) is a complex
autoimmune disease characterized by chronic immune
activation and multiple immunologic phenotypes (for
review, see ref. 1). The pathogenesis of SLE is poorly
understood, and current therapies are based on nonspecific immunosuppression. Among numerous immunologic alterations present in lupus patients, the type I
interferon (IFN) system is thought to play a pivotal role
in pathogenesis (2–4). It is well known that many
patients with SLE have elevated serum levels of IFN␣
(5) and that these increased levels correlate with disease
activity and severity (6,7). Using peripheral blood samples from SLE patients, we and other groups of investigators have independently identified the expression patterns of IFN-inducible genes (8–11), which is referred to
as the IFN signature. This signature is associated with
severe manifestations of the disease, such as nephritis
1065
1066
TANG ET AL
(12), and reflects coordinate activation of the type I IFN
pathway in vivo (10).
Recent recognition of the central role of type I
IFN in SLE has led to a new understanding of the
significant role of the innate immune system in the
predisposition to, and amplification of, autoimmunity
and tissue damage (4), especially the Toll-like receptor 7
(TLR-7) pathway, which has been shown to be the most
important molecular pathway responsible for induction
of excessive type I IFN in both murine and human lupus
(4). However, the molecular mechanisms by which the
type I IFN pathway is activated in patients with SLE
remains largely unknown.
Scientists have only recently discovered that microRNA (miRNA), tiny fragments of single-stranded
RNA, regulate gene expression via messenger RNA
(mRNA) degradation and translational repression (13).
It is estimated that miRNA target ⬃30% of the human
transcriptome (14). A growing body of evidence indicates that miRNA have the ability to alter cellular
pathways and events, such as development and differentiation. The role of miRNA in immunity is also beginning to be explored. A recent study that identified
miR-146 as a key player in innate immunity was among
the first to demonstrate the importance of miRNA in
immune regulation (15). The role of miRNA in adaptive
immunity has also been described, since miR-181a was
found to modulate T cell sensitivity and selection (16).
Investigations of the role of miRNA in immune-related
diseases conducted by several groups of scientists have
found altered expression of miRNA in rheumatoid
arthritis (17–19).
In this study, we examined the involvement of
miRNA in SLE in humans. Using pilot expression
profiling, we identified the underexpression of miR-146a
in patients with SLE and further demonstrated an
association between miR-146a levels and overactivation
of the type I IFN pathway. We characterized the role of
miR-146a as a negative regulator of the type I IFN
pathway and explored the potential molecular mechanisms. The findings presented here reveal the relevance
of miRNA genes in the biologic and clinical behavior of
an autoimmune disease.
PATIENTS AND METHODS
Study subjects. We recruited 52 patients with SLE, 6
patients with Behçet’s disease, and 29 normal control subjects
for the present study, after obtaining their informed consent.
Participants with concurrent infection were excluded from the
study. Patients with Behçet’s disease met the International
study group criteria for the disease (20). All SLE patients
Table 1. Clinical features of the 52 patients with SLE, by disease
activity group*
Characteristic
Sex, no. male/female
Age, mean ⫾ SD years
Disease duration, mean ⫾ SD
months
SLEDAI, mean ⫾ SD score
Anti-dsDNA, no. positive/negative†
Lupus nephritis, no. positive/negative
Proteinuria, no. positive/negative†
Medications
Steroids, no. taking‡
ⱕ10 mg/day
10–40 mg/day
⬎40 mg/day
Secondary agents, no. taking/not
taking§
Inactive SLE
(n ⫽ 19)
Active SLE
(n ⫽ 33)
2/17
35 ⫾ 14
70.11 ⫾ 57.73
2/31
32 ⫾ 13
76.61 ⫾ 76.74
2⫾2
2/7
7/12
0/17
11 ⫾ 5
14/11
19/14
18/14
11
6
2
10/9
3
12
18
22/11
* Patients with systemic lupus erythematosus (SLE) were classified as
having active disease if the Systemic Lupus Erythematosus Disease
Activity Index (SLEDAI) score was ⬎4 and inactive disease if the
SLEDAI score was ⱕ4. Anti-dsDNA ⫽ anti–double-stranded DNA.
† Not all patients were evaluated.
‡ Prednisone or equivalent dosage of another steroid. Dosages of
other steroids were converted to prednisone equivalents (e.g., 40 mg of
methylprednisolone was considered to be equivalent to 50 mg of
prednisone).
§ Some patients were receiving secondary antirheumatic agents, including chloroquine, cyclophosphamide, methotrexate, and azathioprine.
fulfilled the American College of Rheumatology (ACR) classification criteria for SLE (21), and 26 of these patients met the
ACR criteria for lupus nephritis (22). The Systemic Lupus
Erythematosus Disease Activity Index (SLEDAI) score (23)
was determined for each patient at the time of the blood draw.
Patients were categorized as having active disease (scores ⬎4)
or inactive disease (scores ⱕ4) based on the SLEDAI results.
Renal SLEDAI scores were determined as described elsewhere (24). Additional clinical information on the SLE patients is given in Table 1. The study was approved by the
Research Ethics Board of Renji Hospital.
Sample handling and RNA processing. Peripheral
blood samples obtained from each study subject were collected
into tubes containing acid citrate dextrose Formula A. Erythrocytes were immediately lysed, and total RNA was extracted
from the leukocytes using TRIzol (Invitrogen, San Diego, CA).
Approximately 1 ␮g of RNA was reverse transcribed into
complementary DNA (cDNA) using Superscript II reverse
transcriptase (Invitrogen) and oligo(dT) primers. The quantity
of miRNA was determined by reverse transcription of 20 ng of
RNA from each sample using a TaqMan Human MicroRNA
Assays kit (Applied Biosystems, Foster City, CA). For the pilot
expression profiling study, equal amounts of RNA from 8
healthy donors was mixed and divided into 2 control pools,
each containing samples from 4 donors.
Real-time polymerase chain reaction (PCR) analysis.
For the pilot study, expression of the 156 miRNA included in
the TaqMan MicroRNA Assays Human Panel–Early Access
ABNORMAL ACTIVATION OF THE TYPE I IFN PATHWAY BY miR-146a IN SLE
kit (Applied Biosystems) was examined according to the
manufacturer’s protocol. In subsequent studies, the TaqMan
kit specified for quantification of miR-146a was used, and the
expression level of each sample was normalized to that of
RNU66, a reference small nuclear RNA. To determine the
quantity of mRNA, the cDNA was amplified by real-time PCR
with SYBR Green (SYBR Premix Ex Taq RT-PCR kit;
Takara, Shiga, Japan), and the expression of RPL13A was
determined as the internal control. TaqMan and SYBR Green
assays were performed in duplicate or in triplicate on a
7900HT real-time instrument (Applied Biosystems). Relative
expression levels were calculated using the 2–⌬⌬Ct method.
Primers used were as follows: for lymphocyte antigen 6 complex, locus E (Ly-6E), 5⬘-CTTACGGTCCAACATCAGAC
(forward) and 5⬘-GCACACATCCCTACTGACAC (reverse);
for 2⬘,5⬘-oligoadenylate synthetase 1, 40/46 kd (OAS-1), 5⬘-GA
AGGCAGCTCACGAAAC (forward) and 5⬘-TTCTTAAAGC
ATGGGTAATTC (reverse); for myxovirus resistance 1 (MX1), 5⬘-GGGTAGCCACTGGACTGA (forward) and 5⬘-AGG
TGGAGCGATTCTGAG (reverse); for IFN-induced protein
with tetratricopeptide repeats 3 (IFIT-3), 5⬘-AACTACGCCTGGGTCTACTATCACTT (forward) and 5⬘-GCCCTTTCATTTCTTCCACAC (reverse); for IFN␣, 5⬘-TCCATGAGATGATCCAGCAG (forward) and 5⬘-ATTTCTGCTCTGACAACCTCCC (reverse); for IFN␤, 5⬘-TCTAGCACTGGCTGGAATGAG (forward) and 5⬘-GTTTCGGAGGTAACCTGTAAG (reverse); and for ribosomal protein L13A
(RPL13A), 5⬘-CCTGGAGGAGAAGAGGAAAGAGA (forward) and 5⬘-TTGAGGACCTCTGTGTATTTGTCAA (reverse).
Calculation of IFN scores. Three representative genes
(Ly-6E, OAS-1, and MX-1) were chosen to calculate IFN
scores (8,10,12). First, the mean level of Ly-6E expression in
the normal controls was subtracted from the level of Ly-6E
expression in each lupus patient, and then the remainder was
divided by the SD value for Ly-6E in normal controls to obtain
the standardized expression level of the gene. The standardized expression levels of OAS-1 and MX-1 were calculated in
the same manner. These 3 values were then summed to obtain
the IFN score for each patient. The mean IFN score in SLE
patients was 65.3 (range –0.45 to 412.60), and the mean IFN
score in normal controls was 0 (range –1.88 to 6.55).
Preparation of constructs. Overexpression of miR146a was accomplished by amplifying a genomic fragment of
⬃280 bp, corresponding to the miR-146a precursor, and
inserting this fragment into the pSUPER.basic vector (OligoEngine, Seattle, WA), using the primer pair 5⬘GTGAGATCTGCATTGGATTTACC (forward) and 5⬘GACCTCGAGACTCTGCCTTCTGT (reverse). To create 3⬘untranslated region (3⬘-UTR) luciferase reporter constructs,
fragments of 3⬘-UTR from the IFN regulatory factor 5 (IRF-5)
or STAT-1 gene harboring the predicted miR-146a binding
sites were cloned downstream of the firefly luciferase cassette
in pMIR-REPORT vector (Ambion, Austin, TX). Primers
used were as follows: for IRF-5 5⬘-GTCGAGCTCTCTTGTGTATATTC (forward) and 5⬘-GAGAAGCTTGGAGTGTGCAGAGAT (reverse); and for STAT-1 5⬘-GTGGAGCTCTTTACTGTTTGTTATGG (forward) and 5⬘-ACGAAGCTTAATAGACTAAATACCAC (reverse). All constructs were sequenced, and expression vectors were prepared
with the use of an EndoFree Plasmid Maxi kit (Qiagen,
1067
Chatsworth, CA). Following transfection, overexpression of
miR-146a was confirmed by quantitative PCR.
Cell culture, transfection, and stimulation. For these
studies, 293T and SMMC-7721 cells were grown in Dulbecco’s
modified Eagle’s medium (DMEM) supplemented with 10%
fetal bovine serum (FBS), and 293T/ISRE cells (i.e., 293T cells
stably transfected with an IFN-stimulated response element
[ISRE] reporter gene) were maintained in DMEM supplemented with 10% FBS and 200 ␮g/ml of hygromycin B. These
3 cell lines were transfected using Lipofectamine 2000 (Invitrogen). Peripheral blood mononuclear cells (PBMCs) were
isolated using a density gradient separation medium (Cedarlane, Burlington, NC) and were rested in RPMI 1640 supplemented with 10% FBS for 2 hours.
For analysis of the induction of miR-146a, PBMCs
from 5 healthy donors were incubated for 6 hours with each of
the following stimuli separately: type I IFN (1,000 units/ml;
PBL InterferonSource, Piscataway, NJ), ultrapure lipopolysaccharide (LPS) (10 ␮g/ml, from Escherichia coli strain K12;
InvivoGen, San Diego, CA), imiquimod R837 (5 ␮g/ml; InvivoGen), and type A CpG-containing oligonucleotide (ODN)
2216 (5 ␮M; InvivoGen). For transfection of PBMCs, 3 ⫻ 106
cells were electroporated with 1.5 ␮g of an empty or miR-146a
expression vector using a Nucleofector device (Amaxa, Cologne, Germany). Alternatively, PBMCs were transfected with
3 ␮g of miRIDIAN (i.e., an hsa-miR-146a inhibitor) or with 3
␮g of scrambled oligonucleotides (all from Dharmacon, Lafayette, CO). In experiments using PBMCs from healthy donors,
the medium was changed 24 hours after transfection, and cells
were incubated in fresh medium alone or in the presence of type
I IFN (1,000 units/ml) for 6 hours or in the presence of imiquimod
R837 (5 ␮g/ml) for 2 hours.
Reporter gene assay. SMMC-7721 cells were seeded in
the wells of a 96-well plate and then transfected with a mixture
of 20 ng of 3⬘-UTR luciferase reporter vector and 10 ng of
pRL-TK vector, along with 270 ng of either an empty vector or
the miR-146a expression plasmid. After 24 hours, cells were
lysed, and luciferase activity was measured with a luminometer
(TR717; Applied Biosystems) by using a Dual-Luciferase
Reporter Assay system (Promega, Madison, WI). The ratio of
firefly luciferase to Renilla luciferase was obtained for each
well.
In addition, 293T/ISRE cells were similarly seeded and
transfected with 300 ng of expression plasmids. After 18 hours,
cells were stimulated with type I IFN (1,000 units/ml) for 6
hours. The cells were then lysed, and the firefly luciferase
activity was measured.
Western blotting. In a 6-well plate, 293T cells were
seeded and transfected with 3 ␮g of miR-146a expression
vector per well. Twenty-four hours after transfection, cells
were lysed, and proteins were extracted. Supernatants were
then subjected to sodium dodecyl sulfate–polyacrylamide gel
electrophoresis, blotted with the indicated antibodies, and
detected with Luminol/Enhancer Solution (Pierce, Rockford,
IL). IRF-5 and GAPDH antibodies were obtained from Abcam (Cambridge, UK) and Chemicon (Temecula, CA), respectively. STAT-1 and horseradish peroxidase–conjugated secondary antibodies were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Relative expression levels
were quantified using Quantity One software, version 4.52
(Bio-Rad, Richmond, CA).
1068
TANG ET AL
Figure 1. Underexpression of microRNA-146a (miR-146a) in patients with systemic lupus erythematosus (SLE) as
compared with patients with Behçet’s disease (BD) and normal control (NC) subjects, and its correlation with SLE
disease activity. A, Expression of miR-146a in 47 patients with SLE, 6 patients with Behçet’s disease, and 21 normal
controls. Values are the mean and SEM. B, Expression of miR-146a in 29 patients with active SLE, 18 patients with
inactive SLE, and 21 normal controls. Horizontal bars show the mean. C, Association of miR-146a expression with the
concurrent presence of proteinuria in SLE. Horizontal bars show the mean. D, Correlation between miR-146a levels and
activation of the type I interferon (IFN) pathway. IFN scores were calculated by integrating the expression of 3
representative IFN-inducible genes (see Patients and Methods for details) to reflect the coordinate activation of the type
I IFN pathway.
Statistical analysis. Data were analyzed using Prism 4
software, version 4.03 (GraphPad Software, San Diego, CA).
The nonparametric Mann-Whitney U test was used to draw
comparisons between groups, with the exception that an
unpaired t-test was used to compare reporter gene activity.
Spearman’s test was used for correlation studies. P values
(2-tailed) less than 0.05 were considered statistically significant.
RESULTS
Decreased expression of miR-146a in patients
with SLE and correlation between miR-146a levels and
disease activity. In an initial effort to identify differentially expressed miRNA in lupus patients, we profiled
the expression of 156 miRNA by using a TaqMan
microRNA Assay Human Panel–Early Access kit from
Applied Biosystems. This method, which involves stemloop reverse transcription followed by TaqMan real-time
PCR analysis, amplifies only mature miRNA and can
discriminate among similar miRNA that differ by as few
as 1 nucleotide. The high sensitivity and specificity of
this method have been well established (25–27). RNA
samples were obtained from 5 patients and 2 control
pools, each of which was a composite of RNAs from 4
healthy donors.
The study revealed differential expression of 42
miRNA in patients with SLE as compared with normal
controls. Seven miRNA (miR-31, miR-95, miR-99a,
miR-130b, miR-10a, miR-134, and miR-146a) were
more than 6-fold lower in patients versus controls (data
not shown). Among these miRNA, miR-146a in particular has been reported to negatively regulate the innate
immune response by targeting interleukin-1 receptor–
associated kinase 1 (IRAK1) and tumor necrosis factor
receptor–associated factor 6 (TRAF6) (15). Because
defects in the negative regulation system can cause
unabated immune activation, even autoimmune diseases
ABNORMAL ACTIVATION OF THE TYPE I IFN PATHWAY BY miR-146a IN SLE
1069
Figure 2. Effects of microRNA-146a (miR-146a) on the activation of the type I interferon (IFN) pathway. A,
Overexpression of miR-146a represses the production of type I IFNs. Peripheral blood mononuclear cells (PBMCs) from
3 normal donors were electroporated with an expression plasmid for miR-146a, followed by stimulation with imiquimod
R837 for 2 hours. Shown are the relative mRNA levels of IFN␣ and IFN␤. The IFN␣ primers were designed to recognize
most IFN␣ subtypes. Values are the mean and SEM. B, Silencing of miR-146a augments the production of type I IFNs.
PBMCs from two donors (#1 and #2) were transfected with an inhibitor against miR-146a or scrambled oligonucleotides,
followed by stimulation with imiquimod R837 for 2 hours. Shown are the relative mRNA levels of IFN␣ and IFN␤. C,
MicroRNA-146a inhibits the activation downstream of type I IFN in vitro. To examine this, 293T/ISRE cells (i.e., 293T
cells stably transfected with an IFN-stimulated response element [ISRE] reporter gene) were transfected to express
miR-146a, followed by incubation with type I IFN for 6 hours. The activity of the ISRE luciferase reporter gene was then
measured. Values are the mean and SEM. D, MicroRNA-146a inhibits the activation downstream of type I IFN in primary
immune cells. PBMCs from 3 donors were transfected to express miR-146a, followed by incubation with type I IFN for
6 hours. The mRNA levels of 3 IFN-inducible genes (lymphocyte antigen 6 complex, locus E [LY6E], 2⬘,5⬘-oligoadenylate
synthetase 1, 40/46 kd [OAS1], and myxovirus resistance 1 [MX1]) were quantified. Values are the mean and SEM.
(28–30), we further explored the role of miR-146a in
SLE.
We used the TaqMan PCR method described
above to subsequently examine miR-146a expression in a
larger group of samples: 47 patients with SLE, 6 patients
with Behçet’s disease, and 21 normal controls. As shown
in Figure 1A, the expression of miR-146a was significantly lower in lupus patients compared with normal
controls (P ⬍ 0.0001), while the level of expression in
patients with Behçet’s disease appeared normal.
Since our patients were receiving various medications, we conducted the following analysis to evaluate
the influence of drugs on the expression of miR-146a.
We selected 29 patients with active SLE who were
receiving a relatively high dose of steroids. Higher doses
of steroids were not associated with altered expression of
miR-146a (P ⫽ 0.1422) (data not shown). Moreover,
when all 47 SLE patients were divided into 2 groups
according to whether they were receiving a secondary
antirheumatic agent apart from steroids, no difference
was detected (P ⫽ 0.7149) (data not shown). Taken
together, the results suggested that drugs do not affect
the expression of miR-146a and confirm that this
miRNA is intrinsically underexpressed in lupus patients.
We next performed an analysis to determine
whether there was any correlation between miR-146a
levels and clinical features. As shown in Figure 1B, the
expression of miR-146a was lower in patients with
1070
TANG ET AL
Figure 3. Identification of interferon regulatory factor 5 (IRF-5) and STAT-1 as targets of microRNA-146a
(miR-146a). A, Schematic presentation of the potential miR-146a binding sites in the 3⬘-untranslated regions (3⬘-UTRs)
of IRF-5 and STAT-1. B, Relative activity of the luciferase reporter gene fused to the fragment of 3⬘-UTRs of IRF-5
or STAT-1. Shown is a comparison between cotransfection in SMMC-7721 cells with an empty control vector and with
a miR-146a expression plasmid. Values are the mean and SEM of quadruplicate assays, each of which was performed
3 times. ⴱⴱ ⫽ P ⬍ 0.01. C, Effect of miR-146a on IRF-5 (left) and STAT-1 (right) in 293T cells. MicroRNA-146a was
overexpressed in the cells, and cell lysates were used for Western blotting. The ratios of IRF-5 to GAPDH and of
STAT-1 to GAPDH ratio in vector-transfected cells were arbitrarily set at 1.
inactive SLE, and even lower in those with active SLE,
compared with the expression in normal controls. SLE
patients with concurrent proteinuria had much lower
levels of miR-146a expression than did those without
proteinuria (Figure 1C). Moreover, a direct inverse
correlation was observed between the miR-146a levels
and the SLEDAI scores (r ⫽ –0.2882, P ⫽ 0.0247) (data
not shown), as well as between the miR-146a levels and
the renal SLEDAI scores (r ⫽ –0.3815, P ⫽ 0.0081)
(data not shown). Thus, we concluded that miR-146a
expression levels correlate negatively with SLE disease
activity.
It has been established that type I IFN plays a key
etiologic role in SLE and that it can be induced by
various stimuli. Since miR-146a deficiencies might reflect defects in negative regulation of the immune response, we explored whether sustained underexpression
of miR-146a affected, or was associated with, activation
of the type I IFN pathway in lupus patients. We examined mRNA expression of 3 representative IFNinducible genes and calculated IFN scores accordingly
(8,10,12) to determine the coordinate activation of the
type I IFN pathway in our cohorts. The associations
were then analyzed. It is interesting, although not surprising, that a negative correlation was found between
miR-146a levels and IFN scores (r ⫽ –0.3073, P ⫽
0.0378) (Figure 1D).
Negative regulation of the type I IFN pathway by
miR-146a. To explore the association between miR-146a
levels and activation of the type I IFN pathway, we first
sought to determine whether miR-146a could intrinsically modulate the onset and activation of the pathway.
The effects of miR-146a on type I IFN production were
initially explored in primary immune cells. Normal PBMCs were electroporated with a miR-146a expression
vector; 24 hours later, cells were stimulated with imiquimod R837, the TLR-7 ligand, to induce production of
IFNs. As shown in Figure 2A, overexpression of miR146a greatly reduced the induction of IFN␣ and IFN␤.
Furthermore, silencing the endogenous miR-146a via
transfection with inhibitory oligonucleotides increased
IFN production (Figure 2B). Thus, the results suggested
that miR-146a negatively regulates the production of
type I IFN.
ABNORMAL ACTIVATION OF THE TYPE I IFN PATHWAY BY miR-146a IN SLE
A common response to type I IFN is the activation of STAT proteins. Activated STAT-1 and STAT-2,
together with IRF-9, form the IFN-stimulated transcription factor 3 (ISGF-3) transcriptional complex to initiate
transcription of IFN-inducible genes whose promoters
harbor ISREs (31). Thus, we evaluated the direct effects
of miR-146a on downstream transactivation of type I
IFN by performing ISRE reporter gene assays. Transient
miR-146a expression in 293T/ISRE cells substantially
inhibited ISRE reporter gene activity after stimulation
with type I IFN (Figure 2C), indicating that miR-146a
directly regulates the activation downstream of IFN
receptors.
We further clarified the regulatory role of miR146a by monitoring its effect on the expression of
IFN-inducible genes. Normal PBMCs were similarly
transfected and stimulated with type I IFN. Overexpression of miR-146a consistently reduced the expression of
the selected IFN-inducible genes (Figure 2D). Taken
together, the results indicate that miR-146a could also
effectively regulate the coordinate activation downstream of type I IFN.
To further investigate the involvement of miR146a in the type I IFN pathway, we used PBMCs from
healthy donors to determine whether triggers of the type
I IFN pathway could induce the expression of miR-146a.
We found that mature miR-146a can be induced by
imiquimod R837 (TLR-7 ligand), type A CpG (TLR-9
ligand), and type I IFN, in addition to LPS (TLR-4
ligand) (see discussion of Figure 5A below).
Regulation of the type I IFN pathway by miR146a by targeting multiple key components. Our findings thus far have revealed that miR-146a is a negative
regulator of the type I IFN pathway. To gain insight into
the molecular mechanism of this regulator, we used
bioinformatics tools to identify its potential targets.
Previous computational analyses have revealed that
miRNA predominantly target positive regulatory motifs,
highly connected scaffolds, and downstream network
components to facilitate robust transitions of cellular
responses to extracellular signals and maintain cellular
homeostasis (32). Hence, we compiled a list of all key
components related to IFN signaling and searched each
of these proteins for potential miR-146 binding sites.
Using algorithms from miRBase (available at
http://microrna.sanger.ac.uk/targets/v5/) and TargetScan
(available at http://www.targetscan.org/), we discovered
that miR-146a base-pairs with sequences in the 3⬘-UTR
of IRF-5 and STAT-1 (Figure 3A), in addition to the 2
1071
Figure 4. Potential alleviation of the overactivation of the type I
interferon (IFN) pathway by microRNA-146a (miR-146a) in patients
with systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells from 5 patients with SLE who had high IFN scores were
transfected with a miR-146a expression plasmid for 24 hours, and then
mRNA levels of the selected IFN-inducible genes (IFN-induced
protein with tetratricopeptide repeats 3 [IFIT3], myxovirus resistance
1 [MX1], and 2⬘,5⬘-oligoadenylate synthetase 1, 40/46 kd [OAS1]) were
quantified. Values are the mean and SEM percentage reduction of the
expression levels by transfection with miR-146a as compared with
transfection with an empty vector (designated as 100%).
established miR-146 targets, IRAK1 and TRAF6 (15).
All of the proteins were key components in the signaling
cascade of the type I IFN pathway and were essential
either for the production of type I IFN (33–36) or for the
transactivation downstream of IFN (31). More intriguingly, a haplotype that elevates the expression of multiple isoforms of IRF-5 has been shown to confer lupus
susceptibility across multiple ethnic backgrounds (37),
and basal expression and activation of STAT-1 is known
to be elevated in lupus patients and murine models
(38–40). We thus performed a biologic validation to
confirm our new predictions.
The 3⬘-UTR fragments of IRF-5 and STAT-1
were cloned downstream of the luciferase reporter gene.
The constructs were then transiently transfected into
SMMC-7721 cells, together with either an empty control
vector or an expression plasmid for miR-146a. As expected, overexpression of miR-146a effectively attenuated luciferase activity (Figure 3B), while 3 irrelevant
miRNA (miR-98, miR-202, and miR-224) had no effect
on those reporter constructs (data not shown), implying
the inhibitory effect of miR-146a via the predicted
binding sites. We then introduced miR-146a into 293T
cells and analyzed the expression of IRF-5 and STAT-1
by Western blotting. Overexpression of miR-146a consistently reduced the expression of IRF-5 and STAT-1 at
the protein level (Figure 3C). Thus, miR-146a appears
to regulate the immune activation by targeting key
signaling proteins in the type I IFN pathway.
1072
TANG ET AL
Potential alleviation of overactivation of the type
I IFN pathway by miR-146a in patients with SLE. The
results described thus far demonstrate that miR-146a
regulates the type I IFN pathway by targeting critical
proteins in the signaling cascade. Thus, we performed an
exploratory examination of whether manipulation of
miR-146a levels could alleviate overactivation of the
type I IFN pathway in lupus patients. PBMCs were
obtained from 5 patients who had high IFN scores (i.e.,
⬎2 SD above the mean IFN score in normal controls)
and were electroporated for expression of miR-146a. As
expected, miR-146a notably reduced the expression of
selected IFN-inducible genes (Figure 4). This indicates
that manipulation of miR-146a levels could potentially
provide a therapeutic benefit to lupus patients.
DISCUSSION
Ever since the discovery of miRNA, tremendous
effort has been devoted to determining their biologic
functions and their relevance to diseases. Dysregulation
of miRNA has been associated with certain human
diseases, such as leukemia and heart disease (15,41). By
elucidating the presence of an miRNA signature and its
contribution to alterations of the type I IFN pathway in
patients with SLE, the present study now extends the
role of miRNA in the pathogenesis of autoimmune
diseases. The strong association between the miR-146a
level and clinical disease activity indicates that it may
serve as a new disease biomarker. Dai et al (42) recently
identified several differentially expressed miRNA in
lupus patients by microarray analysis; however, dysregulation of miR-146a was not reported. This is likely due to
the difference between the quantification methods and
patient cohorts used in their study as compared with
ours.
There is now considerable evidence of the contribution of TLRs to autoimmunity through their role in
the recognition of endogenous ligands (43,44). Immune
complexes of autoantibodies to RNA binding nucleoproteins and self DNA from lupus patients are known to
induce IFN␣ in plasmacytoid dendritic cells through
TLR-7 or TLR-9 (45–47). These responses require
sequential activation of signaling adaptors and transcription factors, including myeloid differentiation factor 88,
IRAK1, TRAF6, IRF-5, and IRF-7 (33–35). Recently
reported data underscore the critical role of IRF-5 in the
induction of type I IFN (36). Once induced, type I IFN
binds to its receptors to initiate downstream signaling by
activation of STAT proteins, which ultimately leads to
the transcription of target genes (“IFN-inducible
genes”) (31).
Physiologically, cells of the immune system spontaneously use various mechanisms to negatively regulate
TLR signaling so as to avoid abnormal activation and to
maintain the immunologic balance. Such mechanisms
involve intracellular negative regulators, which are
present constitutively or are up-regulated by TLR signaling in a feedback loop (28). Defects in negative
regulators could lead to overactivation of positive signaling and result in diseases (28). This notion is supported by genetic studies in patients with asthma, in
whom inactive lesions in the IRAK-M gene are found
(29), and in mice deficient in suppressor of cytokine
signaling protein 1, in which systemic autoimmune phenotypes occur (30).
Recent studies also add miRNA to the list of
negative regulators of innate immunity. It has been
reported that miR-146 regulates TLR-4 signaling
through a feedback loop in THP-1 cells (15). We used
PBMCs from healthy donors and found that mature
miR-146a can also be induced upon TLR-7, TLR-9, and
type I IFN ligation in addition to LPS (Figure 5A). This
indicates that miR-146a is indeed involved in the much
more complex regulatory network of innate immunity.
In the present study, we showed that miR-146a
negatively regulates type I IFN induction by TLR-7
signaling and directly represses activation downstream
of type I IFN. During the preparation of our manuscript,
a group studying Epstein-Barr virus determined via
array analysis that miR-146a modulates the expression
of plenty of IFN-inducible genes (48). These findings
further support our data.
To explore the molecular mechanisms of the
regulation by miR-146a, we used bioinformatics tools to
search for its potential targets among the key components involved in signaling upstream and downstream of
IFN. This led to the identification of 2 novel targets of
miR-146a (i.e., IRF-5 and STAT-1), in addition to the 2
previously established miR-146 targets (i.e., IRAK1 and
TRAF6). All of these proteins are important mediators
of IFN signaling, and are critical for the induction of
type I IFN or for transactivation downstream of type I
IFN. Thus, miR-146a is licensed to target multiple
components in the signaling cascade of the type I IFN
pathway (Figure 5B).
Given the essential characteristics of these proteins, the negative regulation by miR-146a on the activation of the pathway could be very effective, which is an
overall result of the integration of its function at multiple targets with quantitatively graded modulation, al-
ABNORMAL ACTIVATION OF THE TYPE I IFN PATHWAY BY miR-146a IN SLE
1073
Figure 5. Induction of microRNA-146a (miR-146a) to target multiple key components in the interferon (IFN) signaling
pathway in a feedback loop. A, Induction of miR-146a in peripheral blood mononuclear cells (PBMCs) by various
stimuli. Shown is the fold change in expression of miR-146a in PBMCs from 5 healthy donors after 6 hours of incubation
with lipopolysaccharide (LPS), imiquimod R837, type A CpG, and type I IFN. Values are the mean and SEM. B,
Overview of the negative regulation of the type I IFN pathway by miR-146a. Activation of Toll-like receptors (TLRs)
(e.g., TLRs 7–9) triggers sequential signaling and leads to the production of type I IFNs, which in turn, bind to their
receptors and induce downstream activation. In this scenario, various negative regulators, including miR-146a, are
simultaneously induced. The mature miR-146a uses inhibitory machinery to reduce expression of its target genes,
including interleukin-1 receptor–associated kinase 1 (IRAK1), tumor necrosis factor receptor–associated factor 6
(TRAF6), IFN regulatory factor 5 (IRF-5), and STAT-1, thereby attenuating the positive signaling. MyD88 ⫽ myeloid
differentiation factor 88; IFNAR1 ⫽ interferon-␣/␤/␻ receptor 1.
though the effect on a single target might be modest or
subtle. This is similar to the role of miR-181a in T cells:
by bringing about modest reductions in multiple phosphatases, miR-181a can single-handedly tune the excitation threshold of a T cell, whereas the robust repression
of individual targets via siRNA is insufficient to achieve
this regulation (16). Deficiency of miR-146a could thus
be substantially deleterious; it would lead to accumulation of its target proteins, albeit with varied concentrations. This, in turn, could result in sustained overproduction of type I IFNs and downstream activation.
Therefore, it appears that miR-146a deficiency is one of
the causal factors in the abnormal activation of the type
I IFN pathway in SLE. The correlation we observed
between miR-146a levels and activation of the type I
IFN pathway in lupus patients echoes this idea and
implicates defective miRNA regulation in the pathogenesis of autoimmune conditions. On the other hand, some
patients with decreased miR-146a expression do not
have overactivation of the type I IFN pathway (Figure
1D). This difference may reflect the heterogeneous
nature of lupus, and it indicates that miR-146a may have
other etiologic roles.
Previous studies have shown that miR-146 expression is up-regulated in Th1 cells and down-regulated
in Th2 cells relative to its expression in naive T cells, thus
suggesting that miR-146 might be involved in cell fate
determination (49). It is known that T cells from lupus
patients display numerous signaling abnormalities that
contribute to the pathogenesis of SLE (50). Therefore, it
would be interesting to determine the function of miR146 in T cells and explore whether miR-146a deficiencies
contribute to the skewed expression of cytokines in SLE,
thereby expanding the role of miR-146a to alterations in
adaptive immunity.
To explore possible reasons for the underexpression of miR-146a in lupus patients, we performed a
bioinformatic analysis and identified a potential CpG
island in the promoter of miR-146a. This island corresponded exactly to the position of a fragment harboring
the putative STAT-1 binding site and one of the validated NF-␬B binding sites (15,48) (data not shown).
Previous studies have shown the epigenetic regulation of
several miRNA by IL-6 in malignant human cholangiocytes (51). Interestingly, a number of studies have shown
an increase in serum IL-6 levels in SLE patients (for
review, see ref. 1). It would be interesting to explore
whether DNA methylation changes caused by IL-6 account for the lowered expression of miR-146a in lupus
patients.
1074
TANG ET AL
The type I IFN pathway has emerged as a
significant contributor to the pathogenesis of SLE. Thus,
antagonists for TLRs or IFNs appear to be promising
strategies for the treatment of this disease. However,
these strategies should be applied with considerable
caution because of the potential for life-threatening
immune deficiencies (52). Since miRNA provide quantitative regulation of genes, rather than on/off signals,
they can be thought of as molecules that fine-tune a
cell’s responses to external influences (53). Consequently, manipulation of miRNA levels could lead to
novel therapeutic strategies to combat SLE. Interestingly, when miR-146a was introduced in PBMCs from
the SLE patients, the coordinate activation of the type I
IFN pathway was notably reduced, as revealed by downregulation of several IFN-inducible genes. These results
suggest that miR-146a levels could be manipulated to
provide useful therapeutic interventions for SLE. Studies in knockout and transgenic animal models would
further identify the role of miR-146a in autoimmune
diseases.
In conclusion, our results demonstrate that underexpression of miR-146a in lupus patients is relevant
to the biologic and clinical behavior of SLE. Our findings suggest that miRNA could serve as therapeutic
targets for the treatment of SLE via regulation of the
type I IFN pathway.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
AUTHOR CONTRIBUTIONS
Dr. Shen had full access to all of the data in the study and
takes responsibility for the integrity of the data and the accuracy of the
data analysis.
Study design. Tang, Chen, Shen.
Acquisition of data. Luo, Cui, Ni, Yuan, Guo, Huang, Zhou.
Analysis and interpretation of data. Tang, Luo, Cui, de Vries, Tak,
Shen.
Manuscript preparation. Tang, Luo, de Vries, Tak, Shen.
Statistical analysis. Tang, Luo, Cui, Ni.
REFERENCES
1. Fairhurst AM, Wandstrat AE, Wakeland EK. Systemic lupus
erythematosus: multiple immunological phenotypes in a complex
genetic disease. Adv Immunol 2006;92:1–69.
2. Ronnblom L, Eloranta ML, Alm GV. The type I interferon system
in systemic lupus erythematosus [review]. Arthritis Rheum 2006;
54:408–20.
3. Pascual V, Farkas L, Banchereau J. Systemic lupus erythematosus:
all roads lead to type I interferons. Curr Opin Immunol 2006;18:
676–82.
4. Crow MK. Type I interferon in systemic lupus erythematosus. Curr
Top Microbiol Immunol 2007;316:359–86.
5. Hooks JJ, Moutsopoulos HM, Geis SA, Stahl NI, Decker JL,
Notkins AL. Immune interferon in the circulation of patients with
autoimmune disease. N Engl J Med 1979;301:5–8.
6. Bengtsson AA, Sturfelt G, Truedsson L, Blomberg J, Alm G,
18.
19.
20.
21.
22.
23.
24.
25.
Vallin H, et al. Activation of type I interferon system in systemic
lupus erythematosus correlates with disease activity but not with
antiretroviral antibodies. Lupus 2000;9:664–71.
Dall’Era MC, Cardarelli PM, Preston BT, Witte A, Davis JC Jr.
Type I interferon correlates with serological and clinical manifestations of SLE. Ann Rheum Dis 2005;64:1692–7.
Baechler EC, Batliwalla FM, Karypis G, Gaffney PM, Ortmann
WA, Espe KJ, et al. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc
Natl Acad Sci U S A 2003;100:2610–5.
Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau
J, et al. Interferon and granulopoiesis signatures in systemic lupus
erythematosus blood. J Exp Med 2003;197:711–23.
Kirou KA, Lee C, George S, Louca K, Papagiannis IG, Peterson
MG, et al. Coordinate overexpression of interferon-␣–induced
genes in systemic lupus erythematosus. Arthritis Rheum 2004;50:
3958–67.
Han GM, Chen SL, Shen N, Ye S, Bao CD, Gu YY. Analysis of
gene expression profiles in human systemic lupus erythematosus
using oligonucleotide microarray. Genes Immun 2003;4:177–86.
Feng X, Wu H, Grossman JM, Hanvivadhanakul P, FitzGerald JD,
Park GS, et al. Association of increased interferon-inducible gene
expression with disease activity and lupus nephritis in patients with
systemic lupus erythematosus. Arthritis Rheum 2006;54:2951–62.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and
function. Cell 2004;116:281–97.
Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes
are microRNA targets. Cell 2005;120:15–20.
Taganov KD, Boldin MP, Chang KJ, Baltimore D. NF-␬Bdependent induction of microRNA miR-146, an inhibitor targeted
to signaling proteins of innate immune responses. Proc Natl Acad
Sci U S A 2006;103:12481–6.
Li QJ, Chau J, Ebert PJ, Sylvester G, Min H, Liu G, et al.
miR-181a is an intrinsic modulator of T cell sensitivity and
selection. Cell 2007;129:147–61.
Stanczyk J, Pedrioli DM, Brentano F, Sanchez-Pernaute O,
Kolling C, Gay RE, et al. Altered expression of microRNA in
synovial fibroblasts and synovial tissue in rheumatoid arthritis.
Arthritis Rheum 2008;58:1001–9.
Nakasa T, Miyaki S, Okubo A, Hashimoto M, Nishida K, Ochi M,
et al. Expression of microRNA-146 in rheumatoid arthritis synovial tissue. Arthritis Rheum 2008;58:1284–92.
Pauley KM, Satoh M, Chan AL, Bubb MR, Reeves WH, Chan EK.
Upregulated miR-146a expression in peripheral blood mononuclear cells from rheumatoid arthritis patients. Arthritis Res
Ther 2008;10:R101.
International Study Group for Behçet’s Disease. Evaluation of
diagnostic (‘classification’) criteria in Behçet’s disease—towards
internationally agreed criteria. Br J Rheumatol 1992;31:299–308.
Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield
NF, et al. The 1982 revised criteria for the classification of systemic
lupus erythematosus. Arthritis Rheum 1982;25:1271–7.
Renal Disease Subcommittee of the American College of Rheumatology Ad Hoc Committee on Systemic Lupus Erythematosus
Response Criteria. The American College of Rheumatology response criteria for proliferative and membranous renal disease in
systemic lupus erythematosus clinical trials. Arthritis Rheum
2006;54:421–32.
Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang DH,
and the Committee on Prognosis Studies in SLE. Derivation of the
SLEDAI: a disease activity index for lupus patients. Arthritis
Rheum 1992;35:630–40.
Pitashny M, Schwartz N, Qing X, Hojaili B, Aranow C, Mackay M,
et al. Urinary lipocalin-2 is associated with renal disease activity in
human lupus nephritis. Arthritis Rheum 2007;56:1894–903.
Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT,
ABNORMAL ACTIVATION OF THE TYPE I IFN PATHWAY BY miR-146a IN SLE
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
et al. Real-time quantification of microRNAs by stem-loop RTPCR. Nucleic Acids Res 2005;33:e179.
Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, et al.
Characterization of microRNA expression levels and their biological correlates in human cancer cell lines. Cancer Res 2007;67:
2456–68.
Tang F, Hajkova P, Barton SC, O’Carroll D, Lee C, Lao K, et al.
220-plex microRNA expression profile of a single cell. Nat Protoc
2006;1:1154–9.
Liew FY, Xu D, Brint EK, O’Neill LA. Negative regulation of
Toll-like receptor-mediated immune responses. Nat Rev Immunol
2005;5:446–58.
Balaci L, Spada MC, Olla N, Sole G, Loddo L, Anedda F, et al.
IRAK-M is involved in the pathogenesis of early-onset persistent
asthma. Am J Hum Genet 2007;80:1103–14.
Fujimoto M, Tsutsui H, Xinshou O, Tokumoto M, Watanabe D,
Shima Y, et al. Inadequate induction of suppressor of cytokine
signaling-1 causes systemic autoimmune diseases. Int Immunol
2004;16:303–14.
Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signaling [review]. Nat Rev Immunol 2005;5:375–86.
Cui Q, Yu Z, Purisima EO, Wang E. Principles of microRNA
regulation of a human cellular signaling network. Mol Syst Biol
2006;2:46.
Uematsu S, Sato S, Yamamoto M, Hirotani T, Kato H, Takeshita
F, et al. Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated
interferon-␣ induction. J Exp Med 2005;201:915–23.
Kawai T, Sato S, Ishii KJ, Coban C, Hemmi H, Yamamoto M, et
al. Interferon-␣ induction through Toll-like receptors involves a
direct interaction of IRF7 with MyD88 and TRAF6. Nat Immunol
2004;5:1061–8.
Schoenemeyer A, Barnes BJ, Mancl ME, Latz E, Goutagny N,
Pitha PM, et al. The interferon regulatory factor, IRF5, is a central
mediator of Toll-like receptor 7 signaling. J Biol Chem 2005;280:
17005–12.
Yasuda K, Richez C, Maciaszek JW, Agrawal N, Akira S, Marshak-Rothstein A, et al. Murine dendritic cell type I IFN production induced by human IgG-RNA immune complexes is IFN
regulatory factor IRF5 and IRF7 dependent and is required for
IL-6 production. J Immunol 2007;178:6876–85.
Graham RR, Kozyrev SV, Baechler EC, Reddy MV, Plenge RM,
Bauer JW, et al. A common haplotype of interferon regulatory
factor 5 (IRF5) regulates splicing and expression and is associated
with increased risk of systemic lupus erythematosus. Nat Genet
2006;38:550–5.
Martinez-Lostao L, Ordi-Ros J, Balada E, Segarra-Medrano A,
Majo-Masferrer J, Labrador-Horrillo M, et al. Activation of the
signal transducer and activator of transcription-1 in diffuse proliferative lupus nephritis. Lupus 2007;16:483–8.
1075
39. Kuroiwa T, Schlimgen R, Illei GG, Boumpas DT. Monocyte
response to Th1 stimulation and effector function toward human
mesangial cells are not impaired in patients with lupus nephritis.
Clin Immunol 2003;106:65–72.
40. Dong J, Wang QX, Zhou CY, Ma XF, Zhang YC. Activation of
the STAT1 signalling pathway in lupus nephritis in MRL/lpr mice.
Lupus 2007;16:101–9.
41. Van Rooij E, Olson EN. MicroRNAs: powerful new regulators of
heart disease and provocative therapeutic targets. J Clin Invest
2007;117:2369–76.
42. Dai Y, Huang YS, Tang M, Lv TY, Hu CX, Tan YH, et al.
Microarray analysis of microRNA expression in peripheral blood
cells of systemic lupus erythematosus patients. Lupus 2007;16:
939–46.
43. Marshak-Rothstein A. Toll-like receptors in systemic autoimmune
disease. Nat Rev Immunol 2006;6:823–35.
44. Kanzler H, Barrat FJ, Hessel EM, Coffman RL. Therapeutic
targeting of innate immunity with Toll-like receptor agonists and
antagonists. Nat Med 2007;13:552–9.
45. Vollmer J, Tluk S, Schmitz C, Hamm S, Jurk M, Forsbach A, et al.
Immune stimulation mediated by autoantigen binding sites within
small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp
Med 2005;202:1575–85.
46. Means TK, Latz E, Hayashi F, Murali MR, Golenbock DT, Luster
AD. Human lupus autoantibody-DNA complexes activate DCs
through cooperation of CD32 and TLR9. J Clin Invest 2005;115:
407–17.
47. Barrat FJ, Meeker T, Gregorio J, Chan JH, Uematsu S, Akira S,
et al. Nucleic acids of mammalian origin can act as endogenous
ligands for Toll-like receptors and may promote systemic lupus
erythematosus. J Exp Med 2005;202:1131–9.
48. Cameron JE, Yin Q, Fewell C, Lacey M, McBride J, Wang X, et
al. The Epstein-Barr virus latent membrane protein 1 (LMP1)
induces cellular microRNA-146a, a modulator of lymphocyte
signaling pathways. J Virol 2008;82:1946–58.
49. Monticelli S, Ansel KM, Xiao C, Socci ND, Krichevsky AM, Thai
TH, et al. MicroRNA profiling of the murine hematopoietic
system. Genome Biol 2005;6:R71.
50. Tenbrock K, Juang YT, Kyttaris VC, Tsokos GC. Altered signal
transduction in SLE T cells. Rheumatology (Oxford) 2007;46:
1525–30.
51. Meng F, Wehbe-Janek H, Henson R, Smith H, Patel T. Epigenetic
regulation of microRNA-370 by interleukin-6 in malignant human
cholangiocytes. Oncogene 2008;27:378–86.
52. Baccala R, Hoebe K, Kono DH, Beutler B, Theofilopoulos AN.
TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 2007;13:
543–51.
53. Taganov KD, Boldin MP, Baltimore D. MicroRNAs and immunity: tiny players in a big field. Immunity 2007;26:133–7.
Документ
Категория
Без категории
Просмотров
0
Размер файла
294 Кб
Теги
abnormal, activation, typed, 146a, human, micrornas, contributes, lupus, key, protein, signaling, pathways, targeting, interferon
1/--страниц
Пожаловаться на содержимое документа