close

Вход

Забыли?

вход по аккаунту

?

Molecular profiling of proteolytic and lectin transcripts in Homalodisca vitripennis HemipteraAuchenorrhynchaCicadellidae feeding on sunflower and cowpea.

код для вставкиСкачать
76
Coudron et al.
Archives of Insect Biochemistry and Physiology 66:76–88 (2007)
Molecular Profiling of Proteolytic and Lectin
Transcripts in Homalodisca vitripennis (Hemiptera:
Auchenorrhyncha: Cicadellidae) Feeding on Sunflower
and Cowpea
Thomas A. Coudron,1* Sandra L. Brandt,1 and Wayne B. Hunter2
Homalodisca vitripennis Germar 1821 (Hemiptera: Cicadellidae) [Takiya et al. (2006) Ann Entomol Soc Am 99:648–655; syn. H.
coagulata (Say)] salivary gland and gut EST libraries were used to isolate cDNA fragments of the gene transcripts encoding for
cathepsin L, asparaginyl endopeptidase, cathepsin B, metalloendopeptidase, cathepsin D, multicatalytic endopeptidase, and a
sugar-binding C-type lectin. Transcript levels were evaluated in immature and adult H. vitripennis feeding on sunflower (Helianthus
annuus) or cowpea (Vigna unguiculata). Northern blot hybridization results showed that expression of most of the transcripts were
similar for all developmental stages and feeding on the two diets examined. However, the expression of the transcript for asparaginyl endopeptidase was less expressed in sunflower-fed adult females compared to sunflower-fed immatures. Also, the expression of
the C-type lectin transcript was up-regulated in adults compared to immatures when fed on either diet. Documenting both the
presence and variation of transcript expression involved in putative digestive proteolysis in this xylem-feeding leafhopper is noteworthy and aids efforts to design specific diet formulations for mass production of hosts and parasitoids to be used as effective
biological control measures. Arch. Insect Biochem. Physiol. 66:76–88, 2007. Published 2007 Wiley-Liss, Inc.†
KEYWORDS: digestion; glassy-winged sharpshooter; Homalodisca coagulata; Northern hybridization; Pierce’s disease;
transcriptome; xylem feeder
INTRODUCTION
The glassy-winged sharpshooter (GWSS), Homalodisca vitripennis Germar 1821 (Hemiptera:
Cicadellidae) (Takiya et al., 2006), is highly polyphagous, indigenous to the southern United States and
to northern Mexico (Triapitsyn and Phillips, 2000;
Redak et al., 2004) and is most frequently referred
to as a xylem-fluid feeder. As such, this pest is cred-
ited with transmitting the bacterium Xylella fastidiosa,
a causal agent of several economically important diseases including Pierce’s disease of grapevines, citrus
variegated chlorosis, and phony peach disease (Qin
et al., 2001; Hopkins and Purcell, 2002). Undulating and seasonal populations and difficulties in rearing this insect have limited biological studies and,
subsequently, the development of effective pest management strategies.
1
Biological Control of Insects Research Laboratory, USDA-Agriculture Research Service, Columbia, Missouri
2
Subtropical Insects Research Unit, USDA-Agriculture Research Service, Fort Pierce, Florida
Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation
or endorsement by the U.S. Department of Agriculture.
Contract grant sponsor: Pierce’s Disease Program, California Department of Food and Agriculture.
Sandra L. Brandt’s present address is Department of Biochemistry, University of Missouri, Columbia, MO 65211.
*Correspondence to: Thomas A. Coudron, Biological Control of Insects Research Laboratory, USDA-Agriculture Research Service, 1503 S. Providence Rd, Columbia,
MO 65203. E-mail: coudront@missouri.edu
Received 22 November 2006; Accepted 6 March 2007
Published 2007 Wiley-Liss, Inc.
†
This article is a US Government work and, as such, is in the public domain in the United States of America.
DOI: 10.1002/arch.20200
Published online in Wiley InterScience (www.interscience.wiley.com)
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Molecular Profiling of Proteases in GWSS
GWSS have a wide host range containing many
plants that serve as effective reservoirs for X.
fastidiosa, necessitating control strategies in urban
and natural areas adjacent to cropping systems at
risk of the disease (Phillips, 2000). Chemical control of GWSS on such a wide scale is neither an
economically feasible nor an environmentally sustainable strategy. Therefore, the development of effective biological control agents for GWSS is an
important part of an integrated pest management
program (Hoddle, 2004). The mymarid wasps,
Gonatocerus spp., are the most common egg parasitoids of GWSS in the southeastern United States
and appear to be a feasible control strategy for providing long-term, area-wide suppression of this pest
(Pilkington et al., 2005). An increased comprehension of GWSS digestive physiology may lead to a
more thorough understanding of the nutritional
requirements, the host range, and possibly more
effective rearing methods needed for the mass production of leafhopper hosts and parasitoids.
Amino acids and soluble proteins are the primary nitrogen nutrients in xylem fluid where organic constituents include 19 amino acids, 7
organic acids, and 3 or 4 sugars (Andersen et al.,
1992, 2003). The dietary nitrogen impacts survival,
growth, and reproduction of phytophagous insects
(Bi et al., 2005). Consequently, the nutritionally
dilute chemistry of the xylem fluid is a probable
cause of the extremely high rate of feeding by
GWSS (Brodbeck et al., 2004). Equally important
is that GWSS are able to assimilate at least 99%
of the amino acids, organic acids, and sugars
(Andersen et al., 1989; Brodbeck et al., 1993,
1996). Asparagine and glutamine or proline are
the predominant amino acids detected in xylem
fluid in most woody host plant species investigated
(Andersen et al., 1992; Redak et al., 2004; Bi et
al., 2005). Adult GWSS prefer and perform best
on host plants with high amide content in the xylem fluid (Andersen et al., 1992), while immatures
require lower levels of amides and a more balanced
amino acid profile (Brodbeck et al., 1995, 1999).
Substantial amounts of soluble proteins exist
in xylem fluid of GWSS host plants. For example,
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
77
total protein concentration in grape xylem extracts
varies from 0.468 to 0.854% (Jain and Basha,
2003). However, soluble protein levels were higher
in the xylem of orange trees during the times when
GWSS adults were sexually active, while the levels
of certain amino acids corresponded better to shifts
in GWSS numbers (Bi et al., 2005). Also of interest is that several plants, including sunflower, show
an increase in the concentration of xylem proteins
in response to stress (Zhu and Zhang, 1997).
The extent to which GWSS utilize host plant
proteins is not understood. However, the ability
to utilize xylem proteins as a nutrient source would
depend on the presence and activity of the appropriate proteases within the digestive tract. Therefore, the current study was undertaken to test the
hypothesis that suitable proteolytic enzymes exist
within the digestive tract and consequently that
finding could influence current tenets and advance
our understanding of the underlying mechanisms
of GWSS digestive physiology. The use of expression libraries is a timely approach to understanding the genetic basis of proteolytic activity as it
relates to insect development (Hunter et al., 2003;
Huang et al., 2006; Sabater-Munoz et al., 2006)
and feeding and digestion (Colebatch et al., 2002;
Abubakar et al., 2006). The focus of this study was
to compare transcript levels of several proteases in
immature and adult GWSS feeding on sunflower
or cowpea plants.
MATERIALS AND METHODS
GWSS Rearing
GWSS adults were originally obtained from a
laboratory colony in Westlaco, Texas. Insects were
maintained in a quarantine facility on cowpea
(Vigna unguiculata) or sunflower (Helianthus annuus)
(Chen et al., 2006) under high intensity lights and
the following conditions: 28 ± 2°C, >70% relative
humidity and 12 h light/12 h dark cycles. Specific
developmental stages were selected based on head
capsule width with the following assignment: 3rd
instar 1.01–1.50 mm and 5th instar 1.98–2.20 mm
(Sétamou and Jones, 2005).
78
Coudron et al.
Library Construction
Insects for library construction were collected
off several citrus trees in Kern County, California.
Dissected salivary glands and midguts from 50
adult GWSS were used in the construction of an
expression library (Hunter B, Katsar CS, Dang PM,
unpublished results). Tissues were ground in liquid nitrogen and total RNA was extracted using the
guanidinium salt-phenol-chloroform procedure as
previously described by Strommer et al. (1993).
Poly (A) RNA was purified using Micromole (A)
Pure™ according to the manufacturer’s instructions
(Ambion, Austin, TX). A directional cDNA library
was constructed in Lambda Uni-ZAP® XR vector
using Stratagene’s ZAP-cDNA Synthesis Kit (Stratagene, La Jolla, CA). The resulting DNA was packaged into Lambda particles using Gigapack® III
Gold Packaging Extract (Stratagene). An amplified
library was generated with a titer of 1.0 × 109
plaque-forming units per mL. Mass excision of the
amplified library was carried out using Ex-Assist®
helper phage (Stratagene). An aliquot of the excised, amplified library was used for infecting XL1Blue MRF’ cells and subsequently plated on LB agar
containing 100 µg/ml ampicillin. Bacterial clones
containing excised pBluescript SK(+) phagemids
were recovered by random colony selection.
Sequencing of Clones
pBluescript SK (+) phagemids were grown overnight at 37°C and 240 rpm in 96-well culture plates
containing 1.7 ml of LB broth, supplemented with
100 µg/ml ampicillin. Archived stocks were prepared from the cell cultures using 75 µl of a LBamp-glycerol mixture and 75 µl of cells. These
archived stocks are held at the United States Horticultural Research Lab (USHRL, Fort Pierce, FL)
in an ultra low temperature freezer set at –80°C.
Plasmid DNA was extracted using the Qiagen 9600
liquid handling robot and the QIAprep 96 Turbo
miniprep kit according to the recommended protocol (Qiagen Inc., Valencia, CA). Sequencing reactions were performed using the ABI PRISM®
BigDye™ Primer Cycle Sequencing Kit (Applied
Biosystems, Foster City, CA) along with a universal T3 primer. Reactions were prepared in 96-well
format using the Biomek2000™ liquid handling
robot (Beckman Coulter Inc., Fullerton, CA). Sequencing reaction products were precipitated with
70% isopropanol, resuspended in 15 µl sterile water and loaded onto an ABI 37300 DNA Analyzer
(Applied Biosystems).
Sequence Verification and Cloning
Base confidence scores were designated using
TraceTuner® (Paracel, Pasadena, CA). Low-quality
bases (confidence score <20) were trimmed from
both ends of sequences. Quality trimming, vector
trimming, and sequence fragment alignments were
executed using Sequencher® software (Gene Codes,
Ann Arbor, MI). Sequences less than 100 nucleotides in length, after both vector and quality trimming were completed, were excluded from the
analysis. Additional ESTs that corresponded to vector sequences were removed from the dataset. The
potential identity of the gene was determined based
on BLAST homology searches using the National
Center for Biotechnology Information (NCBI)
BLAST server (http://www.ncbi.nlm. nih.gov) with
the sequence comparisons made to protein databases (BLASTX, BLASTP). To estimate the number
of genes represented in the library and the redundancy of specific genes, ESTs were assembled into
“contigs” using Sequencher®. Contig assembly parameters were set using a minimum overlap of 50
bases and 95% identity match. Vector and lowquality sequence were trimmed and the sequences
filtered for a minimum length (200 bp), producing 4,853 high-quality ESTs. These ESTs were analyzed with the Sequencher® assembly program to
identify those representing redundant transcripts.
RNA Preparation for Northern Blots
Total RNA was extracted from 100 mg of pooled
GWSS nymphs (20–25 third instars, 3–5 fifth instars, or 2–4 adults) for each sample. Whole insect
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Molecular Profiling of Proteases in GWSS
79
frozen samples were pulverized with a RNase-free
pestle in a 1.5-ml RNase-free microcentrifuge tube,
processed with 1.0 ml of TRIzol® reagent (Invitrogen Corporation, Carlsbad, CA) using a microhomogenizer, and held at room temperature for
10 min. Tubes were then centrifuged for 10 min at
12,000g at 4°C and the supernatant transferred to
a new 1.5-ml RNase-free microcentrifuge tube. The
RNA was purified following the manufacturer’s protocol. The isolated RNA pellet from each tube was
stored under absolute ethyl alcohol at –70°C and
then dissolved in 50 µl RNase-free water for Northern blot analysis.
95°C for 2 min, followed by 30 cycles of 95°C for
30 s, 55°C for 30 s, and 72°C for 45 s, followed by
72°C for 7 min. The amplified product was cloned
into pCR2.1 vector using the TOPO TA Cloning®
kit (Invitrogen), and the ligated product was transformed into DH5α Escherichia coli competent cells.
Probes were labeled via PCR using the PCR DIG
Probe Synthesis Kit™ (Roche Applied Science, Indianapolis, IN). Gene-specific primers (Table 1)
and approximately 10–100 pg of each clone were
used for each labeling reaction.
Cloning of cDNA Fragments and Probe Labeling
Five micrograms of total RNA per sample was
separated on a 1.2% agarose glyoxal-based denaturing gel (NorthernMax™-Gly, Applied Biosystems).
The RNA was then transferred onto a positively
charged nylon membrane (Nytran SuPerCharge,
Whatman, Sanford, ME) using downward capillary
action in 20× SSC transfer buffer (3 M NaCl, 0.3 M
NaC6H5O7·2H2O, pH 7.0) for 3–4 h. After completion of the transfer, membranes were cross-linked
at 12,000 µJ/cm2. Prehybridization and hybridization at 42°C overnight were carried out in DIG Easy
Hyb® hybridization buffer (Roche). The digoxigenin-
Gene-specific primers were designed using
PrimerQuest software (Integrated DNA Technologies, Coralville, IA) and EST sequences generated
from GWSS salivary gland (resulting in 3 probes)
or GWSS gut (resulting in one housekeeping and
5 proteinase probes, Table 1). RNA was extracted
from whole insects and DNase treated (DNAfree,
Ambion, Austin, TX). cDNA was synthesized and
then used with gene-specific primers (Table 1) for
RT-PCR reactions under the following conditions:
Northern Blotting
TABLE 1. Gene-Specific Primer Sequences*
GWSS EST
Primer sequences (5′–3′)
Housekeeping
F: GACGAAGAAGTTGCTGCGTTGGTT
R: TCCCAGTTGGTCACAATACCGTGT
Mg1
F: TGTCCGAGGAAGATCTTGCCCAAT
R: TGGCAAGCTCGATGTCTTCTGAGT
Mg2
F: ATATGGATGCTTGTCACTCGGGCT
R: TGTCACGTGATCGAAACCCAGACT
Mg3
Expected size (bp)
BLASTX homology and accession no.
E value
236
β-Actin AAU84923
0.0
294
Cathepsin-L cysteine peptidase XP 970644
08E–109
311
Asparaginyl endopeptidase CAB71158
09E–27
F: TTACCCTGACTTGGCTTGGCCTTA
R: TGAATGGACTGGACATCAGGTGGT
237
Cathepsin B XP 966663
07E–63
Mg4
F: TTGGCGAGGCCACAGAAATAGACT
R: ACCTTGACAGGAGCGAAGACGAAA
275
Cathepsin-D aspartic protease XP 966517
06E–62
Mg5
F: AGGCCAACTCCTGTGTGACTTTCA
R: GTGAACGCATCAGCGGCATAATGT
370
Metalloendo peptidase EAT36357
5E–30
Sg1
F: AGTGTTGCCATCGATGCGAGTCAT
R: GCTTGCACAAGAAGCTATGCCACA
240
Cathepsin-L cysteine peptidase EAT45919
02E–40
Sg2
F: ATTTCACCAGCGTTCACAACGTCC
R: ACTTTGACCTGCGGTTGTACAGGA
320
Multicatalytic endopeptidase complex B XP 394993
3E–30
Sg3
F: TCAGGATAACGCCACTTGCCAGAT
R: ACCCATTGTCCCTGAGGAAAGTCA
345
Sugar-binding, C-type lectin EAT36282
5E–21
*F = forward; R = reverse.
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
80
Coudron et al.
labeled probes were detected using DIG High Prime
DNA Labeling and Detection Start Kit II® (Roche)
followed by 15–300-min exposure to autoradiography film (Classic BX, Molecular Technologies, St.
Louis, MO). Films were imaged using a multi-imaging system equipped with a cooled CCD camera
(VersaDoc 4000 Imaging System, BioRad, Hercules,
CA). Densitometric analysis of the bands was performed using QuantityOne™ software (BioRad). The
blots were stripped with two 15-min incubations at
37°C in a stripping buffer (0.2 M NaOH, 0.1% SDS).
After stripping, the blots were rinsed twice for 5 min
in 2× SSC and reprobed with β-actin in order to
assure equal loading of RNA. Blots were probed no
more than three times before being discarded. Transcript size was estimated by comparison to DIG-labeled RNA markers (Roche).
Statistical Analysis
Transcript levels of genes encoding for the seven
proteinases and the C-type lectin were evaluated
in immature and adult GWSS that had been reared
on sunflower or cowpea plants. Three biological
replicates were analyzed for each sample. The densitometric intensity for each transcript was divided
by the intensity of the housekeeping transcript (βactin) for each corresponding sample. This value
was then normalized to the value for cowpea-fed
3rd instar for each Northern blot. Average normalized intensity values were compared using the
Student’s t-test (SAS Institute, 1990).
RESULTS
Identification of ESTs
Transcripts which were ≥100 nucleotides subsequent to quality and vector trimming averaged 821
bases in length. Because multiple ESTs can be derived from a single gene, sequences were assembled
into contiguous sequences (contigs) to estimate the
number of genes giving rise to the ESTs. Contig
alignment resulted in a dataset of 965 unique assembled sequences, including contigs and singlets.
Of that total, 189 of the contigs and 379 of the sin-
glets corresponded with a putative match in GenBank,
while 397 of the cDNAs had “No Significant Homology” to any sequence currently listed in GenBank.
“No Significant Homology” denoted either “no
match” to GenBank’s database when similarity
searches were performed using both BLASTX and
BLASTN or an E value of > –5. About 40% of the
cDNAs sequenced are potentially newly discovered
or as yet undescribed insect genes, some of which
may be specific to the leafhoppers. ESTs, identified
as encoding enzymes, were sorted into enzyme class
and subclass by putative function based on homology to proteins that had been previously characterized in the NCBI database (Table 2, NCBI BLAST
server http://www.ncbi.nlm. nih.gov using BLASTX,
TBLASTX, TBLASTN). Enzyme classification of transcripts based on BLAST homology searches resulted
in the majority of sequences being identified as belonging to the Hydrolases (50%), then Oxidoreductases (21%) and Transferases (18%). Transcripts with
identity matches to digestive enzymes in other insects were selected and used to design the primers
and molecular probes used in these studies.
Northern Blot Analyses
Northern blot analyses demonstrated transcripts
of the following approximate sizes: 1,517 bp for
β-actin, 1,049 bp for Calcium-dependent (C-type)
lectin, 1,049 bp for multicatalytic endopeptidase,
1,560 bp for salivary gland cathepsin L, 1,250 bp
for gut cathepsin L, 1,600 bp for asparaginyl endopeptidase, 1,250 bp for cathepsin B, 1,517 bp
for cathepsin D, and 1,049 bp for metalloendopeptidase. With two exceptions, the expression levels of the transcripts did not vary significantly
among developmental stages or diet treatments
(Fig. 1). C-type lectin transcript expression was one
exception. Expression of C-type lectin transcription
was significantly greater (P < 0.05) in adult females
and males compared to 3rd or 5th instar larvae
feeding on cowpea. However, only in the sunflower
treatment was the lectin expression significantly
greater for adult males compared to the immatures.
The other exception was the expression of asparaginyl endopeptidase transcript, which was 1.6-fold
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Molecular Profiling of Proteases in GWSS
81
TABLE 2. Enzymatic Classification of Homalodisca vitripennis Midgut Sequences*
EC no.
Class
Subclass
1
1.1
1.11
1.13
1.14
1.15
1.2
1.3
1.4
1.5
1.6
1.8
1.9
2
2.1
2.2
2.3
2.4
2.5
2.6
2.7
3.1
3.2
3.4
3.5
3.6
4.1
4.2
5.2
5.3
5.99
6.1
6.2
6.3
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Oxidoreductase
Transferase
Transferase
Transferase
Transferase
Transferase
Transferase
Transferase
Transferase
Hydrolases
Hydrolases
Hydrolases
Hydrolases
Hydrolases
Lyases
Lyases
Isomerases
Isomerases
Isomerases
Ligases
Ligases
Ligases
Oxidoreductase
Acting on the CH-OH group of donors
Acting on a peroxide as acceptor
Acting on single donors with incorporation of molecular oxygen (oxygenases)
Acting on paired donors, with incorporation or reduction of molecular oxygen
Acting on superoxide radicals as acceptor
Acting on the aldehyde or oxo group of donors
Acting on the CH-CH group of donors
Acting on the CH-NH2 group of donors
Acting on the CH-NH group of donors
Acting on NADH or NADPH
Acting on a sulfur group of donors
Acting on a heme group of donors
Transferase
Transferring one-carbon groups
Transferring aldehyde or ketonic groups
Acyltransferases
Glycosyltransferases
Transferring alkyl or aryl groups, other than methyl groups
Transferring nitrogenous groups
Transferring phosphorus-containing groups
Acting on ester bonds
Glycosylases
Acting on peptide bonds (peptidases)
Acting on carbon-nitrogen bonds, other than peptide bonds
Acting on acid anhydrides
Carbon-carbon lyases
Carbon-oxygen lyases
cis-trans-Isomerases
Intramolecular isomerases
Other isomerases
Forming carbon—oxygen bonds
Forming carbon—sulfur bonds
Forming carbon—nitrogen bonds
Total
No. of sequences
2
28
8
2
32
2
2
2
4
4
41
2
20
2
2
2
2
4
14
2
102
24
24
86
8
228
4
16
4
2
1
22
2
28
732
*Classification is hierarchial. All functional assignments of Homalodisca vitripennis (syn. H. coagulata) sequences described here are the “inferred from electronic
evidence” (IEE) using the top 5 BLASTX hits with an E-value of ≤ –5 generated from NCBI’s nr database. The definition term associated with each sequence was defined
according to The International Union of Biochemistry and Molecular Biology’s Enzyme classification system.
(P = 0.022) and 1.8-fold (P = 0.028) greater in
sunflower-fed 3rd and 5th instars, respectively, than
was found in sunflower-fed adult females.
DISCUSSION
Within the order Hemiptera. it is widely recognized that many plant-feeding species in the
suborder Heteroptera have high levels of proteases associated with the salivary gland and/or
midgut to aid in the digestion of proteins (Colebatch et al., 2001; Zhu et al., 2003). In contrast,
plant-feeding species in the suborder Auchenorrhyncha, especially xylem-feeders like GWSS, have
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
long been assumed to lack digestive proteases because the protein content of xylem under normal
circumstances is extremely low (Terra et al., 1996).
Yet, plants under environmental stress, especially
drought stress (Zhu and Zhang, 1997) and possibly heavy insect infestation, can have a significant
level of protein in the xylem. Additionally, adult
GWSS have been reported to occasionally feed on
phloem of transitional host plants (Katsar et al.,
2007). The use of the GWSS expression datasets
provided a means for profiling the presence of transcripts for cysteine and aspartic proteinases as well
as other endopeptidases and, thus, for providing
support for our hypothesis that GWSS express gene
Coudron et al.
Fig. 1. (continues on following pages)
82
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
83
Fig. 1. (continues on overleaf)
Molecular Profiling of Proteases in GWSS
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
Fig. 1. Northern blots of GWSS RNA from 3rd instar, 5th instar, adult female (AF), and adult male (AM) feeding on cowpea (cp) or sunflower (sf) and
densitometric comparison of the average normalized intensity values from 3 replicates. Each lane was loaded with 5 µg total RNA. β-actin was used as an
internal loading reference and is shown below each respective blot. Probes are indicated in the left margin. Significance levels in the average blot
intensities were determined by Student’s t-test.
84
Coudron et al.
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Molecular Profiling of Proteases in GWSS
transcripts encoding proteolytic polypeptides that
play a role in GWSS feeding and overall nitrogen
nutrition, especially when feeding on stressed,
heavily infested, or transitional plants. Furthermore, demonstrating that GWSS express genes that
are involved in proteolytic degradation supports
the testing of artificial diets that contain protein.
Recent developments in the area of nutrigenomics
have demonstrated how nutrition alters global gene
expression patterns (Coudron et al., 2006). It is
plausible that one or more of the proteolytic enzymes expressed by GWSS can be used as a biomarker for, and an early indicator of, the insect’s
response to different nutritional quality.
Digestive proteolytic enzymes, as described in
different orders of economically important insect
pests, belong predominantly to one of the major
classes of proteinases. Coleopteran and hemipteran
species tend to utilize cysteine proteinases while
lepidopteran, hymenopteran, orthopteran, and
dipteran species mainly use serine proteinases
(Lawrence and Koundal, 2002). Cathepsin D-like
aspartic proteinases were identified along with cysteine proteinases in species representing six families in the order Hemiptera (Houseman and
Downe, 1983). The low pH of midguts in many
coleopteran and hemipteran species provides a
more favorable environment for aspartic and cysteine proteinases than the high pH found in other
insect guts (Lawrence and Koundal, 2002). Thus,
if any digestive proteinase activity were to be
present in GWSS, it might be expected to be of the
cysteine or aspartic classes. Also, plant xylem fluid
is slightly acidic (Andersen et al., 1992). Specifically, cowpea and sunflower xylem pH in our experiments were estimated as between 5.0 and 6.0
using pH indicator strips (data not shown), which
would be optimal for cysteine proteinases.
Digestive proteolysis has been reported for other
sap-feeding insects. Putative digestive cysteine proteinases have been characterized for the phloemfeeding insects Aphis gossypii and Nilaparvata lugens
(Deraison et al., 2004; Foissac et al., 2002). Foissac
et al. (2002) theorized that digestive proteolysis
may be widespread in sap-sucking hemipterans and
makes a significant contribution to nutrition.
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
85
The occurrence of a sugar-binding C-type lectin with higher expression levels in GWSS adults
than in immatures is intriguing. C-type lectins are
a group of calcium-dependent carbohydrate-binding extracellular proteins. The majority of the Ctype lectins characterized from insects are involved
in immune responses, although involvement in cellular adhesion and developmental regulation has
also been reported (Zelensky and Gready, 2005).
A C-type lectin expressed in mouthparts of the flesh
fly Sarcophaga peregrina is thought to play a novel
biological role in the food intake of this insect
(Yamamoto-Kihara and Kotani, 2004). Considered
important in detection and neutralization of pathogenic materials, C-type lectins expressed in the salivary gland of the mosquito Aedes aegypti are
postulated to have a role in controlling bacterial
growth in ingested meals (Valenzuela et al., 2002).
Determination of the role of C-type lectin in GWSS
feeding, digestive physiology or immunity, possibly relating to X. fastidiosa interactions, merits further study.
A comparison of preliminary results of caseinolytic activity in homogenates of the salivary gland
and midgut of GWSS included as part of this study
with that of Lygus Hesperus Knight (Hemiptera:
Miridae), the tarnished plant bug (Wright et al.,
2006), in the suborder Heteroptera, further supports the hypothesis that substantial protease activity is present within the digestive track of GWSS.
Caseinolytic activity in the salivary gland of L.
hesperus increased with an increase in pH and time,
with the highest activity observed at pH 8.5, achieving 11,000 RFU/IE in 6 h. A much slower activity
was recorded in L. hesperus over a pH range of 6.5–
8.0. That pH profile suggested the presence of a
trypsin-like serine protease and a chymotrypsin
protease, which was confirmed using protease inhibitors and peptide digestion studies. In comparison, the caseinolytic activity in the salivary gland
of GWSS detected in our study decreased with an
increase in pH but increased with time, with the
highest activity observed at pH 5.0–6.0, achieving
1,000 RFU/IE in 18 h. Caseinolytic activity in the
midgut of L. hesperus varied with pH and increased
86
Coudron et al.
with time, with the highest activity observed at pH
4.5, achieving 7,000 RFU/IE in 18 h. The pH profile suggested the presence of aspartic and cysteine
proteases, which was confirmed using protease inhibitors and peptide digestion studies. In comparison, the caseinolytic activity in the midgut of GWSS
detected in our study also decreased with an increase in pH and increased with time, with the
highest activity observed at pH 5.0–6.0, achieving
8,000 RFU/IE in 18 h. That pH profile suggests
the prominence of aspartic and cysteine protease
in the midgut as well as the salivary gland of GWSS.
Overall, the caseinolytic digestion demonstrated
that GWSS have the ability to digest protein and
showed major differences in proteolytic activity
between the salivary gland and midgut, and that
the activity was affected by pH, as was the case for
L. hesperus. For GWSS, the greatest activity was
found at a low pH in midgut tissues suggesting
the presence of aspartic and cysteine activity
whereas the greatest activity was found at a higher
pH in the salivary gland of L. hesperus, indicative
of serine and chymotrypsin activity, and at a low
pH in the midgut of L. hesperus, indicative of aspartic and cysteine activity. Further work to determine the mechanistic classes of proteolytic activity
(Wright et al., 2006) in GWSS will add clarification and confirmation of the class of protease activity suggested by our preliminary data.
Expression levels of the putative digestive enzyme transcripts in this study changed very little
over development or in response to the two plant
diets examined. Future studies plan to explore expression levels with specific dietary modifications
presented through an artificial membrane. Clearly,
the enzymatic changes observed herein are linked
to the feeding and digestive ability of GWSS to utilize specific host plant proteins. These enzymes are
critically linked to interactions that also affect
GWSS development and performance on different
hosts and/or artificial diets. As we begin to elucidate more of the variables underlying GWSS feeding and digestion, we come closer in our efforts to
produce an efficacious system for the mass production of GWSS and its parasitoids.
ACKNOWLEDGMENTS
We thank the following ARS employees: Drs.
Joe Patt and Roger Leopold for providing GWSS,
Maureen Wright, James Smith. and John Willenberg for their creative contributions to rearing the
GWSS, and Laura Hunnicutt for providing bioinformatic and technical assistance.
LITERATURE CITED
Abubakar LU, Bulimo WD, Mulaa FJ, Osir EO. 2006. Molecular characterization of a tsetse fly midgut proteolytic
lectin that mediates differentiation of African trypanosomes. Insect Biochem Mol Biol 36:344–352.
Andersen PC, Brodbeck BV, Mizell RF. 1989. Metabolism of
amino acids and organic acids and sugars extracted from
the xylem fluid of 4 host plants by Homalodisca coagulata.
Entomol Exp Appl 50:149–159.
Andersen PC, Brodbeck BV, Mizell RF. 1992. Feeding by the
leafhopper Homalodisca coagulata in relation to xylem fluid
chemistry and tension. J Insect Physiol 38:611–622.
Andersen PC, Brodbeck BV, Mizell RF. 2003. Plant and insect
characteristics in response to increasing density of Homalodisca
coagulata on three host species: a quantification of nutrient extraction. Entomol Exp Appl 107:57–68.
Bi JL, Castle SJ, Byrne FJ, Tuan SJ, Toscano NC. 2005. Influence of seasonal nitrogen nutrition fluctuations in orange
and lemon trees on population dynamics of the glassysinged sharpshooter (Homalodisca coagulata). J Chem Ecol
31:2289–2308.
Brodbeck BV, Mizell RF, Andersen PC. 1993. Physiological
and behavioral adaptations of three species of leafhoppers in response to the dilute nutrient content of xylem
fluid. J Insect Physiol 39:73–81.
Brodbeck BV, Andersen PC, Mizell RF. 1995. Differential utilization of nutrients during development by the xylophagous leafhopper, Homalodisca coagulata. Entomol Exp Appl
75:279–289.
Brodbeck BV, Andersen PC, Mizell RF. 1996. Utilization of
primary nutrients by the polyphagous xylophage, Homalodisca
coagulata, reared on single host species. Arch Insect
Biochem Physiol 32:65–83.
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Molecular Profiling of Proteases in GWSS
87
Brodbeck BV, Andersen PC, Mizell RF. 1999. Effect of total
dietary nitrogen and nitrogen form on the development
of xylophagous leafhoppers. Arch Insect Biochem Biophysiol 42:37–50.
Huang Z, Hunter WB, Cleland CA, Wolinsky M, Lapointe SL,
Powell CA. 2006. A new member of the growth-promoting glycoproteins from Diaprepes root weevil (Coleoptera:
Curculionidae). Florida Entomol 89:223–232.
Brodbeck BV, Andersen PC, Mizell RF, Oden S. 2004. Comparative nutrition and developmental biology of xylemfeeding leafhoppers reared on four genotypes of Glycine
max. Environ Entomol 33:165–173.
Hunter WB, Dang PM, Bausher M, Chaparro JX, McKendree
W, Shatters RG Jr, McKenzie CL, Sinisterra XH. 2003. Aphid
biology: expressed genes from alate Toxoptera citricida
(Kirkaldy), brown citrus aphid (Hemiptera: Aphididae). J
Insect Sci 3.23. [http://www.insectscience.org/3.23]
Chen W-L, Leopold RA, Morgan DJW, Harris MO. 2006. Development and Reproduction of the egg parasitoid, Gonatocerus ashmeadi Girault (Hymenoptera: Mymaridae), as a
function of temperature. Environ Entomol 35:1178–1187.
Colebatch G, East P, Cooper P. 2001. Preliminary characterization of digestive proteases of the green mirid, Creontiades
dilutus (Hemiptera: Miridae). Insect Biochem Mol Biol
31:415–423.
Colebatch G, Cooper P, East P. 2002. cDNA cloning of a salivary chymotrypsin-like protease and the identification of
six additional cDNAs encoding putative digestive proteases
from the green mired, Creontiades dilutus (Hemiptera:
Miridae). Insect Biochem Mol Biol 32:1065–1075.
Coudron TA, Yocum GD, Brandt SL. 2006. Nutrigenomics: a
case study in the measurement of insect response to nutritional quality. Entomol Exp Appl 121:1–14.
Deraison C, Darboux I, Duportets L, Gorojankina T, Rahbé
Y, Jouanin L. 2004. Cloning and characterization of a gutspecific cathepsin L from the aphid Aphis gossypii. Insect
Mol Biol 13:165–177.
Foissac X, Edwards MG, Du JP, Gatehouse AMR, Gatehouse
JA. 2002. Putative protein digestion in a sap-sucking homopteran plant pest (rice brown plant hopper; Nilaparvata
lugens: Delphacidae)-identification of trypsin-like and
cathepsin B-like proteases. Insect Biochem Mol Biol
32:967–978.
Hoddle MS. 2004. Restoring balance: using exotic species to
control invasive exotic species. Conserv Biol 18:38–49.
Hopkins DL, Purcell AH. 2002. Xylella fastidiosa: cause of
Pierce’s disease of grapevine and other emergent diseases.
Plant Disease 86:1056–1066.
Houseman JG, Downe AER. 1983. Cathepsin D-like activity
in the posterior midgut of Hemipteran insects. Comp
Biochem Physiol-B 75:409–512.
Archives of Insect Biochemistry and Physiology
October 2007 doi: 10.1002/arch.
Jain AK, Basha SM. 2003. A capillary electrophoretic method
for isolation and characterization of grape xylem proteins.
African J Biotech 2:66–70.
Katsar CS, Hunter WB, Sinisterra XH. 2007. Phytoreoviruslike sequences from glassy-winged sharpshooter salivary
glands. Fla Entomol 90:189–203.
Lawrence PK, Koundal KR. 2002. Plant protease inhibitors
in control of phytophagous insects. Electronic J Biotech
5:93–109.
Phillips PA. 2000. Protecting vineyards from Pierce’s disease
vectored by the glassy-winged sharpshooter: preliminary
observation. KAC Plant Protect Q 10:6–7.
Pilkington LJ, Irvin NA, Boyd EA, Hoddle MS, Triapitsyn SV,
Carey BG, Jones WA, Morgan DJW. 2005. Introduced parasitic wasps could control glassy-winged sharpshooter. Calif Agri 59:223–228.
Qin X, Miranda VS, Machado M, Lemos E, Hartung JS. 2001.
An evaluation of the genetic diversity of Xylella fastidiosa
isolated from diseased citrus and coffee. Phytopathology
91:599–605.
Redak RA, Purcell AH, Lopes JRS, Blua MJ, Mizell RF, Andersen
PC. 2004. The biology of xylem-fluid feeding vectors of
Xylella fastidiosa and their relation to disease epidemiology. Annu Rev Entomol 49:243–270.
Sabater-Munoz B, Legeai F, Rispe C, Bonhomme J, Dearden
P, Dossat C, Duclert A, Gauthier J, Ducray D, Hunter W,
Dang P, Kambhampati S, Matinez-Torres D, Cortes T, Moya
A, Nakabachi A, Philippe C, Prunier-Leterne N, Rahbe Y,
Simon J, Stern D, Wincker P, Tagu D. 2006. Large-scale
gene discovery in the pea aphid Acyrthosiphon pisum (Hemiptera). Genome Biol 7:R21. [http://genomebiology.
com/2006/7/3/R21]
SAS Institute. 1990. SAS/STAT User’s guide for personal computers, Version 6. Cary, NC: SAS institute.
88
Coudron et al.
Sétamou M, Jones WA. 2005. Biology and biometry of sharpshooter Homalodisca coagulata (Homoptera: Cicadellidae)
reared on cowpea. Ann Entomol Soc Am 98:322–328.
Strommer JN, Gregerson R, Vayda M. 1993. Isolation and
characterization of plant mRNA. In: Glik BR, Thompson
JE, editors. Methods in plant molecular biology and biotechnology. Boca Raton, FL: CRC Press. p 49–66.
Takiya DM, Mckamey SH, Cavichioli RR. 2006. Validity of
Homalodisca and of H. vitripennis as the name for glassywinged sharpshooter (Hemiptera: Cicadellidae: Cicadellinae).
Ann Entomol Soc Am 99:648–655.
Terra WR, Ferreira C, Baker JE. 1996. Compartmentalization
of digestion. In: Lehane MJ, Billingsley PF, editors. Biology of the insect midgut. London: Chapman and Hall. p
153–194.
Triapitsyn SV, Phillips PA. 2000. First host record of Gonatocerus
triguttatus (Hymenoptera: Mymaridae) from eggs of Homalodisca coagulata (Homoptera: Cicadellidae), with notes on
the distribution of the host. Florida Entomol 83:200–203.
Valenzuela JG, Pham VM, Garfield MK, Francischetti IMB,
Ribeiro JMC. 2002. Toward a description of the sialome
of the adult female mosquito Aedes aegypti. Insect Biochem
Mol Biol 32:1101–1122.
Wright MK, Brandt SL, Coudron TA, Wagner RM, Habibi J,
Backus EA, Huesing JE. 2006. Characterization of digestive proteolytic activity in Lygus Hesperus Knight (Hemiptera: Miridae). J Insect Physiol 52:717–728.
Yamamoto-Kihara M, Kotani E. 2004. Isolation and characterization of a C-type lectin cDNA specifically expressed
in the tip of mouthparts of the flesh fly Sarcophaga
peregrina. Insect Mol Biol 13:133–140.
Zelensky AN, Gready JE. 2005. The C-type lectin-like domain
superfamily. FEBS J 272:6179–6217.
Zhu X, Zhang J. 1997. Anti-transpiration and anti-growth activities in the xylem sap from plants under different types
of soil stress. New Phytol 137:657–664.
Zhu YC, Zeng FR, Oppert B. 2003. Molecular cloning of
trypsin-like cDNAs and comparison of proteinase activities in the salivary glands and gut of the tarnished plant
bug Lygus lineolaris (Heteroptera: Miridae). Insect Biochem
Mol Biol 33:889–899.
Archives of Insect Biochemistry and Physiology
October 2007
doi: 10.1002/arch.
Документ
Категория
Без категории
Просмотров
4
Размер файла
334 Кб
Теги
vitripennis, hemipteraauchenorrhynchacicadellidae, transcripts, sunflower, molecular, lectin, feeding, profiling, cowpea, homalodisca, proteolytic
1/--страниц
Пожаловаться на содержимое документа