close

Вход

Забыли?

вход по аккаунту

?

Sequencing and characterization of a cDNA encoding a ferritin subunit of Colorado potato beetle Leptinotarsa decemlineata.

код для вставкиСкачать
140
Qiu et al.
Archives of Insect Biochemistry and Physiology 60:140–150 (2005)
Sequencing and Characterization of a cDNA Encoding
a Ferritin Subunit of Colorado Potato Beetle,
Leptinotarsa decemlineata
Lihong Qiu, Jian-Rong Gao, and J. Marshall Clark*
A differentially expressed cDNA fragment (P311) from Colorado potato beetle (CPB), Leptinotarsa decemlineata (Say),
was identified by restriction fragment differential display–polymerase chain reaction (RFDD-PCR) technique, and showed
a strong similarity to ferritin heavy chain subunits of other organisms. Based on P311, we constructed specific primers
and obtained a 840-bp cDNA fragment spanning the open reading frame of CPB ferritin subunit using the rapid amplification of cDNA ends (RACE) technique. The sequence encodes 213 amino acid residues, including a 19 amino acid signal
peptide. The sequence has a conserved cysteine in the N-terminus and has the seven conserved residues that comprise the
ferroxidase center, which is the feature of heavy chain ferritins of vertebrates. The CPB ferritin subunit has high amino
acid sequence identity with the Apriona germari (69.3%), Galleria mellonela (54.5%), Manduca sexta (54.0%), Drosophila melanogaster (53.2%), Calpodes ethlius (51.4%), and Nilaparvata lugens (47.6%) but lower identity with the
Anopheles gambiae (38.7%) and Aedes aegypti (37.8%). Using Northern blot analysis, the subunit mRNA was identified
from fat body and midgut of 4th instars with much higher mRNA levels found in midgut than that in fat body (~2.5fold). Nevertheless, only the levels of mRNA in fat body was induced by dexamethasone (~1.5-fold). Arch. Insect Biochem.
Physiol. 60:140–150, 2005. © 2005 Wiley-Liss, Inc.
KEYWORDS: Leptinotarsa decemlineata; Colorado potato beetle; ferritin; cDNA sequence; expression;
dexamethasone induction
INTRODUCTION
Iron is an essential nutrient and a potential
toxin in all living organisms. It serves as a catalytic
center during oxidative metabolism, which in some
instances results in destructive oxidative reactions
(Nichol et al., 2002). Thus, iron regulation (uptake, transport, and storage) is essential in all living organisms. Ferritin is an iron storage protein
and plays an important role in iron metabolism.
Ferritin has been extensively studied in vertebrates
and cytosolic ferritin is the principle site of iron
storage. It contains 24 subunits, which can be divided into two subgroups: heavy (H) and light (L)
chains. The H chain plays an essential role in the
rapid oxidation and uptake of iron for storage
(Cozzi et al., 2000) and is characterized by the
presence of a ferroxidase center, while the L chain
serves in iron-core nucleation and cooperates efficiently with the H chain to complex iron with
Department of Veterinary and Animal Sciences, University of Massachusetts, Amherst
Contract grant sponsor: NIH/NIAID; Contract grant number: PHS 5R01AI45062-3.
Lihong Qiu’s present address is Department of Applied Chemistry, China Agricultural University, Beijing, 100094, P.R. China.
Jian-Rong Gao’s present address is Department of Entomology, Comstock Hall, Cornell University, Ithaca, NY 14853.
*Correspondence to: Dr. J. Marshall Clark, Dept. of Veterinary & Animal Sciences, University of Massachusetts, Amherst, MA 01003.
E-mail: jclark@vasci.umass.edu
Received 13 October 2004; Accepted 29 July 2005
© 2005 Wiley-Liss, Inc.
DOI: 10.1002/arch.20089
Published online in Wiley InterScience (www.interscience.wiley.com)
Archives of Insect Biochemistry and Physiology
Ferritin Subunit of Colorado Potato Beetle
phosphate and oxygen (Levi et al., 1996; Nichol
et al., 2002).
Currently, ferritins have been isolated from at
least seven insects (Nichol et al., 2002) and other
arthropods (Kopá…ek et al., 2003). Most insect ferritins are heteromeric with relative small but different subunits (24–32 kDa). Like their vertebrate
counterparts, insect ferritin subunits can also be divided into H and L chain subgroups. In C. ethlius,
the two major subunits are 24 and 31 kDa and are
referred to as the S and G subunits, respectively
(Nichol and Locke, 1999). Both G and S subunits
have a consensus iron responsive element (IRE) in
their 5′-untranslated region (UTR). The S subunit
contains the conserved ferroxidase residues, while
the G subunit lacks such residues. In D. melanogaster,
the 5′-UTR of one ferritin subunit also has an IRE,
and the sequence of this subunit contains a signal
peptide and resembles most closely ferritin of A.
aegypti (Charlesworth et al., 1997).
Insect ferritins, however, have some notable differences: (1) They are usually larger in molecular
mass (~660 kDa in insects vs. ~440 kDa in vertebrates); (2) Most are glycosylated and appear in
the endoplasmic reticulum of the cells (rather than
in the cytoplasm) and in the hemolymph; (3) They
are usually secreted and synthesized with a signal
peptide, which presumably directs the subunit to
secretion pathways (Locke and Nichol, 1992;
Dunkov et al., 1995; Pham et al., 2000). These special characteristics suggest that insect ferritins may
have a function different from that of vertebrate,
and might play a role in iron transport in addition to iron storage (Locke and Nichol, 1992;
Dunkov et al., 1995).
To date, no sequence information exists on
beetle ferritin subunits. Colorado potato beetle
(CPB), Leptinotarsa decemlineata (Say), is an important agricultural pest and difficult to control due
to multiple resistances to many types of insecticides (Clark et al. 1995; Argentine et al., 1989,
1995). A major resistance mechanism in CPB is
enhanced oxidative metabolism. A recent study
showed that pre-exposure to dexamethasone could
significantly increase the tolerance of an insecticide-susceptible strain of CPB to abamectin (Yoon
November 2005
141
et al., 2002). The increased tolerance was coupled
to an increased production of cytochrome P450
monooxygenase (P450) and the formation of 3″-O
desmethyl abamectin, a non-toxic metabolite. Because dexamethasone is a relatively selective inducer
for P450 genes, we utilized it in a differential display to identify other genes that may be co-induced,
particularly those that may have a role in enhanced
heme biosynthesis.
In this study, we report the cloning and sequencing of a cDNA encoding a ferritin subunit of
CPB, and establish its relationship with other insect ferritins. We also report a differential level of
mRNA in midgut versus fat body after induction
by dexamethasone.
MATERIALS AND METHODS
Insects
The insecticide-susceptible strain of CPB used
in this study was originally a gift from Dr. G.G.
Kennedy (North Carolina State University, Raleigh,
NC) and has been in a colony at the University of
Massachusetts for over 15 years. CPB were reared
as described by Argentine and Clark (1990).
Dexamethasone Treatment
and RNA Isolation
One microliter of dexamethasone (10 ng/µl acetone) (Sigma Co., St Louis, MO) or acetone only
(control) was topically applied to the dorsal abdomen of early 4th instars with a microapplicator
(Model M, ISCO, Lincoln, NB). Larvae were fed
on potato tuber slice for approximately 18 h under rearing condition. Fat body and midgut were
dissected from isolated abdomen and placed individually into RNALater (Ambion, Austin, TX). Total RNA was extracted from pooled fat body and
midgut tissues, respectively, using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer’s instructions. Poly(A)
RNA was purified from 2 mg of total RNA using
the PolyATrack mRNA Isolation System III (Promega, Madison, WI). Total RNA and poly(A) RNA
samples were stored at –80°C for subsequent use.
142
Qiu et al.
Restriction Fragment Differential
Display-PCR (RFDD-PCR)
RFDD-PCR was accomplished using the displayPROFILE™ Kit (Qbiogene, Carlsbad, CA) according to the manufacturer’s instructions. Briefly,
double-strand cDNA was synthesized from 1 µg of
total RNA isolated from fat bodies of dexamethasone- or acetone-treated larvae, respectively, and
digested with Taq1 restriction enzyme. The RFDDPCR templates were constructed by ligating the digested fragments to two different adaptors supplied
with the kit. The templates were PCR amplified
using a 0-extension primer (kinase-labeled with [(33
P] ATP) and a Probe primer (display PROBE EU1 to -32, provided with the kit) using the following
thermal cycle program: Initial denaturation at 94°C
for 1 min; for the first 10 cycles: 94°C for 30 s,
60°C for 30 s with decreasing temperature by 0.5°C
for each cycle until 55°C is reached, and 72°C for
1 min; and for the last 25 cycles: 94°C for 30 s,
55°C for 30 s, and 72°C for 1 min with a final
extension at 72°C for 5 min. The PCR products
from each reaction were separated on a 7% urea
polyacrylamide gel. The dried gel was exposed to
Kodak X-Omat AR film for 1.5 h at –80°C with an
intensifying screen. The differentially expressed
gene fragments were excised from the gel, eluted,
and reamplified using the same primers as used in
the initial PCR reaction. The PCR reamplification
program was 30 cycles at 94°C for 30 s, 55°C for
30 s, and 72°C for 1 min.
Rapid Amplification of cDNA Ends (RACE)
The 3′ and 5′ terminal cDNA fragments were
obtained by using SMART™ RACE cDNA Amplification Kit (Clontech, Palo Alto, CA). The cDNA
was synthesized from the poly(A) RNA from fat
body with Superscript reverse transcriptase (Life
Technology, Grand Island, NY) by priming with
oligo(dT). 3′RACE PCR was conducted with the
Universal Primer A Mix (UPM) supplied in the kit
and a sequence specific primer (3FerRACE1: 5′CGTCAACAGGCCCGGCTTCGCTGA) using the following thermal cycle program: for the first 5 cycles,
94°C for 30 s, 72°C for 3 min; for the next 5 cycles,
94°C for 30 s, 70°C for 30 s, 72°C for 3 min; and
for the last 20 cycles: 94°C for 30 s, 68°C for 30 s,
72°C for 3 min. A single bright band of the expected size was detected when visualized following agarose gel electrophoresis with ethidium
bromide staining. 5′RACE was conducted with the
UPM and a gene specific primer (5FerRACE3:
5′CAGCCATTCGCCTAAAGCACCGTG) using the
following thermal cycle program: initial denaturation: 94°C for 1 min; for the first 5 cycles, 94°C
for 5 s, 72°C for 2 min; for the next 5 cycles, 94°C
for 5 s, 68°C for 10 s, 72°C for 2 min; and for the
following 20 cycles, 94°C for 30 s, 65°C for 1 min,
72°C for 2 min, and a final elongation at 72°C for
10 min. A faint band of the expected size was detected following agarose gel electrophoresis with
ethidium bromide staining. The band was excised
and the gel slice melted in 20 µl of TE buffer. One
microliter of the melted gel slice was used as template for a second semi-nested PCR using the UPM
and a gene-specific primer, 5′FeRace4, 5′TCCGGCGATATCACGTTGACC with the following thermal
cycle program: initial denaturation, 94°C for 5 min;
for the next 21 cycles, 94°C for 30 s, 55°C for 30 s,
72°C for 1 min, and a final extension at 72°C for
5 min.
Sequencing of DNA Fragments
PCR-amplified DNA fragments were purified by
Gene Clean Spin Kit (Qbiogene, Carlsbad, CA) following agarose gel electrophoresis, ethidium bromide staining, and excision of gel slices. The
purified fragments were cloned into pCR2.1 vector and transformed into TOP 10 F′ cells using TA
Cloning® Kit (Invitrogen, Carlsbad, CA). Three to
five individual clones were sequenced to obtain
representative sequences. Each fragment was sequenced in both directions using a ABI PRISM
3700 DNA Analyzer (Applied Biosystems, Foster
City, CA) at the Sequencing and Genotyping Facility at Kansas State University, Manhattan, KS. The
entire DNA sequence of the ferritin subunit from
CPB were deposited in GenBank (Accession No.
AY297687).
Archives of Insect Biochemistry and Physiology
Ferritin Subunit of Colorado Potato Beetle
Sequence Analysis
Multiple sequence alignments were performed
with CLUSTAL W using the Gonnet matrix (Megalign program, DNASTAR Inc., Madison WI). Phylogenetic analysis was performed using the PHYLIP
software package (Felsenstein, 1993). Amino acid
sequences were aligned by CLUSTAL X. The phylogenetic tree was constructed by the neighbor-joining method (Saitou and Nei, 1987). The ferritin
amino acid sequence of Ixodes ricinus was used as
the outgroup. Bootstrap values were calculated with
SEQBOOT program (Felsenstein, 1985) on 1,000
replications. The phylogenetic tree was drawn by
the TreeView program (Page, 1996).
Northern Blot Analysis
Northern blot analysis was performed using
NorthernMax Kit (Ambion, Austin, TX) according
to the manufacturer’s instructions. Briefly, total RNA
(20 µg), which was extracted from either fat body
or midgut of dexamethasone- or acetone-treated 4th
instars, was separated on a 1% agarose gel by electrophoresis and transferred to a nylon membrane
(Boehringer-Mannhein, Mannhein, Germany). A
387-bp cDNA fragment (nt286–nt682) that was
amplified from the coding region of CPB ferritin
subunit was labeled with [32P]dATP using random
primer labeling system (Invitrogen, Gaithersburg,
MD). The blot was hybridized overnight at 42°C.
After washing twice, the blot was exposed to Kodak
X-Omat AR film at –80°C with an intensifying
screen. Densitometeric analysis of the autoradiograph was performed using Kodak Digital Science 1
D Image Analysis software (version 3.6) (Eastman
Kodak Company, Rochester, NY).
RESULTS
Cloning and Characterization of
Ferritin Heavy Chain cDNA
The differential display patterns of 36 cDNA
fragments generated by RFDD-PCR were induced
November 2005
143
by dexamethasone treatment. The DNA sequence
from P311, a 379-bp fragment amplified by PROBE
EU-31, was most similar to the ferritin heavy chain
subunit by a BLAST search using GenBank (data
not shown).
To obtain the full-length sequence of the CPB
ferritin cDNA, specific primers were synthesized
based on the known sequence of P311 and used
for RACE. A 625-bp fragment was obtained by 5′RACE and a 555-bp fragment was obtained by 3′
RACE, both of which overlapped, in part, with the
fragment of P311 (Fig. 1). Assembly of sequences
from P311 and the RACE fragments generated a
840-bp full-length cDNA sequence, which was
composed of a 639-bp open reading frame (ORF)
encoding 213 amino acid residues, 76-bp 5′ untranslated region (UTR), and 125-bp 3′UTR that
included a putative polyadenylation signal ATTAAA
at nt 791 and a 28-bp poly (A) tail (Fig. 2).
Analysis of the deduced amino acid sequence
from the full-length cDNA revealed a putative signal peptide at positions 1–19. (Fig. 2). The calculated molecular mass and isoelectric point (pI) of
the mature protein was 22 kD and 7.11, respectively. The seven amino acid residues associated
with the metal-binding site (the ferroxidase center/the iron storage site) were found in the CPB
ferritin subunit (Fig. 3). This amino acid arrangement is conserved in insect and vertebrate ferritin
H chain subunits (Charlesworth et al., 1997; Kim
et al., 2001). The CPB ferritin subunit had no Nlinked glycosylation sites.
Sequence Comparison and Phylogenetic
Analysis of Insect Ferritin Heavy
Chain Subunits
The CPB ferritin subunit showed high amino acid
sequence identity with Apriona germari (69.3%), G.
mellonela (54.5%), M. sexta (54.0%), D. melanogaster (53.2%), C. ethlius (51.4%), and N. lugens
(47.6%). Lower identity was found with Anopheles
gambiae (38.7%) and Ae. aegyti (37.8%) (Fig. 4).
CPB ferritin is phylogenetically most closely related
to that of Ap. germari (Fig. 5).
144
Qiu et al.
Fig. 1. Diagram of the 3′ and 5′
RACE strategies used to obtain a
840-bp full-length cDNA using
nucleotide sequence determined
from P311 of CPB, a differentially
expressed cDNA fragment identified by RFDD-PCR following
dexamethasone induction.. The
639-bp open reading frame
(ORF) is shown as an opened
box, the 5′UTR (76 bp) and
3′UTR (125 bp) are lines. The
solid lines beneath the base pair
scale represent cloned PCR fragments. The arrows indicate length
and direction of sequenced
fragments.
Tissue Expression of mRNA Encoding
Ferritin Heavy Chain Subunit
Northern blot analysis revealed that CPB ferritin subunit mRNA was expressed both in fat body
and midgut of 4th instars (Fig. 6A). The Expression of mRNA was higher in midgut than that
found in fat body (~2.5-fold). Expression of mRNA
in fat body, however, was inducible by dexamethasone (~1.5-fold). Figure 6B shows that each well
received equal amounts of total RNA, validating
that differences in the ferritin H chain mRNA expression patterns seen in Figure 6A are not due to
differences in amounts of total RNA used.
DISCUSSION
Initial research on insect ferritins began with
the purification of ferritin subunits by biochemical methods, obtaining amino acid sequence, and
lastly cloning and characterization of the cDNA
encoding the ferritin subunit (Dunkov et al., 1995;
Nichol and Locke, 1999; Du et al., 2000; Kim et
al., 2001). In this study, a differentially expressed
cDNA fragment (P311) was identified by RFDDPCR technique following induction by dexametha-
sone. Based on the nucleic acid sequence of P311,
we designed two pairs of PCR primers and obtained an 840-bp cDNA using 3′ and 5′ RACE. The
ORF of the cDNA coded for 213 amino acids and
showed a high similarity to vertebrate ferritin Hchain subunit and to other insect ferritin sequences
(Figs. 3 and 4), with the highest similarity to Ap.
germari ferritin (69.3%).
Most insect ferritins reported to date contain a
signal peptide, which facilitates secretion (Nichol
et al., 2002). Amino acid residues of the signal peptide differ in insects but the length is similar. In G.
mellonella, the signal peptide contains 20 amino
acid residues (Kim et al., 2001). In C. ethlius, the
signal peptide of S ferritin is 20 residues and that
of G ferritin is 19 residues (Nichol and Locke,
1999). Based on the rules developed by von Heijne
(1983), a putative signal peptide is also detected
in the deduced amino acid sequence of CPB ferritin subunit. It is 19 amino acid residues in length
and most are hydrophobic (63%). The calculated
molecular weight of CPB ferritin subunit is 22 kDa,
which is similar with other insect ferritin subunits
(Nichol et al., 2002).
The N-terminus of CPB ferritin subunit has a
cysteine at the 23rd residue (Fig. 3). The cysteine
Archives of Insect Biochemistry and Physiology
Ferritin Subunit of Colorado Potato Beetle
145
Fig. 2. Nucleotide and deduced amino acid sequences
of the ferritin heavy chain cDNA isolated from CPB. The
underlined sequences are: TGA, a stop codon upstream
from the start codon; ATG, the start codon; TAA, the stop
codon at the end of the coding sequence; and ATTAAA, a
putative polyadenylation signal. Arrowhead: Predicted signal peptide cleavage site. This sequence was deposited in
GenBank (accession number: AY297687).
is conserved in many other insect ferritins, e.g., Ap.
germari, G. mellonela, M. sexta, D. melanogaster, C.
ethlius, and N. lugens (Nichol et al., 2002), and may
function in protein-protein interaction or allow the
retention of ferritin in endoplasmic reticulum by
addition of lipid moieties (Nichol and Locke, 1999;
Nichol et al., 2002). Ferritins of An. gambiae and
Ae. aegypti, which have low sequence identities with
CPB ferritin subunit, do not have this conserved
cysteine.
November 2005
Fig. 3. Amino acid sequence alignment of CPB ferritin heavy chain subunit with ferritin heavy chain subunits identified from other insects. Black
shaded areas indicate that amino acids are identical. Sequences used: Aeaegy = Aedes aegypti (the yellow fever mosquito), GenBank accession No. P41822;
Angamb = Anopheles gambiae (the malaria mosquito), XP_312474; Apgerm = Apriona germari (the mulberry longicorn beetle), AAM 44043; Caethl =
Calpodes ethlius (the larger canna leafroller), AAD50238; Drmela = Drosophila melanogaster (fruit fly), NP_524873; Gamell = Galleria mellonella (the greater
wax moth), AAG41120; Ixrici = Ixodes ricinus (the Castor Bean Tick), AAC19131; Ledece = Leptinotarsa decemlineata (Colorado potato beetle), AAP57194;
Masext = Manduca sexta (tobacco horn worm), AAK39636; Niluge = Nilaparvata lugens (brown planthopper), CAB65310. Asterisks indicate conserved
residues with the ferroxidase center found in vertebrate ferritin heavy chain subunits.
146
Qiu et al.
Archives of Insect Biochemistry and Physiology
Ferritin Subunit of Colorado Potato Beetle
147
Fig. 4. Matrix indicating the
sequence identities (%) of
aligned insect ferritin heavy
chain subunit sequences.
Identities were calculated using CLUSTAL W (DNASTAR,
Inc). (See Fig. 3 legend for
species names and accession
numbers.)
There was no N-linked glycosylation site (AsnX-Ser/Thr) identified in the deduced amino acid
sequence of CPB ferritin subunit. The H chain subunit of Ae. aegypti (Dunkov et al., 1995; Pham et
al., 2000) and G. mellonela (Kim et al., 2001) also
lack a glycosylation site. However, the H chain subunit of D. melanogaster (Lind et al., 1998), C. ethlius
(Nichol and Locke, 1999), N. lugens (Du et al.,
2000), B. mori (Nichol et al., 2002), and the L
chain subunit of M. sexta (Pham et al., 1996), C.
ethlius (Nichol and Locke, 1999), and N. lugens (Du
et al., 2000) have functional glycosylation sites.
Glycosylation of secreted ferritin may increase its
stability and assist in intracellular targeting and receptor binding (Nichol and Locke, 1999).
An iron-responsive element (IRE) is usually
present in the 5′-UTR of ferritin mRNA and is involved in the translational control of iron metabolism in insects and other animals by interacting
with an iron regulatory protein (IRP) (Eisenstein
Fig. 5. Phylogenetic tree of
deduced amino acid sequences of insect ferritin
heavy chain subunits using
that of I. ricinus as the outgroup. The bootstrap values
with 1,000 trials are indicated on branches. (See Fig.
3 legend for species names
and accession numbers.)
November 2005
148
Qiu et al.
Fig. 6. Northern blot analysis of
L. decemlineata ferritin mRNA. A:
Ferritin mRNA. B: Relative rRNA
amounts per well on the 1% agarose gel following electrophoresis
and visualized with ethidium bromide. Control (–), dexamethasone
treatment (+).
and Munro, 1990; Beattany, et al., 1992; Eisenstein
and Blemings, 1998; Hentze and Kuhn, 1996). The
IRE is conserved among many insects and has a
consensus structure of a six-nucleotide loop (CAGUGN) followed by two 5-bp stem segments that
are separated by a single C bulge (Pham et al.,
1996; Kim et al., 2001; Charlesworth et al., 1997;
Du et al., 2000; Kopá…ek et al., 2003). There are,
however, some ferritin subunits without IRE. No
IRE was reported in yeast, plant, and bacteria
(Rothenberger et al., 1990), in yolk of Lymnaea
stagnalis (snail) (von Darl et al., 1994), and in
Schistosoma mansoni (Schussler et al., 1996). There
was likewise no IRE detected in the 5′ UTR of
fersub2 from N. lugens and Du et al. (2000) suggested that the library may have a truncated 5′ end,
which might explain the absence of the IRE.
Georgieva et al. (1999) reported that Drosophila H
chain homologs represented at least four classes
of mRNA of various lengths, two of which contain
IREs and two of which lack IREs. The authors suggested that the IRE was contained in an N-terminal region of the gene and that alternative splicing
results in mRNA with or without a IRE. In this
study, there was no IRE detected in the 76-bp 5′UTR of CPB ferritin subunit. It may have been lost
by an accidental truncation during the 5′RACE, it
may have been in an intron and splicing resulted
in mRNA lacking IRE, or it simply does not exist.
The H and L chains of vertebrate ferritins have
similar capacities for iron but they may serve different functions (Charlesworth et al., 1997). The
H chain has seven conserved amino acid residues
(1 Tyr, 1 His, 1 Gln, and 4 Glu), which form a
ferroxidase center that acts as a metal binding site
and oxidizes cytoplasmic ferrous ion into ferric ion
(Andrews et al., 1992; Lawson et al., 1989; Wade
et al., 1991; Charlesworth et al., 1997). In the L
chain, the ferroxidase center is replaced by salt
bridges, which confer higher stability to chemical
denaturation (Charlesworth et al., 1997). In the
CPB ferritin subunit, the ferroxidase center is conserved and is consistent with 7 other insect ferritin subunits (Fig. 3). This finding suggests that
the insect ferritin H chain may function similarly
to the vertebrate H chain. However, the vertebrate
H chain contains a tyrosine residue, which is
thought to be essential for rapid iron biomineralization (Waldo et al., 1993). A similar tyrosine
residue is not present in the CPB ferritin subunit
or in other insect ferritin subunits (Charlesworth
et al., 1997; Kim et al., 2001), indicating that insect ferritins may have a distinct biomineralization
mechanism (Charlesworth et al., 1997).
Archives of Insect Biochemistry and Physiology
Ferritin Subunit of Colorado Potato Beetle
Ferritin has been identified in many insect tissues including midgut, Malpighian tubules, fat
body, and usually occurs abundantly in hemolymph (Locke and Leung, 1984; Locke and Nichol,
1992; Nichol and Locke, 1990). Ferritin synthesis
in insects can be affected or induced by excess iron
(Locke and Leung, 1984; Pham et al., 1999; Kim
et al., 2001, 2002). In D. melanogaster, excess iron
can shift the distribution of ferritin H chain mRNAs
to those without the IRE or to those having shorter
3′ ends (Geogieva et al., 1999). In mosquito, ferritin mRNA expression increased 3-fold in irontreated cells (Pham et al., 1999). In G. mellonella,
mRNA expression for the 26-kDa ferritin subunit
increased about 1.5- and 1.7-fold in fat body and
midgut, respectively (Kim et al., 2001), and that
of the 32 kDa subunit increased 3-fold after iron
feeding (Kim et al., 2002). In CPB, the midgut had
a higher level of ferritin mRNA compared with fat
body and similar patterns are seen in M. sexta, G.
mellonella, and other insects (Pham et al., 1996,
1999; Kim et al., 2001). Nevertheless, CPB ferritin
subunit mRNA is induced by dexamethasone in fat
body whereas a similar increase is not apparent in
midgut. Induction of ferritin by dexamethasone has
not been reported before but dexamethasone-induction of P450s is well known (Yoon et al., 2002).
Since fat body is a major site for P450 biosynthesis in insects and since dexamethasone induced the
oxidative detoxification of abamectin by increasing the levels of P450s expressed, the co-induction
of ferritin in fat body may be necessary to supply
iron to newly translated P450s. Additionally, dexamethasone applied topically would be expected
to affect the fat body first before reaching the midgut. The induction pattern of dexamethasone when
administered by feeding should be investigated.
LITERATURE CITED
Andrews SC, Arosio P, Bottke W, Briat JF, von Darl M. 1992.
Structure, function, and evolution of ferritins. J Inorg
Biochem 47:161–174.
Argentine JA, Clark JM, Ferro DN. 1989. Genetics and synergism of resistance to azinphosmethyl and permethrin in
the Colorado potato beetle. J Econ Entomol 82:698–705.
November 2005
149
Argentine JA, Clark JM. 1990. Selection for abamectin resistance in Colorado potato beetle (Coleoptera: Chrysomelidae). Pestic Sci 28:17–24.
Argentine JA, Lee SH, Sos MA, Barry SR, Clark JM. 1995.
Permethrin resistance in a near isogenic strain of Colorado potato beetle. Pestic Biochem Physiol 53:97–115.
Beattany AJE, Eisenstein RS, Munro HN. 1992. Mutagenesis
of the iron-regulatory element further defines a role for
RNA secondary structure in the regulation of ferritin and
transferritin receptor expression. J Biol Chem 265:16531–
16537.
Charlesworth A, Georgieva T, Gospodov I, Law JH, Dunkov
BC, Ralcheva N, Barillas-Mury C, Ralchev K, Kafatos FC.
1997. Isolation and properties of Drosophila melanogaster
ferritin. Molecular cloning of a cDNA that encodes one
subunit, and localization of the gene on the third chromosome. Eur J Biochem 247:470–475.
Clark JM, Scott JG, Campos F, Bloomquist JR. 1995. Resistance to avermectins: extent, mechanisms, and management implications. Annu Rev Entomol 40:1–30.
Cozzi A, Corsi B, Levi S, Santambrogio P, Albertini A, Arosio
P. 2000. Overexpression of wild type and mutated human
ferritin H-chain in Hela cells: in vivo role of ferritin
ferroxidase activity. J Biol Chem 275: 25122–25129.
Du J, Foissac X, Carss A, Gatehouse AMR, Gatehouse JA. 2000.
Ferritin acts as the most abundant binding protein for
snowdrop lectin in the midgut of rice brown planthoppers
(Nilaparvata lugens). Insect Biochem Mol Biol 30:297–305.
Dunkov BC, Zhang D, Choumarov K, Winzerling JJ, Law JH.
1995. Isolation and characterization of mosquito ferritin
and cloning of a cDNA that encodes one subunit. Arch
Insect Biochem Physiol 29:293–307.
Eisenstein RS, Munro HN. 1990. Translational regulation of
ferritin synthesis by iron. Enzyme 44:42–58.
Eisenstein RS, Blemings KP. 1998. Iron regulatory proteins,
iron responsive elements and iron homeostasis. J Nutr
128:2295–2298.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791.
Felsenstein J. 1993. PHYLIP (Phylogeny Inference Package),
version 3.5c. Department of Genetics, University of Washington, Seattle.
150
Qiu et al.
Georgieva T, Dunkov BC, Harizanova N, Ralchev K, Law JH.
1999. Iron availability dramatically alters the distribution
of ferritin subunit messages in Drosophila melanogaster. Proc
Natl Acad Sci USA 96:2716–2721.
Hentze MW, Kuhn LC. 1996. Molecular control of vertebrate
iron metabolism: mRNA-based regulatory circuits operated
by iron, nitric oxide, and oxidative stress. Proc Natl Acad
Sci USA 93:8175–8182.
Kim BS, Yun CY, Yeo SM, Lee HJ, Kim HR. 2001. Cloning
and expression of a ferritin subunit for Galleria mellonella.
Arch Insect Biochem Physiol 47:8–17.
Kim BS, Lee CS, Seol JY, Yun CY, Kim HR. 2002. Cloning
and expression of 32 kDa ferritin from Galleria mellonella.
Arch Insect Biochem Physiol 51:80–90.
Kopá…ek P, ðdychová J, Yoshiga T, Weise C, Rudenko N, Law
JH. 2003. Molecular cloning, expression and isolation of
ferritins from two tick species: Ornithodoros moubata and
Ixodes ricinus. Arch Insect Biochem Physiol 33:103–113
Lawson DM, Treffry A, Artymiuk PJ, Harrison PM, Yewdall
SJ. 1989. Identification of the ferroxidase centre in ferritin. FEBS Lett 254:207–210.
Levi S, Santambrogio P, Corsi B, Cozzi A, Arosio P. 1996. Evidence that H- and L-chain have co-operative roles in the
iron-uptake mechanism of human ferritin. Biochem J
288:591–596.
Page RDM. 1996. TREEVIEW: an application to display phylogenetic trees on personal computer. Comput Appl Biosci
12:357–358.
Pham DQ-D, Zhang D, Hufnagel DH, Winzerling JJ. 1996.
Manduca sexta hemolymph ferritin: cDNA sequence and
mRNA expression. Gene 172:255–259.
Pham DQ-D, Winzerling JJ, Dodson MS, Law JH. 1999. Transcriptional control is relevant in the modulation of mosquito ferritin synthesis by iron. Eur J Biochem 266:236–240.
Pham DQ-D, Brown SE, Knudson DL, Winzerling JJ, Dodson
MS, Shaffer JJ. 2000. Structure and location of a ferritin
gene of the yellow fever mosquito Aedes aegypti. Eur J
Biochem 267:3885–3890.
Rothenberger S, Mullner EW, Kuhn LC. 1990. The mRNAbinding protein which controls ferritin and transferrin receptor expression is conserved during evolution. Nucleic
Acids Res 18:1175–1179.
Saitou N, Nei M. 1987. The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Molec Biol
Evol 4:406–425.
Schussler P, Potters E, Winnen R, Michel A, Bottke W, Kunz
W. 1996. Ferritin mRNAs in Schistosoma mansoni do not
have iron-responsive elements for post-transcriptional
regulation. Eur J Biochem 241:64–69.
Lind MI, Ekengren S, Melefors Ö, Söderhäll K. 1998. Drosophila
ferritin mRNA: alternative RNA splicing regulates the presence of the iron-responsive element. FEBS Lett 436:476–482.
von Darl M, Harrison PM, Bottke W. 1994. cDNA cloning
and deduced amino acid sequence of two ferritins: soma
ferritin and yolk ferritin from the snail Lymnaea stagnalis
L. Eur J Biochem 222:353–366.
Locke M, Leung H. 1984. The induction and distribution of
an insect ferritin: a new function for the endoplasmic
reticulum. Tissue Cell 16:739–766.
von Heijne G. 1983. Patterns of amino acid near signal-sequence cleavage sites. Eur J Biochem 133:17–21.
Locke M, Nichol H. 1992. Iron economy in insects. Annu
Rev Entomol 37:195–215.
Wade VJ, Levi S, Arosio P, Treffry A, Harrison PM, Mann S.
1991. Influence of site-directed modification on the formation of iron cores in ferritin. J Mol Biol 221:1443–1452.
Nichol H, Locke M. 1990. The localization of ferritin in insects. Tissue Cell 22:767–777.
Nichol H, Locke M. 1999. Secreted ferritin subunits are of
two kinds in insects molecular cloning of cDNAs encoding two major subunits of secreted ferritin from Calpodes
ethlius. Arch Insect Biochem Physiol 29:999–1013.
Nichol H, Law JH, Winzerling JJ. 2002. Iron metabolism in
insect. Annu Rev Entomol 47:535-559.
Waldo GS, Ling J, Sanders-Loeth J, Theil EC. 1993. Formation of an Fe(III)-tyrosinate complex during biomineralization of H-subunit ferritin. Science 259:796–798.
Yoon KS, Nelson KO, Clark JM. 2002. Selective induction of
abamectin metabolism by dexamethasone, 3-methylcholanthrene, and phenobarbital in Colorado potato
beetle, Leptinotarsa decemlineata (Say), Pestic Biochem
Physiol 73:74–86.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
3
Размер файла
245 Кб
Теги
potato, beetle, ferritic, subunit, characterization, sequencing, decemlineata, colorado, leptinotarsa, encoding, cdna
1/--страниц
Пожаловаться на содержимое документа