close

Вход

Забыли?

вход по аккаунту

?

Functional analysis of four Gloverin-like genes in the silkworm Bombyx mori.

код для вставкиСкачать
Archives of Insect Biochemistry and Physiology 67:87–96 (2008)
Functional Analysis of Four Gloverin-like Genes in the
Silkworm, Bombyx mori
Shinpei Kawaoka,1 Susumu Katsuma,1 Takaaki Daimon,1 Ryoko Isono,1 Naoko Omuro,1
Kazuei Mita,2 and Toru Shimada1*
To identify genes involved in the innate immunity of the silkworm Bombyx mori, we constructed a cDNA library from the fat
body of Escherichia coli-challenged B. mori larvae. Based on the expressed sequence tag (EST) data and whole genome
shotgun sequence analysis, we found four Gloverin-like genes, BmGlov1–4, in the Bombyx genome. Northern blot and RT–
PCR analysis showed that BmGlov1–4 were induced in the larval fat body after an immune challenge by the injection of E.
coli; however, less induction was observed after the injection of a yeast Candida albicans. In silico sequence analysis revealed
the presence of a motif homologous to NF-κB binding site in the upstream region of each BmGlov gene. Moreover, we
expressed recombinant BmGlov1–4 proteins using the baculovirus expression system, and found that all the recombinant
BmGlov1–4 significantly inhibited the growth of E. coli. Arch. Insect Biochem. Physiol. 67:87–96, 2008. © 2007 Wiley-Liss, Inc.
Keywords: Bombyx mori; EST; antibacterial protein; Gloverin
INTRODUCTION
In multicellular organisms, low-molecularweight, nonspecific antimicrobial proteins play an
important role in the innate immunity to combat
infectious microorganisms (Hoffman et al., 1999).
These antimicrobial proteins are induced by invasion of microorganisms or an injury. In the study
of the innate immunity of the silkworm Bombyx
mori, at least four groups of antimicrobial proteins
have been discovered: Cecropin, Attacin, Lebocin,
and Moricin (Morishima et al., 1990; Sugiyama et
al., 1995; Hara and Yamakawa, 1995a,b). These
antimicrobial proteins might act with each other,
and this cooperation may help in developing an
effective defense mechanism against microorganisms. Many gene families encode antimicrobial
proteins. Some of them, such as the Cecropin fam-
ily (Ramos-Onsins and Aguade, 1998), are conserved beyond order or species, while others, such
as the Drosomycin family (Jiggins and Kim, 2005),
are specific among order or species.
There are glycine-rich antibacterial proteins with
molecular masses ranging from 8 to 30 kDa.
Attacin is a representative of glycine-rich antibacterial proteins. These proteins inhibit the growth
of gram-negative bacteria by interacting with lipopolysaccharides (LPS) and by specifically inhibiting the formation of outer membrane (Carlsson
et al., 1991, 1998). The permeabilization of the bacterial outer membrane allows the large molecular
antibacterial proteins to access the inner membrane
easily, which results in setting a synergic interaction between these antibacterial proteins (Engström
et al., 1984; Lazzaro and Clark, 2001). Gloverin,
isolated from the giant silk moth Hyalophora gloveri,
1
Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo, Japan
2
National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan
Contract grant sponsor: Grants-in-Aid for Scientific Research (MEXT); Contract grant number: 17018007; Contract grant sponsor: Insect Technology–Agrigenome
Program (MAFF-NIAS); Contract grant sponsor: National Bioresource Project (MEXT); Contract grant sponsor: Program for Agricultural Bioinformatics (JST).
*Correspondence to: Dr. T. Shimada, Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, University of
Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan. E-mail: shimada@ss.ab.a.u-tokyo.ac.jp
Received 15 March 2007; Accepted 6 May 2007
© 2007 Wiley-Liss, Inc.
DOI: 10.1002/arch.20223
Published online in Wiley InterScience (www.interscience.wiley.com)
88
Kawaoka et al.
also belongs to this group and seems to be a lepidopteran-specific protein (Axen et al., 1997).
In this study, we describe the functional analysis of four Gloverin-like genes, BmGlov1–4, in B.
mori, and show that recombinant BmGlov1–4 expressed by a baculovirus vector can cause the inhibition of bacterial growth.
MATERIALS AND METHODS
Insects, Cell Lines, and Viruses
B. mori larvae (F1 hybrid Kinshu × Showa) were
reared as described previously (Katsuma et al.,
2005). The Sf-9 and High Five cell lines were cultured at 27°C in TC-100 medium supplemented
with 10% fetal bovine serum and Express Five medium (Invitrogen, Carlsbad, CA), respectively. Autographa californica nucleopolyhedrovirus (AcMNPV)
was propagated in the Sf-9 cells, and the virus titers
were determined by a plaque assay on the Sf-9 cells.
Alignment and Phylogenetic Analysis
Amino acid sequences and nucleotide sequences
of lepidopteran Gloverins were aligned using the
CLUSTALW program (Thompson et al., 1994). Distances between the nucleotide sequences were calculated according to the F84 model with DNADIST
in the PHYLIP 3.65 package (Felsenstein, 1989).
A Neighbor-joining tree was constructed with the
NEIGHBOR program in PHYLIP (Felsenstein,
1989). The reliability of the tree was tested by bootstrap analysis with 1,000 replications.
Immune Challenge
Escherichia coli (JCM5491; ATCC 25299) and
Candida albicans (JCM1621; ATCC 10264) were
grown overnight at 37°C in Luria-Bertani (LB) medium and potato-dextran medium, respectively.
The cells were washed twice with phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 4.3
mM Na2HPO4, 1.4 mM KH2PO4), and the bacterial concentration was adjusted to an absorbance
of 0.01 at 600 nm. Three-day-old fifth instar B. mori
larvae were injected with 50 µl of E. coli or C.
albicans suspensions. We collected fat body from
the larvae at 0, 6, 12, 24, 36, and 48 h after the
injection, and then isolated total RNA from these
tissues using the Trizol reagent (Invitrogen).
Construction of Expressed Sequence Tag (EST)
Database From Fat Body of Immune-Challenged
B. mori Larvae
We constructed a cDNA library from the fat
body RNA of E. coli- and C. albicans-challenged B.
mori larvae (6 h and 12 h after the injection) using the method described previously (Kato et al.,
2005). We sequenced 10,752 clones from the cDNA
library and annotated these clones by the BLAST
program against public protein databases.
Reverse Transcription–Polymerase Chain
Reaction (RT–PCR)
The total RNA was reverse-transcribed, diluted,
and used for PCR as described elsewhere (Katsuma
et al., 2005). First-strand cDNA reaction was performed with TaKaRa RNA PCR Kit (AMV) version
3.0 (TaKaRa, Japan), using oligo dT-Adaptor primer.
Primers for PCR are shown in Table 1.
Northern Blot Analysis
Total RNA of the B. mori fat body was prepared
using the Trizol reagent (Invitrogen). Northern blot
analysis was performed as described previously
(Katsuma et al., 2005). Probes for B. mori Gloverin1,
Cecropin B, and Actin3 were amplified by PCR with
the primers listed in Table 1 using the B. mori cDNA
clones as a template.
Generation of Recombinant AcMNPVs
Recombinant AcMNPVs were constructed using
a Bac-to-Bac system (Invitrogen). The coding region of the BmGlov proteins (BmGlov1, BmGlov2,
BmGlov3, and BmGlov4) with a His-tag sequence
at the C-terminus was amplified by PCR with the
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Characterization of B. mori Gloverin Genes
89
TABLE 1. PCR Primers Used in This Study
Nucleotide sequence (5′–3′)
Application
CACGACTTTGTCACTTGG
GCTTACGAGGCAAGAATG
GTCTTGAGGAGCGAAACT
GTCATAACAAAGCACGAG
ACTAGCCAAACCACAAAC
GATGGGATTGTGTTGACA
ATTGGGAGGACGAAGAAG
TGCAGAGTGAAAGTATCG
AGATGAACCCAGATCATGTTCG
GAGATCCACATCTGTTGGAAG
AGCGCCGCTTGTGTCTTAA
TGGAAATCCAGTCTTATACGAG
CTAGGATCCAGAAATGTATTCCAAGGTGTTGTTATCC
AGTGGATCCTCAATGGTGATGGTGATGATGACCCCACTCGTGAGTAATCTGGGCCTG
CTAGGATCCAGAAATGAATACAAATCTGTTTTATATCTTCGC
AGTGGATCCTCAATGGTGATGGTGATGATGACCCCAATCATGGCGGATCTCTGCTTG
CTAGGATCCAGAAATGAATTCCAAATTGCTGTTTTTCATCGC
AGTGGATCCTCAATGGTGATGGTGATGATGACCCCACTCATGCCGGATCTCTGCTTG
CTAGGATCCAGAAATGAATTCCAAACTATTATATTTCTTCGCCAC
AGTGGATCCTCAATGGTGATGGTGATGATGACCCCAATCATGACGGAACTCTGCCTG
BmGlov1 (Forward): RT–PCR and Northern blot
BmGlov1 (Reverse): RT–PCR and Northern blot
BmGlov2 (Forward): RT–PCR
BmGlov2 (Reverse): RT–PCR
BmGlov3 (Forward): RT–PCR
BmGlov3 (Reverse): RT–PCR
BmGlov4 (Forward): RT–PCR
BmGlov4 (Reverse): RT–PCR
BmActin3 (Forward):RT–PCR and Northern blot
BmActin3 (Reverse):RT–PCR and Northern blot
BmCecB (Forward): Northern blot
BmCecB (Reverse): Northern blot
BmGlov1-His (Forward)
BmGlov1-His (Reverse)
BmGlov2-His (Forward)
BmGlov2-His (Reverse)
BmGlov3-His (Forward)
BmGlov3-His (Reverse)
BmGlov4-His (Forward)
BmGlov4-His (Reverse)
gene-specific primers (shown in Table 1) using the
B. mori cDNA clones as a template. The PCR products were cloned into the cloning site (BamHI) of
the pFastBac1 vector (Invitrogen). The nucleotide
sequence was confirmed by DNA sequencing using the ABI Big Dye Terminator Cycle Sequencing
Ready Reaction Kit (Applied Biosystems, Foster
City, CA) and the ABI Prism 3100 DNA sequencer
(Applied Biosystems). The recombinant AcMNPVs
were generated by transfection with bacmid DNAs
into Sf-9 cells and propagated in the Sf-9 cells.
HisGraviTrap column (GE Healthcare Bioscience,
New York, NY). The eluted solution was concentrated by using AmiconUltra 10K (Millipore), then
desalted by using a PD-10 column (GE Healthcare
Bioscience). Elution was performed with 0.1 M
phosphate buffer (pH 7.4). The protein concentrations were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE), followed by staining with Coomassie
brilliant blue. The BmGlov proteins were stored
at –80°C until use.
Expression and Purification of BmGlovs
Antibacterial Assays
The High Five cells cultured in a 150-mm dish
were infected with the recombinant AcMNPVs at
an MOI of 5. After 60 h, the cells were collected
and the expressions of BmGlov1–4 were examined by Western blot analysis using anti-His antibody (Qiagen, Germany), as described previously
(Katsuma et al., 2006). Purification of BmGlov1–4
was performed by using nickel chromatography.
The collected cells were lysed with I-PER Reagent
(Pierce, Rockford, IL), containing protease inhibitor cocktail (Roche, Switzerland). After centrifugation at 8,000g for 15 min, the resulting supernatants were filtered with a 0.45-µm pore filter
(Millipore, Billerica, MA), and loaded onto a
E. coli (JM109) were used in this antibacterial
assay. Five or 20 µg of the purified BmGlov1–4
was added to LB medium in 96-well microtiter
plates that contained log-phase bacteria in a total
volume of 100 µl. The growth of the bacteria at
37°C was determined by recording optical density
595 nm.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Nucleotide Sequence Accession Number
The nucleotide sequence reported in this article
has been submitted to the DDBJ/EMBL/GenBank
data bank under the accession number AB190863AB190866 (BmGlov1–4).
90
Kawaoka et al.
RESULTS
We constructed a cDNA library from the fat
body RNA of E. coli- and C. albicans-challenged B.
mori larvae. DNA sequencing yielded 10,752 ESTs
from the cDNA library, and these ESTs were clustered into 858 contigs. From the EST data, we
found four kinds of clone that were homologous
to Gloverin from Hyalophora gloveri (Axen et al.,
1997). Based on the whole genome shotgun sequence (Mita et al., 2004; Xia et al., 2004) and
phylogenetic analysis, we identified four loci encoding Gloverin-like genes in the B. mori genome
and termed them BmGlov1, BmGlov2, BmGlov3, and
BmGlov4, respectively (Fig. 1A). A more detailed
EST data analysis showed that each BmGlov gene
had putative alleles. Nucleotide sequence similari-
ties between the alleles were very high (>97%). We
found that the BmGlov1–4 cDNAs were 828, 805,
809, and 840 bp long and potentially encode proteins composed of 178, 173, 173, and 171 amino
acids, respectively (Fig. 1B). Hydropathy plot analysis showed that the N-terminus of each BmGlov
protein had features consistent with a signal peptide, suggesting that BmGlovs might be secreted proteins. The signal sequence cleavage site was predicted
to lie between amino acid positions 17 and 18 of
BmGlov1 or 18 and 19 of BmGlov2, BmGlov3, and
BmGlov4 (Fig. 1B).
The deduced amino acid sequence of BmGlov1
showed 84%, 84%, and 82% identity to BmGlov2,
BmGlov3, and BmGlov4, respectively, and 77%
identity to Manduca sexta Gloverin (Fig. 1B).
Gloverins from other insects are produced in a
prepropeptide form (Lundström et al., 2002). After cleavage of the signal peptide, a cleavage at
Fig. 1. Phylogenetic tree and multiple alignment of
Gloverins from lepidopteran insects. A: Neighbor-joining
tree generated from lepidopteran Gloverin gene sequences.
Bootstrap values of 1,000 replicates are indicated. B: Mul-
tiple alignment of BmGlovs with Gloverin from Hyalophora
cecropia (P81048), Manduca sexta (AAO74639), and
Trichoplusia ni (AAG44367). Putative signal peptidase (S)
and endopeptidase (X) processing sites are indicated.
Isolation of B. mori cDNAs Encoding Gloverin-like
Genes
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Characterization of B. mori Gloverin Genes
TABLE 2. Molecular Weight (Mw) and Isoelectric Points (pI) of BmGlovs
BmGlov1
BmGlov2
BmGlov3
BmGlov4
prepro
pro
mature
prepro
pro
mature
prepro
pro
mature
prepro
pro
mature
Mw (kDa)
pI
19.2
17.4
14.4
18.9
16.4
14.1
19.0
17.1
14.1
18.8
16.8
14.1
6.97
6.57
5.49
6.41
6.48
7.03
6.91
6.49
6.32
6.30
5.93
6.94
RHPR present on propeptide, which is a typical motif (-Arg-X-X-Arg-) of the cleavage site for endopeptidase (Molloy et al., 1992), could result in the
production of the mature form of BmGlovs. Theoretical molecular masses of BmGlov1, BmGlov2,
BmGlov3, and BmGlov4 were 14.4, 14.1, 14.1, and
14.1 kDa, respectively (Table 2). Isoelectric points
of BmGlovs were 5.49, 7.03, 6.32, and 6.94, respectively (Table 2). The putative mature form of
BmGlov1 showed 92%, 93%, and 91% identity to
that of BmGlov2, BmGlov3, and BmGlov4, respectively, and 80% identity to that of M. sexta Gloverin
(Fig. 1B). The BmGlov proteins exhibit a typical
amino acid composition of the Gloverin family:
many glycine residues (14%) and no cysteine residues (Axen et al., 1997). The locations of glycine
residues were conserved among BmGlovs.
Transcriptional Analysis of BmGlov Genes
Temporal expression profiles of the BmGlov
genes after the challenge of E. coli or C. albicans
91
were examined by Northern blot analysis. As shown
in Fig. 2, the injection of E. coli caused a strong
induction of the BmGlov genes at 6 h after the immune challenge, and this induction continued for
48 h after the immune challenge. In contrast, the
injection of C. albicans did not induce the expression of the BmGlov genes. The expression of the
BmGlov genes reached its highest level at 12–24 h
after the bacterial challenge. One distinct band with
an approximate size of 800 bases was detected by
Northern blot analysis. We could not separate the
transcripts of BmGlov1–4 by Northern blot analysis because of the similarities of their sequences
and sizes. In addition, the expression pattern of
Cecropin B was examined by Northern blot analysis. Cecropin B is a well-known antibacterial gene
of B. mori (Taniai et al., 2006). As shown in Figure
2, Cecropin B was significantly induced in the larval fat body after the bacterial challenge, but less
induction was observed after the C. albicans injection, confirming that the immune-challenge experiments performed in this study worked well. To
distinguish the expression profiles of each BmGlov,
we next performed RT–PCR analysis using primers specific to BmGlov1–4. We found that the expressions of all BmGlov genes were significantly
induced by the injection of E. coli (Fig. 3).
Sequence Analysis of Promoter Regions of BmGlovs
We searched the partial promoter sequences of
BmGlovs using the B. mori whole-genome shotgun
sequence (Mita et al., 2004; Xia et al., 2004). In
the upstream regions of each BmGlov gene, a puta-
Fig. 2. Effects of the bacterial challenge on
the expression of BmGlov, BmCecB, and Actin3.
Three-day-old fifth-instar larvae were immune
challenged with the injection of either Escherichia coli or Candida albicans. Northern blot
analysis was performed using total RNA of the
larval fat body prepared at 0, 6, 12, 24, 36,
and 48 h after the injection. Actin3 is shown
as a control. Molecular sizes are shown to the
right of the figure and time courses and experimental group are indicated above.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
92
Kawaoka et al.
BmGlovs in both the cells and the medium, suggesting that both the propeptides and mature forms
of BmGlovs exist in the cells and medium of the
recombinant AcMNPV-infected cells. We then purified recombinant BmGlovs from recombinant
AcMNPV-infected cells to near homogeneity by using nickel chromatography (Fig. 4B), and performed
antibacterial assays using different concentrations
of BmGlovs (5 or 20 µg in 100 µl E. coli culture
medium). As shown Figure 5, we observed that all
Fig. 3. RT–PCR analysis of BmGlov1–4. The total RNA
samples used in Northern hybridization were used in this
experiment. Actin3 was used as a control, and time courses
and experimental groups are indicated above.
tive TATA box was located 21 nt upstream from
the transcription start site (data not shown). Moreover, a clear consensus sequence for the transcription factor NF-κB binding site (GGGAMTTYCC)
was found 48 nt upstream from the transcription
start site of BmGlov1, BmGlov2, BmGlov3, and
BmGlov4, suggesting that the BmGlov genes may be
induced by the NF-κB signaling cascade (Silverman
and Maniatis, 2001; data not shown).
Expression and Antibacterial Assays of
Recombinant BmGlovs
To examine the biochemical properties of the
products of the BmGlov genes, we generated recombinant AcMNPVs expressing His-tagged BmGlov
proteins. With Western blot analysis using anti-His
antibody, we found that the recombinant Histagged BmGlovs were successfully expressed as approximately 15–20 kDa proteins in the High Five
cells infected with the recombinant AcMNPVs (Fig.
4A). Moreover, we observed faint bands in the medium of AcMNPV-infected High Five cells (Fig. 4A),
indicating that the recombinant BmGlovs were
slightly secreted into the medium. Positive bands
were not detected in the High Five cells infected
with wild-type (wt) AcMNPV (Fig. 4A). In addition, Western blot analysis detected two forms of
Fig. 4. Expression and purification of BmGlov1–4. A: Expression of BmGlov1–4. The High Five cells were infected
with the wt AcMNPV or recombinant AcMNPVs expressing
BmGlov1, BmGlov2, BmGlov3, or BmGlov4. Expression of
BmGlov1–4 was examined by Western blot analysis with
anti-His antibody. The molecular weights of the protein
standards are shown on the left. B: Purification of
BmGlov1–4. Purification was performed by using nickel
chromatography. One µg of each purified BmGlov was electrophoresed, and the gel was stained with Coomassie brilliant blue. The molecular weights of the protein standards
are shown on the left.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Characterization of B. mori Gloverin Genes
93
Fig. 5. Antibacterial assay of BmGlov1–4. The growth of bacteria at
37°C with or without BmGlovs was
detected by recording optical density
at 595 nm. 0.1 M phosphate buffer
(pH 7.4) was used as a negative control. Five (A) or 20 µg (B) of each
BmGlov was used in the experiments. The data show means ± the
standard errors.
recombinant BmGlovs had weak but significant
antibacterial activities against E. coli in a dose-dependent manner.
DISCUSSION
To identify immune-related genes of B. mori, we
obtained 10,752 ESTs from the cDNA library conArchives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
structed from the fat body RNA of E. coli- and C.
albicans-challenged B. mori larvae. From the EST
data, we identified four kinds of clone that were
homologous to Hyalophora gloveri Gloverin (Axen
et al., 1997). Phylogenetic analysis with whole genome shotgun data showed that there are four loci
encoding Gloverin-like genes in the silkworm genome. In addition, we found that each BmGlov gene
94
Kawaoka et al.
has putative alleles. These alleles might be derived
from Kinshu or Showa, the parental strain of Kinshu
× Showa used in this study. Cheng et al. (2006) reported there are at least seven Gloverin-like genes in
the silkworm genome (Cheng et al., 2006). Thus,
we compared sequences of the BmGlov genes obtained in this study to those of Gloverin-like genes
they had reported. We found that none of the
BmGlov genes showed 100% identity with Gloverinlike genes reported by Cheng et al. (2006). These
differences may simply be caused by interstrain
variations between F1 hybrid Kinshu × Showa used
in this study and inbred strain Dazao used in Cheng
et al. (2006). The present EST analysis showed that
only four BmGlov genes were induced by bacterial
challenge, suggesting that these BmGlov genes
might mainly contribute to the innate immunity
of this strain.
To examine whether the BmGlov genes are induced by an immune challenge, we investigated
their immune response by Northern blot analysis
after the injection of a gram-negative bacteria, E.
coli, or a yeast, C. albicans. The BmGlov genes were
strongly induced by the challenge of E. coli, but
not by the challenge of C. albicans. Moreover, RT–
PCR analysis showed that some differences were
present in the expression profiles of the BmGlov
genes. Sequence analysis revealed that there were
consensus NF-κB binding sites at 48 nucleotides
upstream from the transcription start site of each
BmGlov gene (data not shown). These results indicate that the BmGlov genes are likely to be regulated by the classical pathways through Toll
(Lemaitre et al., 1996) and/or Imd (Georgel et al.,
2001), which are well known as Rel/NF-κB-mediated immune responses in insects (Silverman and
Maniatis, 2001; Tanaka et al., 2005).
We next expressed recombinant BmGlovs using
the baculovirus expression system. Sequence analysis and Western blot experiments showed that
BmGlovs might be expressed as prepropeptides like
most insect antibacterial peptides. Generally, the
preproparts are cleaved sequentially to produce the
mature form of antibacterial protein. Most often,
the function of propart is to keep the antibacterial
protein inactive (Lundström et al., 2002). Gunne
et al. (1990) reported that a recombinant proattacin lost its antibacterial activity after introduction of a mutation blocks the correct processing
of attacin (Gunne et al., 1990). In contrast, Lundström et al. (2002) showed that the expression of
a recombinant T. ni Gloverin possessing its propart
had similar, or actually somewhat higher, antibacterial activity compared with H. gloveri mature
Gloverin (Lundström et al., 2002). They concluded
that the propart cannot exert any major inhibitory
effect on the activity of T. ni Gloverin (Lundström
et al., 2002). We have now shown that all propeptides of recombinant BmGlovs could significantly
inhibit the growth of E. coli (Fig. 5), indicating that
the propart of the BmGlov proteins cannot exert
any major inhibitory effect on their activities.
In this study, we identified four functional
Gloverin-like genes, BmGlov1, BmGlov2, BmGlov3,
and BmGlov4. B. mori Gloverins may increase their
antibacterial activities by cooperating with each
other in the innate immunity system.
LITERATURE CITED
Axen A, Carlsson A, Engström A, Bennich H. 1997. Gloverin,
an antibacterial protein from the immune hemolymph of
Hyalophora pupae. Eur J Biochem 247:614–619.
Carlsson A, Engström P, Palva ET, Bennich H. 1991. Attacin,
an antibacterial protein from Hyalophora cecropia, inhibits
synthesis of outer membrane proteins in Escherichia coli
by interfering with omp gene transcription. Infect Immun
59:3040–3045.
Carlsson A, Nyström T, de Cock H, Bennich H. 1998.
Attacin—an insect immune protein—binds LPS and triggers the specific inhibition of bacterial outer-membrane
protein synthesis. Microbiology 144:2179–2188.
Cheng T, Zhao P, Liu C, Xu P, Gao Z, Xia Q, Xiang Z. 2006.
Structures, regulatory regions, and inductive expression
patterns of antimicrobial peptide genes in the silkworm
Bombyx mori. Genomics 87:356–365.
Engström P, Carlsson A, Engström A, Tao ZJ, Bennich H. 1984.
The antibacterial effect of attacins from the silk moth
Hyalophora cecropia is directed against the outer membrane
of Escherichia coli. EMBO J 3:3347–3351.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Characterization of B. mori Gloverin Genes
Felsenstein J. 1989. PHYLIP—Phylogeny Inference Package
(Version 3.2). Cladistics 5:164–166.
Georgel P, Naitza S, Kappler C, Ferrandon D, Zachary D,
Swimmer C, Kopczynski C, Duyk G, Reichhart JM, Hoffmann JA. 2001. Drosophila immune deficiency (IMD) is
a death domain protein that activates antibacterial defense
and can promote apoptosis. Dev Cell 1:503–514.
Gunne H, Hellers M, Steiner H. 1990. Structure of preproattacin and its processing in insect cells infected with
a recombinant baculovirus. Eur J Biochem 187:699–703.
Hara S, Yamakawa M. 1995a. Moricin, a novel type of antibacterial peptide isolated from the silkworm, Bombyx mori.
J Biol Chem 270:29923–29927.
Hara S, Yamakawa M. 1995b. A novel antibacterial peptide
family isolated from the silkworm, Bombyx mori. Biochem
J 310:651–656.
Jiggins FM, Kim KW. 2005. The evolution of antifungal peptides in Drosophila. Genetics 171:1847–1859.
Hoffmann JA, Kafatos FC, Janeway CA Jr, Ezekowits RAB.
1999. Phylogenetic perspectives in innate immunity. Science 284:1313–1318.
95
Lundström A, Liu G, Kang D, Berzins K, Steiner H. 2002.
Trichoplusia ni gloverin, an inducible immune gene encoding an antibacterial insect protein. Insect Biochem Mol
Biol 32:795–801.
Mita K, Kasahara M, Sasaki S, Nagayasu Y, Yamada T, Kanamori
H, Namiki N, Kitagawa M, Yamashita H, Yasukochi Y,
Kadono-Okuda K, Yamamoto K, Ajimura M, Ravikumar G,
Shimomura M, Nagamura Y, Shin-I T, Abe H, Shimada T,
Morishita S, Sasaki T. 2004. The genome sequence of silkworm, Bombyx mori. DNA Res 2004 11:27–35.
Molloy SS, Bresnahan PA, Leppla SH, Klimpel KR, Thomas
G. 1992. Human furin is a calcium-dependent serine
endoprotease that recognizes the sequence Arg-X-X-Arg
and efficiently cleaves anthrax toxin protective antigen. J
Biol Chem 267:16396–16402.
Morishima I, Suginaka S, Ueno T, Hirano H. 1990. Isolation
and structure of cecropins, inducible antibacterial peptides,
from the silkworm, Bombyx mori. Comp Biochem Physiol
B 95:551–554.
Ramos-Onsins S, Aguade M. 1998. Molecular evolution of
the Cecropin multigene family in Drosophila: functional
genes vs. pseudogenes. Genetics 150:157–171.
Kato S, Ohtoko K, Ohtake H, Kimura T. 2005. Vector-capping: a simple method for preparing a high-quality fulllength cDNA library. DNA Res 12:53–62.
Silverman N, Maniatis T. 2001. NF-kappaB signaling pathways in mammalian and insect innate immunity. Genes
Dev 15:2321–2342.
Katsuma S, Tanaka S, Omuro N, Takabuchi L, Daimon T,
Imanishi S, Yamashita S, Iwanaga M, Mita K, Maeda S,
Kobayashi M, Shimada T. 2005. Novel macula-like virus
identified in Bombyx mori> cultured cells. J Virol 79:5577–
5584.
Sugiyama M, Kuniyoshi H, Kotani E, Taniai K, Kadono-Okuda
K, Kato Y, Yamamoto M, Shimabukuro M, Chowdhury S,
Xu J. 1995. Characterization of a Bombyx mori cDNA encoding a novel member of the attacin family of insect antibacterial proteins. Insect Biochem Mol Biol 25:385–392.
Katsuma S, Daimon T, Horie S, Kobayashi M, Shimada T.
2006. N-linked glycans of Bombyx mori nucleopolyhedrovirus fibroblast growth factor are crucial for its secretion. Biochem Biophys Res Commun 350:1069–1075.
Tanaka H, Yamamoto M, Moriyama Y, Yamao M, Furukawa
S, Sagisaka A, Nakazawa H, Mori H, Yamakawa M. 2005.
A novel Rel protein and shortened isoform that differentially regulate antibacterial peptide genes in the silkworm
Bombyx mori. Biochim Biophys Acta 1730:10–21.
Lazzaro BP, Clark AG. 2001. Evidence for recurrent paralogous
gene conversion and exceptional allelic divergence in the
Attacin genes of Drosophila melanogaster. Genetics 159:659–
671.
Taniai K, Lee JH, Lee IH. 2006. Bombyx mori cell line as a model
of immune-system organs. Insect Mol Biol 15:269–279.
Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann
JA. 1996. The dorsoventral regulatory gene cassette spatzle/
Toll/cactus controls the potent antifungal response in
Drosophila adults. Cell 86:973–983.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Res.
22:4673–4680.
96
Kawaoka et al.
Xia Q, Zhou Z, Lu C, Cheng D, Dai F, Li B, Zhao P, Zha X,
Cheng T, Chai C, Pan G, Xu J, Liu C, Lin Y, Qian J, Hou Y,
Wu Z, Li G, Pan M, Li C, Shen Y, Lan X, Yuan L, Li T, Xu H,
Yang G, Wan Y, Zhu Y, Yu M, Shen W, Wu D, Xiang Z, Yu J,
Wang J, Li R, Shi J, Li H, Li G, Su J, Wang X, Li G, Zhang Z,
Wu Q, Li J, Zhang Q, Wei N, Xu J, Sun H, Dong L, Liu D,
Zhao S, Zhao X, Meng Q, Lan F, Huang X, Li Y, Fang L, Li
C, Li D, Sun Y, Zhang Z, Yang Z, Huang Y, Xi Y, Qi Q, He
D, Huang H, Zhang X, Wang Z, Li W, Cao Y, Yu Y, Yu H, Li
J, Ye J, Chen H, Zhou Y, Liu B, Wang J, Ye J, Ji H, Li S, Ni P,
Zhang J, Zhang Y, Zheng H, Mao B, Wang W, Ye C, Li S,
Wang J, Wong GK, Yang H; Biology Analysis Group. 2004.
A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 306:1937–1940.
Archives of Insect Biochemistry and Physiology
February 2008
doi: 10.1002/arch.
Документ
Категория
Без категории
Просмотров
0
Размер файла
403 Кб
Теги
like, silkworm, gloverin, four, morie, analysis, genes, function, bombyx
1/--страниц
Пожаловаться на содержимое документа