close

Вход

Забыли?

вход по аккаунту

?

Hladr8 and acute anterior uveitis in ankylosing spondylitis.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM Volume 38
Number 4, April 1995, pp 547-550
0 1995, American College of Rheumatology
547
HLA-DR8 AND ACUTE ANTERIOR UVEITIS IN
ANKY LOSING SPONDYLITIS
S. M. MONOWARUL ISLAM, JIRO NUMAGA, YUJIRO FUJINO, KANJIRO MASUDA, HIROMI OHDA,
RANK0 HIRATA, HIROO MAEDA, and HIROSHI MITSUI
Objective. To identify possible factors in the
development of acute anterior uveitis (AUU) in patients
with ankylosing spondylitis (AS).
Methods. We investigated HLA antigens serologically, and HLA-DRBl*OS alleles by polymerase chain
reaction-restriction fragment length polymorphism, in
42 Japanese AS patients with and without AAU.
Results. Thirty-six of the AS patients (85.7%)
had HLA-B27. Thirteen (65%)of the 20 patients with
AAU had HLA-DR8, whereas only 1 (4.5%) of the 22
patients without AAU had DR8. The difference was
statistically significant (P,,,, < 0.001).
Conclusion. Our data suggest that HLA-B27 is
strongly associated with AS in Japanese patients and
that HLA-DR8 is important for the development of
AAU in Japanese patients with AS.
Ankylosing spondylitis (AS) is an inflammatory
disorder of unknown origin which primarily affects the
axial skeleton, peripheral joints, and extraarticular
structures (1). The most common extraarticular manifestation of AS is acute anterior uveitis (AAU) (1-3).
AS is strongly associated with HLA-B27, and its
prevalence among populations throughout the world is
proportional to the frequency of HLA-B27 (1,4).
HLA-B27 is a serologic specificity that can be divided
into 7 variants at the DNA level (43). In 1988,
Derhaag and associates reported that there is no
difference among these variants in terms of their
Supported in part by research grant 03557074 from the
Ministry of Education, Science, and Culture, Japan.
S. M. Monowarul Islam, MD, Jiro Numaga, MD, Yujiro
Fujino, MD, Kanjiro Masuda, MD, Hiromi Ohda, MD: University
of Tokyo School of Medicine, Tokyo, Japan; Ranko Hirata, Hiroo
Maeda, MD: Saitama Medical School, Saitama, Japan; Hiroshi
Mitsui, MD: Mitsui Memorial Hospital, Tokyo, Japan.
Address reprint requests to Jiro Numaga, MD, 3-2-1-214
Nishigahara, Kita-ku, Tokyo 114, Japan.
Submitted for publication July 12, 1994; accepted in revised
form November 14, 1994.
association with A'AU (2). They also suspected the
possible role of another genetic factor(s) in the pathogenesis of AAU. Since the frequency of B27 in the
Japanese population is extremely low (<0.5%) (6),AS
is not a frequent condition in this population. The
present study is the first to investigate HLA types in
Japanese AS patients with and without AAU. We
especially considered the HLA class I1 antigens, to
determine whether these antigens have any role in the
precipitation of AAU in patients with AS.
PATIENTS AND METHODS
Patients and controls. A total of 42 AS patients were
included in this study (Table 1). Thirty-seven (88.1%) were
male and 5 (1 1.9%) were female. Twenty of the AS patients
(17 male, 3 female; 47.6%) had AAU either at the time of
investigation or in the past, and 22 (52.4%) did not. We also
included 11 patients who had AAU but not AS. Of these 11
patients, 6 (54.5%) were male and 5 (45.5%) were female. All
of the study patients were of Japanese ancestry and were
unrelated to each other. The AS patients in this study had
been previously diagnosed having AS and had visited the
outpatient services of the Department of Ophthalmology,
University of Tokyo School of Medicine, or the Division of
Orthopedic Surgery, Mitsui Memorial Hospital, during the
period from June 1992 to January 1994. AS patients who had
had the disease for at least 10 years were selected for this
study, except for 1 patient who had had AS for 4 years.
Among the 11 patients who had AAU but not AS, the onset
of AAU had occurred at least 1 year prior to the study.
At the time of the study, all patients underwent
thorough physical and ophthalmologic examinations by experts in the respective fields. The diagnosis of AS was
confirmed according to the New York criteria (7). Briefly,
these criteria entail the presence of radiographically demonstrable sacroiliitis along with at least 1 of the following:
limitation of motion of the lumber spine in all 3 planes, pain
at the thoracolumbar junction or in the lumbar spine, or
chest expansion limited to 52.5 cm. AAU was diagnosed as
iridocyclitis or iritis with a duration of <3 months, according
to the recommendations of Rothova et a1 (8).
One hundred forty healthy volunteers were included
in this study as serologic controls. The control subjects were
MONOWARUL ISLAM ET AL
Table 1. Clinical data on the patients studied*
AS patients
No. malelno. female
Age at onset of AS
Age at onset of AAU
With
AAU
(n = 20)
Without
AAU
(n = 22)
1713
23.1 f 7.0
30.3 f 8.0
2012
31.2 f 4.3
-
RESULTS
AAU
patients
without
AS
(n = 11)
615
-
42.7 2 4.3
* Values for age are the mean 2 SD. AS = ankylosing spondylitis;
AAU = acute anterior uveitis.
healthy and of Japanese ancestry and were unrelated to each
other.
All studies were approved by the Ethics Committee
of the University of Tokyo. Informed consent was obtained
from each subject before his or her participation in the study.
HLA tissue typing. Lymphocytes were isolated from
the peripheral venous blood by the specific gravity gradient
centrifugation method, using Ficoll conray. The sera used
for tissue typing were obtained at the Blood Transfusion
Service, Saitama Medical Center, Saitama Medical School.
The typing sera distributed at the 1lth International Histocompatibility Workshop were also utilized to determine
HLA types. Serologic HLA tissue typing was performed by
the modified 2-stage complement-dependent microcytotoxicity method (9).
DNA analysis. Genomic DNA was extracted from the
granulocytes of peripheral venous blood by the phenolchloroform extraction method (10). The DNA was then
subjected to group-specific amplification by polymerase
chain reaction (PCR). The primers used for DR8 amplification were 5'-ACGTTTCT? OGAGTACTCTACG and 5'CCGCTGCACTGTGAAGCTCT (forward and reverse, respectively) (11). After PCR amplification, the subtypes of
DR8 were determined by restriction fragment length polymorphism analysis, performed according to the method
previously described by us (12). Briefly, 5 pl of PCR product
was incubated at 37°C for 3 hours with 5 units of restriction
endonucleases in 15 pl of the recommetded reaction buffer.
Restriction enzymes used for DRBl 08 alleles were as
described by Ota and colleagues (11). After digestion, 10 pl
of the reaction mixture was run in a 7.5% polyacrylamide gel
for 30 minutes with a constant voltage of 200V, after which
the gel was immersed for 5 minutes in 50 ml of deionized
water containing 20 pl of ethidium bromide (5 mg/ml). The
stained gel was washed 3 times with distilled water and then
visualized under ultraviolet illumination.
Statistical analysis. The results were examined by
chi-square analysis and Fisher's exact test (13) to determine
the significance of the difference between patients and controls and between the 2 groups of patients. Corrected P
values were calculated as P,,, = 1 - (1 - P)",where n is the
number of antigens examined or the number of detected gene
variants of the particular specificity observed in the compared groups. Relative risk (RR) was calculated as (a x d)/(b
x c), where a, b, c, and d are the numbers of positive
patients, negative patients, positive controls, and negative
controls, respectively, for the given marker.
The results of typing for HLA-A, B, DR, and
DQ antigens are shown in Table 2. HLA-B27 was
detected in 36 (85.7%) of the 42 AS patients, while only
1 (0.7%) of the 140 healthy controls had this antigen.
This increase was highly significant. The RR for B27
was 834 (P,,,, < 1.0 X
Minor deviations of the
frequencies of some other class I antigens were observed in the AS patients as compared with the controls, but none of these were statistically significant.
Among the class I1 antigens, the frequencies of
DR12 and DQ7 were increased in the AS patients as
compared with the controls (28.6% versus 8.6% and
40.5% versus 17.9%, respectively). Relative risks were
calculated as 4.2 for DR12 (P,,,, < 0.001) and 3.1 for
Table 2. HLA antigen frequencies in the ankylosing spondylitis
patients versus healthy controls*
HLA type
Patients
(n = 42)
Controls
(n = 140)
~
A2
A1 1
A24
A26
A3 1
A33
B7
B27
B35
B39
B44
B46
B5 1
B52
B54
B60
B61
B62
DRl
DR2
DR4
DR8
DR9
DRll
DR12
DR13
DR14
DR52
DR53
DQ1
DQ3
DQ78
DQ4
21750.0)
13 (30.9)
26 (61.9)
7 (16.7)
6 (14.3)
3 (7.1)
5 (11.9)
36 (85.7)"
4 (9.5)
2 (4.8)
3 (7.1)
1 (2.4)
5 (11.9)
8 (19.0)
5 (11.9)
4 (9.5)
4 (9.5)
3 (7.1)
9 (21.4)
13 (30.9)
13 (30.9)
14 (33.3)
6 (14.3)
3 (7.1)
12 (28.6)$
3 (7.1)
6 (14.3)
21 (50.0)
20 (47.6)
30 (71.4)
26 (61.9)
17 ( 4 0 . 5 ~
11 (26.2)
* Values are the number (%).
Relative risk = 834, Pcorr< 1.0 X
$ Relative risk = 4.2, P,,,, < 0.001.
5 Split of DQ3.
7 Relative risk = 3.1, P,,, < 0.01.
~
59 (42.1)
27 (19.3)
84 (60.0)
30 (21.4)
22 (15.7)
24 (17.1)
15 (10.7)
1 (0.7)
20 (14.3)
11 (7.8)
24 (17.1)
14 (10.0)
17 (12.1)
30 (21.4)
23 (16.4)
12 (8.6)
36 (25.7)
24 (17.1)
12 (8.6)
48 (34.2)
60 (42.9)
33 (23.6)
40 (28.6)
4 (2.9)
12 (8.6)
24 (17.1)
20 (14.3)
56 (40.0)
94 (67.1)
100 (71.4)
84 (60.0)
25 (17.9)
45 (32.1)
HLA-DR8 AND AAU IN AS
549
Table 3. HLA antigen frequencies in ankylosing spondylitis patients with versus those without acute anterior uveitis (AAUI*
AS Patients
HLA
type
With AAU
(n = 20)
Without AAU
(n = 22)
B27
DR8
18 (90)
13 (65)"
18 (81.8)
1 (4.5)
* Values are the number (%).
t Relative risk = 39, Po,, < 0.001.
DQ7 (P,,, < 0.01). In contrast, frequencies of DR4
and DR53 were decreased in the AS patients, but the
decreases were not significant after correction of the P
values.
Table 3 compares the frequencies of a class I
antigen (HLA-B27) and a class I1 antigen (HLA-DR8)
in the 2 clinical subgroups of the AS patients (those
with and those without AAU). The frequency of B27
was not significantly different (90% in patients with
AAU and 81.8% in patients without AAU). DR8, in
contrast, was detected in 13 (65%) of the 20 AS
patients with AAU, but in only 1 (4.5%) of the 22 AS
patients without AAU. This difference was statistically significant (RR = 39, P,,,, < 0.001). We also
compared the AS patients with AAU and the healthy
controls, and again we found an increased frequency
of DR8 among the AS patients with AAU. The relative
risk for DR8 among this patient group versus healthy
controls was 6.0 (P,,,,< 0.01), which was much less
than that for B27. All of the patients with DR8 were
confirmed to have the DRB1*0803 gene by DNA
analysis .
In the AAU patients who did not have AS, the
frequency of HLA-B27 was increased compared with
healthy controls (RR = 30.9, P,,, < 0.01). The
frequency of B46 was also increased significantly, but
the relative risk was higher for B27. No significant
difference was observed in the frequencies of other
class I or class 11 antigens, including HLA-DR8.
DISCUSSION
To the best of our knowledge, this is the first
study of Japanese ankylosing spondylitis patients
grouped according to the presence or absence of
AAU. AAU develops in a considerable number of AS
patients (3). The onset of AAU in these patients
usually occurs approximately 10 years after the onset
of AS (3). It has not been possible to predict which
patient or group of patients will develop AAU. There
is no report to date on the factor(s) that may lead to the
development of this complication. The present study
was aimed at the identification of the possible factor(s)
responsible for the development of the AAU in AS
patients.
By serologic typing, HLA-B27 showed the
highest frequency (85.7%) in the AS patients in spite of
a very low frequency (0.7%) of this antigen in the
normal Japanese population. Significant increases in
the frequencies of the DR12 and DQ7 antigens were
also observed among the AS patients; however, the
relative risk was highest for B27 (RR = 834; Table 2).
This indicates that AS is strongly associated with
HLA-B27 irrespective of racial variations, i.e., HLAB27 confers susceptibility to AS in the Japanese
population as in other population groups.
When the 2 clinical subgroups of AS patients
were compared, a significant increase in the frequency
of HLA-DR8 was observed among those with AAU.
This might indicate possible roles of the DR8 antigen
in the development of AAU in AS patients. Questions
may arise as to whether the presence of DR8 is
sufficient for the causation of AAU. Although this was
a small sample, we were able to study 11 patients with
AAU who did not have AS. Among them, no deviation
in the frequency of DR8 was observed, and the highest
relative risk was that for B27 (RR = 30.9). From this
observation it may be postulated that the HLA-DR8
antigen could be a precipitating factor for AAU in
Japanese patients with AS, but not in persons who are
otherwise healthy.
At the DNA level, all of the AS patients who
had the HLA-DR8 antigen were positive for the
DRB 1 *0803 genotype. Among the Oriental population,
DRB1*0803 is found in >70% of normal subjects who
are positive for DR8 (14). In our AS patients with
AAU, detection of only the "0803 genotype could
reflect the high incidence of this genotype in the
normal j population. Since there are no data on linkage
disequilibrium between B27 and DR alleles in the
Japanese population, it would be difficult to determine
whether the "0803 genotype is linked with HLA-B27
in normal Japanese subjects or if it is detectable at
increased frequency only in AS patients with AAU. To
detect a possible haplotype, we compared the results
among the HLA-B27 positive AS patients only. In this
comparison, the frequency of the DR8 antigen or
DRB 1*0803 genotype was significantly increased
among the AS patients with AAU. The association of
DR8 in B27 negative patients was similar to that in the
B27 positive patients, though there were only a few
MONOWARUL ISLAM ET AL
patients in the former group. This observation might
indicate that the
Of AAU in AS patients
could be secondary to the development of AS, and that
this secondary develoument of AAU in the AS uatients is guided by theHLA-DR8 antigen or possibly
by a B27/DR8 haplotype in the Japanese population.
We also analyzed the subtypes
. _ of B27 among
the AS patients and compared the results between the
patients with and those without AAU (data not
shown). No significant association of any particular
subtype was observed in the AS patients with AAU
(15). Moreover, no specific linkage between any subtype of B27 and the DRBl"0803 genotype was detected among the AS patients with AAU. The study
sample included only 1 AS patient who had the DR8
antigen but had not developed AAU. This patient had
had AS for only 4 years, so the possibility that he
would develop AAU some time in the future could not
be eliminated. The results of this study of Japanese
patients indicate that DRBl"0803 is a risk factor for
the development of AAU in patients with AS.
DRBl"0803 is a frequently detected genotype in Orientals but is not common in other population groups.
Further studies in other population groups may detect
other antigen(s) or genotype(s) that confer risk for the
development of this complication.
REFERENCES
1. Calin A, Kennedy LG, Edmunds L, Will R. Familial versus
sporadic ankylosing spondylitis: two different diseases? Arthritis Rheum 36:676-681, 1993
2. Derhaag PJFM, de Waal LP ,Linssen A, Feltkamp TEW; Acute
anterior uveitis and HLA-B27 subtypes. Invest Ophthalmol Vis
Sci 291137-1140, 1988
3. Nishiyama A, Mochizuki M, Namba R, Izawa y, Masuda K,
Yamagami Y, Mitsui H, Miyanaga Y, Chihara T, Akagi K:
Rheumatic diseases and uveitis. Jpn J Clin Ophthalmol 35:229236, 1981
4. Dominguez 0, Cot0 E, Martinez-Naves E, Choo SY, LopezLarrea J: Molecular typing of HLA-B27 alleles. Immunogenetics 36:277-282, 1992
5. Zemmour J, Parham P: HLA class I nucleotide sequences. Hum
Immunol 34:225-241, 1992
6. Imanishi T, Akaja T, Kimura A, Tokunaga K, Gojobori T:
Allele and hadotme freauencies for HLA and comdement loci
in various etinic-groups: In, HLA 1991. Edited b;K Tsuji, M
Aizawa, T Sasazuki. Oxford, Oxford University Press, 1992
7. Bennett PH, Burch TH: New York symposium on population
studies in the rheumatic diseases: new diagnostic criteria. Bull
Rheum Dis 17:453458, 1967
8. Rothova A, van Veenendaal WG, Linsen A, Glasius E, Kijlstra
A, de Jong PTVM: Clinical features of acute anterior uveitis.
Am J Ophthalmol 103:137-145, 1987
9. Maeda H, Juji T: A new B-cell alloantigen, TB21, coded for in
the HLA-D/DR region. Tissue Antigens 20:327-334, 1982
10. Kimura A, Sasazuki T: DNA component. In, HLA 1991. Edited
by K Tsuji, M Aizawa, T Sasazuki. Oxford, Oxford University
Press, 1992
11. Ota M, Seki T, Fukushima H, Tsuji K, Inoko H: HLA-DRB1
genotyping by modified PCR-RFLP method combined with
group-specific primers. Tissue Antigens 39: 187-202, 1992
12. Islam SMM, Numaga J, Matsuki K, Fujino Y, Maeda H,
Masuda K. Influence of HLA-DRBl gene variation on the
clinical course of Vogt- Koyanagi-Harada disease. Invest Ophthalmol Vis Sci 35:752-756, 1994
13. Thompson G: A review of theoretical aspects of HLA and
disease association. Theor Popul Biol20: 168-206, 1981
14. Famandez-Vina MA, Tiercy J, Tonai R, Katovich-Hurley C,
Tsai J, Stansy P: In, HLA 1991. Edited by K Tsuji, M Aizawa,
T Sasazuki. Oxford, Oxford University Press, 1992
15. Islam SMM, Masuda K, Maeda H, Matsuki K, Fujino Y,
Numaga J: Molecular subtypes of HLA-B27 in acute anterior
uveitis associated with ankylosing spondylitis, 27th International Congress of Ophthalmology, Toronto, June 26-30, 1994
Документ
Категория
Без категории
Просмотров
4
Размер файла
406 Кб
Теги
hladr8, ankylosis, uveitis, anterior, acute, spondylitis
1/--страниц
Пожаловаться на содержимое документа