close

Вход

Забыли?

вход по аккаунту

?

Mechanism of Fibroblast-Like Synoviocyte Apoptosis Induced by Recombinant Human Endostatin in Rats with Adjuvant Arthritis.

код для вставкиСкачать
THE ANATOMICAL RECORD 291:1029–1037 (2008)
Mechanism of Fibroblast-Like
Synoviocyte Apoptosis Induced by
Recombinant Human Endostatin in Rats
with Adjuvant Arthritis
XUE-YING HUANG,1,2 FEI-HU CHEN,1* JUN LI,1 LI-JUAN XIA,1
YONG-JING LIU,3 XIAO-MING ZHANG,2 AND FENG-LAI YUAN1
1
School of Pharmacy, Anhui Medical University, Hefei, China
2
Department of Anatomy, Anhui Medical University, Hefei, China
3
Department of Cardiothoracic Surgery, PLA 105 Hospital, Hefei, China
ABSTRACT
Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by pronounced synovial hyperplasia, in which there may be an imbalance
between the growth and death of fibroblast-like synoviocytes (FLS). The present study was undertaken to examine the effect of recombinant human endostatin (rhEndostatin) on FLS apoptosis in experimental RA. Adjuvant arthritis
(AA) was induced in male Sprague Dawley (SD) rats. Using cultured AA FLS
obtained from these rats, the apoptosis process was measured by terminal
deoxyribonucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)
as well as Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide
(PI) labeling methods. In addition, the expression levels of the Fas, c-jun,
NFjB, and caspase-3 gene products in synovial tissues were quantified by
quantitative real-time polymerase chain reaction (qPCR) and/or Western blotting assays. Our data revealed that rhEndostatin induced apoptosis in AA
FLS. The number and signal density of TUNEL-positive cells were significantly increased in rats treated with rhEndostatin (2.5 mg/kg). The percentage
of Annexin V-FITC-positive cells was 6.67% after treatment with rhEndostatin
at 25 mg/mL for 48 hr, compared with only 3.32% among untreated control cells.
There were significant increases in Fas mRNA, c-jun mRNA, c-Jun protein,
and caspase-3 (p20) protein in AA synovial tissues treated with rhEndostatin
(2.5 mg/kg), whereas no significant difference in NFjB expression was detected
between treated and untreated tissues. These findings indicate that rhEndostatin has a therapeutic effect on RA by inducing FLS apoptosis, which is
strongly associated with increased expression of Fas, c-jun, and caspase-3, but
not NFjB. Anat Rec, 291:1029–1037, 2008. Ó 2008 Wiley-Liss, Inc.
Key words: rheumatoid arthritis; recombinant human endostatin; apoptosis; Fas; c-Jun; caspase-3; NFjB
Rheumatoid arthritis (RA) is characterized by pronounced synovial hyperplasia composed of extensive proliferation of fibroblast-like synoviocytes (FLS) and
inflammatory cell infiltration with neovascularization.
Pannus tissue comprising the hyperplastic synovium
invades the surface of the articular cartilage and subchondral bone adjacent to the synovial cartilage junction, leading to deterioration of the joint function. In
addition, the pannus tissue secretes various kinds of
growth factors and inflammatory cytokines, which stimulate the growth of the pannus tissue itself. Thus, the
synovial hyperplasia has a critical role in the propagation of rheumatoid synovitis (Padula et al., 1986). It is
Ó 2008 WILEY-LISS, INC.
Abbreviations used: SL 5 synovial lining; BV 5 blood vessel.
Grant sponsor: National Science Foundation of China; Grant
number: 30572196; Grant sponsor: Natural Science Foundation
of the Department of Education, Anhui Province; Grant number; KJ2007B034; Grant sponsor: Postdoctoral Science Foundation of Anhui Province; Grant number: 07-08.
*Correspondence to: Fei-hu Chen, School of Pharmacy, Anhui
Medical University, No. 81 Meishan Road, Hefei 230032, China.
Fax: 86-551-516-7735. E-mail: cfhchina@sohu.com
Received 25 October 2007; Accepted 21 February 2008
DOI 10.1002/ar.20722
Published online 28 May 2008 in Wiley InterScience (www.
interscience.wiley.com).
1030
HUANG ET AL.
generally accepted that there is a close relationship
between cell proliferation and cell death, and that there
may be an imbalance between the growth and death of
FLS in RA, which leads to synovial hyperplasia (Nishioka et al., 1998). Therefore, induction of apoptosis in
RA FLS has been proposed as one of the promising
strategies for treating RA by way of reducing synovial
hyperplasia in situ.
Adjuvant arthritis (AA) is a model of experimental arthritis that is induced by injection of complete Freund’s
adjuvant (CFA). The similarities between the joint pathologies as well as the cellular and humoral immunities
in AA and RA suggest that AA is a relevant animal
model that acts as a useful test system for evaluating
apoptosis-inducing therapies (Bendele et al., 1999).
Endostatin, a 22-kDa fragment of collagen XVIII, is a
member of a group of endogenous antiangiogenic proteins
(O’Reilly et al., 1997) that are activated by proteolytic
processing (Ferreras et al., 2000). In fact, the antiangiogenic activity of endostatin is speculated to be specifically
mediated by the inhibition of endothelial cell adhesion,
migration and proliferation, and induction of apoptosis
(Dhanabal et al., 1999). Recently, endostatin has been
studied not only for its inhibitory effects on vascular endothelial cell function but also its direct antitumor effects
on cancer cell migration and proliferation, and induction
of apoptosis (Wilson et al., 2003; Cui et al., 2007). Fibroblast-like synoviocytes are the ultimate target cells of the
pathologic changes in arthritis (Hui et al., 1997), and
endostatin was reported to induce regression of synovial
proliferation in SCID mice grafted with human RA cells
(Matsuno et al., 2002). Previous studies have shown that
systemic administration of recombinant human endostatin (rhEndostatin) attenuates arthritis severity and
blocks synovial thickening in AA rats by means of inhibition of angiogenesis and proinflammatory factors (Yue
et al., 2004, 2007). These findings suggest that endostatin
may be a potential therapeutic agent for RA. However, it
remains unclear whether endostatin directly influences
FLS functions such as apoptosis. The aim of the current
study was to determine whether endostatin could induce
FLS apoptosis in AA rats. The potential mechanisms are
also discussed.
MATERIALS AND METHODS
Animals
Male Sprague Dawley (SD) rats weighing 160–180 g
were obtained from the Animal Center of Anhui Medical
University (Hefei, China). The animals were housed
under standard conditions at 228C with a 12-hr light/
12-hr dark cycle, and given free access to food and
water. The animals were acclimatized to the holding
room for at least 7 days before the initiation of experiments. All animal care and experimental procedures
were carried out in accordance with the Ethical Regulations for the Care and Use of Laboratory Animals of
Anhui Medical University, which conform to the Guidelines for Laboratory Animals of the National Research
Council of USA (1996).
Reagents and Drugs
The rhEndostatin used in the present study was
kindly provided by the Anhui Sunning Institute of Bio-
technology (Hefei, China). Bacille Calmette-Guerin
(BCG) was purchased from the Biochemical Factory
(Shanghai, China). RPMI 1640 medium was purchased
from Gibco Company (Carlsbad, CA). Fetal calf serum
(FCS) was purchased from Gibco BRL (Carlsbad, CA).
Trypsin was purchased from Sigma Chemical Company
(St. Louis, MO). An In Situ Cell Death Detection Kit
was obtained from Roche Applied Science (Mannheim,
Germany). Phycoerythrin (PE) Mouse Anti-Rat VCAM-1
Kit containing PE-conjugated mouse IgG (negative control) and Annexin V-FITC Apoptosis Detection Kit containing propidium iodide (PI) were purchased from Becton Dickinson Biosciences (PharMingen, San Diego, CA).
TRIzol reagent was purchased from Gibco BRL. A
RevertAidTM First Strand cDNA Synthesis Kit was
obtained from Fermentas Life Sciences (Vilnius, Lithuania). A ShineSybr1 Real Time qPCR MasterMix Kit and
a ShineProbe1 Real Time qPCR MasterMix Kit were
obtained from ShineGene Molecular Bio-tech Co. Ltd.
(Shanghai City, China). Sodium dodecylsulfate (SDS)
and polyacrylamide gel electrophoresis (PAGE) reagents
were obtained from Sigma Chemical Company. Mouse
anti-NFjB p65, goat anti-caspase-3 p20, and rabbit antib-actin primary antibodies were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA). A rabbit anti-cJun primary antibody was purchased from Cell Signaling Technology (Beverly, MA). Horseradish peroxidase
(HRP)-conjugated donkey anti-rabbit, anti-mouse and
anti-goat secondary antibodies were obtained from
Sigma Chemical Company.
Induction of AA and Treatment Protocol
Rats were immunized on day 0 by intradermal injection of a 0.1-mL aliquot of CFA containing 10 mg of
heat-inactivated BCG/mL of paraffin oil into the left
hind paw. Arthritis, as determined by the first signs of
redness or swelling of the ankle joints, was observed
approximately 10 days after the immunization. Subcutaneous administrations of rhEndostatin (2.5 mg/kg/day)
and methotrexate (MTX; 1 mg/kg twice weekly), a disease modifying anti-rheumatic drug (DMARD), to the
abdomen were started on day 10 after immunization
and continued until day 16 after immunization. These
doses were given in the morning. A control group
received the same volumes of phosphate-buffered saline
(PBS). On day 26, the animals were killed under anesthesia with sodium pentobarbital (45 mg/kg intraperitoneally) and the knee joints were promptly removed for
subsequent experiments.
Histological Examination
After killing on day 26, the knee joints were removed,
trimmed, fixed in 4% buffered paraformaldehyde, decalcified, embedded in paraffin, sectioned at 5 mm and
stained with hematoxylin and eosin (HE) for histopathological analysis.
Preparation of AA FLS
Fresh synovial tissues were obtained from AA rats.
The synovium was minced, incubated in a plastic flask
and maintained in RPMI 1640 supplemented with
10 mmol/L HEPES (pH 7.2), 20% FCS, 2 mmol/L glutamine, 50 mmol/L mercaptoethanol, 100 kU/L penicillin
ENDOSTATIN INDUCES AA FLS APOPTOSIS
sodium and 100 mg/L streptomycin in a humidified 5%
CO2-containing atmosphere at 378C for 7 days. After removal of the synovial pieces, the adherent cells were cultured in the same medium. At 70–80% confluence, nonadherent cells were removed, and adherent cells were
trypsinized, split at a 1:2 ratio and recultured in the
same medium. The synoviocytes were used in experiments from passages 3. After three passages, most of
the cultured synoviocytes comprised a homogeneous
population of FLS. The cells were identified by their
morphology and expression of vascular cell adhesion
molecule-1 (VCAM-1).
Terminal Deoxyribonucleotidyl Transferasemediated dUTP Nick-End Labeling (TUNEL)
Analysis for Apoptosis
Fibroblast-like synoviocytes obtained from AA rats
treated with rhEndostatin (2.5 mg/kg) were seeded in
six-well plates containing coverslips at 2 3 105 cells/well
and incubated for 48 hr. Apoptotic cells were detected
with an In Situ Cell Death Detection Kit according to
the manufacturer’s instructions. Briefly, the cells were
fixed with 4% paraformaldehyde for 1 hr at room temperature and permeabilized with 0.1% Triton X-100.
After addition of the TUNEL reaction mixture, the cells
were incubated in a humidified atmosphere for 1 hr at
378C in the dark. Negative and positive control reactions
were performed for each experiment. For positive controls, the cells were incubated with DNase I (grade I; 3–
3,000 U/mL in 50 mM Tris-HCl pH 7.5, 1 mg/mL BSA)
for 10 min at 15–258C to induce DNA strand breaks
before labeling procedures. For negative controls, terminal transferase was omitted from the reaction mixture.
All samples were directly analyzed under a fluorescence
microscope.
Annexin V-FITC/PI Analysis for Apoptosis
To distinguish early apoptosis from late apoptosis (secondary necrosis), the cells were simultaneously stained
with FITC-conjugated annexin V and PI. The former reagent binds to phosphatidylserine on the surface of both
early and late apoptotic cells, while the latter reagent
stains cells that have lost their plasma membrane integrity, as is the case for late apoptotic cells. Fibroblast-like
synoviocytes obtained from AA rats were incubated in
RPMI 1640 containing rhEndostatin (25 mg/mL) for
48 hr, while control FLS were incubated in RPMI 1640
alone. Next, the cells were trypsinized and collected for
detection of apoptosis with an Annexin V-FITC Apoptosis Detection Kit according to the manufacturer’s protocol. Briefly, the cells were washed twice with cold PBS
and resuspended in 500 mL of binding buffer (10 mM
HEPES-NaOH pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) at
a concentration of 1 3 106 cells/mL. After addition of
5 ml of Annexin V-FITC solution and PI (1 mg/mL), the
cells were incubated for 15 min at room temperature.
The cells were analyzed with a flow cytometer (Beckman
Coulter, Fullerton, CA).
Total RNA Extraction
Total RNA was extracted from each frozen synovial
tissue sample using the TRIzol reagent. Briefly, the rats
1031
were randomly divided into normal, AA control and
rhEndostatin (2.5 mg/kg)-treated groups. Five rats were
taken from each group. The synovial tissues were dissected and rapidly frozen in liquid nitrogen. Aliquots
(100 mg) of the tissues were homogenized and treated
with 1 mL of TRIzol reagent. After addition of chloroform,
the mixture was centrifuged to separate the RNA phase
from the DNA phase. The RNA phase was subjected to
RNA precipitation using isopropyl alcohol. The obtained
RNA samples were rinsed with ethanol and dissolved in
RNase-free water. Finally, the RNA samples were treated
with RNase-free DNase I to remove any contaminating
genomic DNA before reverse transcription.
cDNA Synthesis from Total RNA
cDNAs were synthesized with a RevertAidTM First
Strand cDNA Synthesis Kit according to the manufacturer’s instructions. Briefly, 6 mL of purified RNA
was reverse-transcribed using 1 mL of oligo(dT)18 primer
(500 mg/mL), 2 mL of 10 mM dNTP mix, 4 mL of 53 firststrand buffer, 1 mL of RiboLockTM Ribonuclease Inhibitor
(20 kU/mL) and 1 mL of RevertAidTM M-MuLV Reverse
Transcriptase (200 kU/mL) in a final volume of 20 mL.
The contents were incubated at 428C for 60 min before
being heat-denatured at 708C for 10 min. Finally, the
cDNAs were diluted 1:5 with DEPC-treated H2O and
stored in 12-mL aliquots at 2708C.
Quantitative Real-time Polymerase Chain
Reaction (qPCR)
The Fas and c-jun mRNA levels were quantified by
real-time PCR in an FTC-2000 instrument (Funglyn Biotech Inc., Toronto, Canada) using SYBR Green I dye and
TaqMan probe detection of amplification products,
respectively. The primers and probes were designed
using the Primer Express software (PE Applied Biosystems, Foster City, CA) and are shown in Table 1. The
threshold cycle (Ct) was determined for each sample
using the GeneAmp 5700 Sequence Detection System
(Applied Biosystems). Standard curves were generated
by linear regression using Ct versus log10(copy number).
The copy equivalent numbers for samples were calculated
using these standard curves. Data were expressed as the
ratio between the gene of interest copy equivalent and an
endogenous housekeeping gene (b-actin or GAPDH) copy
equivalent, yielding the relative expression.
Amplification of the target Fas cDNA was performed
by SYBR Green I real-time PCR in a final volume of
50 mL in thin-walled 0.2-mL tubes. The reaction mixture
in each tube consisted of 25 mL of 23 PCR buffer, 0.6 mL
of each forward and reverse primer (25 pmol/mL), 1 mL of
template cDNA and 22.8 mL of DEPC-treated H2O. All
tubes were sealed and centrifuged at 1,000 3 g for 30 s,
before the mixtures were amplified under the following
cycling conditions: initial activation of PowerQ1 Taq
DNA polymerase for 4 min at 948C, followed by 40 cycles
of denaturation for 15 s at 948C, annealing for 25 s at
608C and extension for 25 s at 728C. Negative controls
consisted of the master mix plus water instead of the
cDNA template (nontemplate control). Rat b-actin, an
endogenous housekeeping gene, was used as an internal
control for this method. The PCR products generated by
1032
HUANG ET AL.
TABLE 1. Primers and probes used in real-time reverse transcriptase polymerase chain reaction
Forward primer 50 –30
Genes
Fas
b-actin
c-jun
GAPDH
c-jun probe
GAPDH probe
Reverse primer 50 –30
Product size
TGGCTGTCCTGCCTCTGGT
CGAACGCTCCTCTTCAACTCC
CCCATCTATGAGGGTTACGC
TTTAATGTCACGCACGATTTC
GCAATGGGCACATCACCACTAC
GTGACACTGGGCAGCGTATTCT
TGGAGTCTACTGGCGTCTT
TGTCATATTTCTCGTGGTTCA
fam1 CGTGACCGACGAGCAGGAGGG 1tamra
fam1 CTGAAGGGTGGGGCCAAAAG 1tamra
qPCR were confirmed by performing a melting curve
analysis at the end of the amplification by increasing
the temperature from 728C at 0.28C/s and continuously
measuring the fluorescence.
TaqMan real-time PCR was used to determine the relative expression levels of c-jun mRNA. The final volume
of 50 mL of PCR mix included 25 mL of 23 Hotstart FluoPCR mix, 0.8 mL of each forward and reverse primer
(25 pmol/mL), 0.3 mL of TaqMan probe (25 pmol/mL), 1 mL
of template cDNA and 22.1 mL of DEPC-treated H2O.
The thermal cycling conditions were 4 min at 948C to
allow activation of PowerQ1 Taq DNA polymerase, followed by 40 cycles of 30 s at 948C and 30 s at 608C. Negative controls consisted of the master mix plus water
instead of the cDNA template (nontemplate control).
Relative c-jun mRNA expression levels were calculated
according to the mRNA expression of the housekeeping
gene GAPDH.
100bp
150bp
142bp
138bp
Differences between groups were deemed significant at
P < 0.05.
RESULTS
Induction of the Rat AA Model
Adjuvant-induced arthritis developed in rats immunized with CFA, and clinical signs (periarticular redness
and swelling) of arthritis appeared at 100% incidence
around day 10 after the immunization. The inflammatory response in the ankles reached its peak by day 17,
and there was significant joint pathology by day 24 (Fig.
1b) in comparison with normal control ankles (Fig. 1a).
Among the variety of pathological features, the most
distinctive characteristics of the AA model were hyperplasia/hypertrophy of FLS accompanied by massive infiltration of inflammatory cells and neovascularization
(Fig. 1d) relative to normal synovial tissues (Fig. 1c).
Western Blot Analysis
Detection of NFjB, c-Jun, and caspase-3 proteins in synovial tissues was performed by Western blot analysis.
The rats were randomly divided into normal, AA control,
rhEndostatin (2.5 mg/kg)- treated and MTX (1 mg/kg)
-treated groups. Five rats were taken from each group.
The tissues were dissected and rapidly frozen in liquid
nitrogen. Aliquots (100 mg) of the tissues were homogenized and treated with 400 mL of lysis buffer (50 mM
Tris-HCl pH 8.0, 150 mM NaCl, 0.02% NaN3, 0.1% SDS,
1% NP-40, 0.5% sodium deoxycholate, 1 mg/mL aprotinin,
100 mg/mL PMSF). The protein concentrations of the tissues were determined by absorbance readings at 280 nm
on a UV spectrophotometer (Bio-Rad, Hercules, CA). Aliquots of the synovial tissue samples containing 30 mg of
protein were resolved by SDS-PAGE using a 10% gel and
transferred to a nitrocellulose membrane (Whatman,
Kent, England) by electroblotting. The membranes were
blocked with Tris-buffered saline containing 0.1% Tween
20 (TBST) and 5% nonfat milk for 1 hr at room temperature, followed by incubation at 48C overnight with one of
the following Abs: mouse anti-NFjB (1:200); rabbit antic-Jun (1:200); goat anti-caspase-3 (1:200); and rabbit
anti-b-actin (1:200). After three washes with TBST, the
membranes were incubated for 1 hr with HRP-conjugated
donkey anti-rabbit, anti-mouse or anti-goat secondary
antibodies (1:1,000). Antigen-antibody interactions were
visualized with chemiluminescence (Pierce, Rockford, IL)
using Kodak X-AR film (Eastman Kodak, Rochester, NY).
Statistical Analysis
Data were expressed as means 6 standard deviation
(SD) and analyzed by one-way analysis of variance.
Identification of FLS
Fibroblast-like synoviocytes were isolated from knee
joints of the AA rats and cultured under permissive conditions. The cells were morphologically homogeneous
and exhibited the typical appearance of FLS with a bipolar configuration under inverse microscopy (after more
than three passages; Fig. 2a). The isolated FLS most
likely corresponded to the intimal subpopulation of FLS,
because they all expressed VCAM-1 as evaluated by flow
cytometry (FCM) analysis (94.2% VCAM-1-positive cells;
Fig. 2b). In contrast, phycoerythrin (PE) -conjugated
mouse IgG was positive only in 2.63% of the cultured
synoviocytes (Fig. 2c).
Effect of rhEndostatin on FLS Apoptosis
The effect of rhEndostatin on FLS apoptosis was
examined using the TUNEL assay method. The number
and signal density of TUNEL-positive cells were significantly increased in rats treated with rhEndostatin
(2.5 mg/kg; Fig. 3c). There were no TUNEL-positive cells
in negative control rats (Fig. 3a), while all the positive
control rats exhibited TUNEL-positive cells (Fig. 3b).
To further confirm that rhEndostatin induced apoptosis in AA FLS, the cells were treated with rhEndostatin
and detected by FCM. As shown in Figure 3e, rhEndostatin did indeed induce apoptosis in AA FLS. Specifically, the percentage of Annexin-positive cells was 6.67%
after treatment with rhEndostatin (25 mg/mL) for 48 hr,
compared with only 3.32% among untreated control cells
(Fig. 3d).
1033
ENDOSTATIN INDUCES AA FLS APOPTOSIS
Fig. 1. Induction of a rat adjuvant-induced arthritis model as evaluated by the appearance and histological features of joints from normal rats and rats immunized with CFA. a: Foot joints of a normal rat.
b: Foot joints of an adjuvant-induced arthritis model rat. The disease
in this model is a migratory polyarthritis primarily affecting the tarsal,
metatarsal and interphalangeal joints. After immunization with CFA,
the ankle joints of AA rats swell markedly over a period of 17 days.
c,d: Synovial histology of rat knee joints. Synovial tissue sections
were stained with hematoxylin and eosin (HE). The AA lining (d) shows
redundant folds of the synovial lining, intense infiltration of inflammatory cells and enhanced angiogenesis. Furthermore, the AA intimal lining layer (d) is hyperplastic, with ten or more layers of cells, compared
with a normal lining (c), which is one or two cell layers deep. Scale
bar 5 50 mm.
Fig. 2. Identification of FLS by their morphology and expression of
VCAM-1. a: After three passages, most of the cultured synoviocytes
are in a fibrocyte-like form with a long fusiform shape and grow in the
same direction. b: VCAM-1 is expressed by more than 94% of iso-
lated AA FLS, as detected by FCM analysis. c: Phycoerythrin (PE) conjugated mouse IgG is positive only in 2.63% of the cultured synoviocytes. PE-IgG, phycoerythrin (PE) -conjugated mouse IgG; SS, side
scatter. Scale bar 5 100 mm.
Effects of rhEndostatin on Expression of
Apoptotic Molecules in FLS
also analyzed by Western blotting. Recombinant human
endostatin treatment induced partial caspase-3 activation, as indicated by the significantly higher expression
of the 20-kDa cleavage product (p20) of caspase-3 compared with normal, AA and MTX-treated samples (P <
0.01; Fig. 5b). However, in three independent experiments, NFjB protein bands were observed in both AA
and rhEndostatin-treated groups (Fig. 5a). The difference between these bands was not significant (Fig. 5b).
To determine whether expression of Fas and c-jun in
FLS is due to pretranslational events, we performed
real-time PCR to quantify their mRNA levels in synovial
tissues. As shown in Figure 4c,d, the Fas and c-jun
mRNA expression levels were significantly increased by
rhEndostatin, compared with the levels in AA and normal control tissues (P < 0.01). The 48-kDa (p48) and
43-kDa (p43) protein bands, representing the subunits of
c-Jun, were detected by Western blot analysis (Fig. 5a).
Densitometric analysis indicated the intensities of both
the p48 and p43 protein bands in synovial tissues
treated with rhEndostatin were significantly higher
than those in normal, and AA and MTX-treated tissues,
respectively (P < 0.01; Fig. 5b). The expression of levels
of NFjB and caspase-3 proteins in synovial tissues were
DISCUSSION
Recent investigations have indicated that RA should
no longer be considered a benign disease. A considerable
amount of data suggests that this disease is associated
with diminished long-term survival (Finesilver, 2003).
Trials of different treatment strategies in animal models
of RA have shown that endostatin has therapeutic
1034
HUANG ET AL.
Fig. 3. Effect of rhEndostatin on FLS apoptosis. a–c: TUNEL analysis of rhEndostatin-induced apoptosis. a: Negative control. Terminal
transferase was omitted from the reaction mixture. None of the negative control cells show positive signals. b: Positive control. Cells were
permeabilized and incubated with DNase I (grade I) for 10 min at 15–
258C to induce DNA strand breaks. All the positive controls exhibit
positive signals. c: rhEndostatin (2.5 mg/kg)-induced apoptosis of AA
FLS. d,e: Annexin V-FITC/PI analysis for apoptosis. The percentage of
Annexin V-FITC-positive cells is 6.67% after treatment with rhEndostatin (25 mg/mL) for 48 hr (e), compared with only 3.32% among
untreated control cells (d). Scale bar 5 15 mm.
effects on RA by means of inhibition of angiogenesis and
proinflammatory factors (Kurosaka et al., 2003; Yue
et al., 2007). However, FLS are the ultimate target cells
of the pathologic changes of arthritis (Hui et al., 1997),
and there may be an imbalance between the growth and
death of FLS in RA, which leads to synovial hyperplasia
(Nishioka et al., 1998). Although abnormal proliferation
and/or persistence of FLS has long been described in
inflammatory arthritic conditions, substantial attention
has only relatively recently been drawn to the relevance
of abnormal apoptotic processes in disease pathogenesis
and treatment. A study by Pope (2002) revealed that
insufficient apoptosis represents at least one fundamental underlying process in RA. However, the issue of
whether endostatin can directly induce FLS apoptosis in
RA remains unclear. In the present study, AA was
induced in SD rats to imitate the clinical scenario of RA
and the effects of rhEndostatin on FLS apoptosis were
assessed in this experimental model. Although animal
models of arthritis only approximate RA, AA in rats is
among the most commonly used animal models for RA.
These rats provide a useful test system for evaluating
apoptosis-inducing therapies (Klareskog et al., 1995;
Oliver and Brahn, 1996). Our findings are the first to
reveal that rhEndostatin can induce apoptosis of FLS in
AA. These results suggest that rhEndostatin may play a
key regulatory role in the inhibition of rheumatoid synovial hyperplasia in vivo by means of induction of FLS
apoptosis.
Apoptosis can be initiated through death receptor- or
mitochondria-dependent
pathways.
However,
the
detailed intracellular mechanism of apoptosis in FLS is
ENDOSTATIN INDUCES AA FLS APOPTOSIS
1035
Fig. 4. Quantification of Fas and c-jun mRNA levels using an FTC2000 PCR instrument. a,b: Standard curves. a: Standard curve for
quantification of target Fas cDNA detected by qPCR using SYBR
Green I dye. r 5 0.99973; slope 5 23.3872; intercept 5 46.5234. b:
Standard curve for quantification of target c-jun cDNA detected by
qPCR using the TaqMan probe. r 5 0.99938; slope 5 23.3672; intercept 5 46.4281. c,d: Relative expression levels of Fas and c-jun
mRNAs. The target Fas and c-jun cDNA copy numbers were quantified by qPCR using the standard curves shown in panels (a) and (b).
The results are expressed as the fold increases of Fas and c-jun
mRNAs relative to b-actin and GAPDH mRNAs, respectively. Data are
presented as the mean 6 SD of three independent experiments. **P <
0.01 vs. the normal group. ##P < 0.01 vs. the AA control group.
still unknown. The death receptor-dependent pathway
has received the most attention in inflammatory arthritis, particularly RA (Peng, 2006). The major death receptors include Fas and TNFR. Our novel observation that
rhEndostatin increases Fas mRNA expression in AA synovial tissues suggests that Fas is up-regulated at the
transcriptional level in AA. In a previous study on RA
synovial tissues, expression of Fas protein was detected
in sub-lining layers and the majority of Fas-expressing
cells were FLS (Chou et al., 2001). Thus, the enhanced
expression of Fas in AA synovial tissues treated with
rhEndostatin in vivo suggests that rhEndostatin may
function to induce Fas-mediated apoptosis in FLS. Early
studies on Fas-mediated apoptosis suggested that caspase-3 is only required for the execution of death signals
triggered by caspase-8 at the site of initiation (Liu and
Pope, 2003; Itoh et al., 2004). Consistent with the previous study (Liu and Pope, 2003; Itoh et al., 2004), our
present results confirmed a significantly higher expression level of the 20-kDa cleavage product (p20) of caspase-3 in rhEndostatin-treated rats compared with AA
control rats. These results indicate that rhEndostatininduced apoptosis in AA FLS is strongly associated with
the expression of Fas and activation of caspase-3 (p20).
In addition, caspase-3 plays key regulatory roles in
TNFR-mediated apoptosis (Liu and Pope, 2003). Therefore, in the present study, we cannot conclude that
rhEndostatin only specifically induces Fas expression in
AA FLS, since no data for TNFR were obtained.
c-Jun, a prominent member of the AP-1 transcriptional factor family, has been implicated in the regulation of a wide range of biological processes including apoptosis, which it can promote or counteract depending
on the tissue, the developmental stage and the nature of
the death stimulus (Leppa and Bohmann, 1999; Shaulian and Karin, 2002). Its transcriptional activities are
regulated by changes in the level of c-jun expression as
well as posttranslational modifications of the c-Jun protein. An early report revealed that increased c-Jun activity is sufficient to trigger apoptotic cell death in NIH
3T3 fibroblasts (Bossy-Wetzel et al., 1997). Another
study by Kolbus et al. (2000) revealed that fibroblasts
with a targeted null mutation in c-jun exhibit a defect in
methyl methanesulfonate-induced apoptosis. c-Jun is
highly activated in RA FLS and synovium and regulated
at both the transcriptional and posttranslational levels
(Boyle et al., 1997; Han et al., 2001). Here, we found
that c-jun mRNA and c-Jun protein were overexpressed
in AA synovium treated with rhEndostatin compared
with AA control synovium. These data, together with
the previous finding described above, strongly suggest
that overexpression of c-Jun contributes to rhEndostatin-induced apoptosis in AA FLS. However, direct links
between c-Jun activity and the induction of specific initiators or executors of apoptosis have not yet been identified by functional means.
Early reports revealed that NF-jB is abundant in
rheumatoid synovium and plays diverse roles in the
1036
HUANG ET AL.
in contrast to c-jun mRNA and c-Jun protein. Taken together, these observations suggest that the p65 subunit
of NF-jB is not responsible for rhEndostatin-induced apoptosis in AA FLS.
In summary, increased proliferation and/or insufficient
apoptosis may contribute to the increased numbers of
FLS in RA joints. The invasive front of the synovium
forms a pannus that invades the cartilage of affected
joints. Therefore, a new therapeutic viewpoint for RA is
to stress the importance of further research regarding
the intracellular mechanism of FLS apoptosis. In the
present study, we have demonstrated that rhEndostatin
is sufficient to induce apoptosis in AA FLS. Although we
cannot exclude the involvement of molecules other than
Fas, caspase-3, c-Jun, and NF-jB, our results reveal
that Fas, caspase-3, and c-Jun play important roles in
rhEndostatin- induced cell death among AA FLS. These
results indicate that rhEndostatin may play a key regulatory role in the inhibition of rheumatoid synovial
hyperplasia in vivo by means of induction of FLS apoptosis, thereby suggesting that rhEndostatin should be
considered as a therapeutic agent for RA. In addition,
our results reveal that therapeutic strategies targeting
Fas, caspase-3 and c-Jun may be effective in diseases
such as RA.
ACKNOWLEDGMENTS
The authors thank Dr. Hao Li (The First Affiliated
Hospital, Anhui Medical University, Hefei, China) for assistance with the histopathology analysis. The authors
also thank Dr. Lei Zhang and Cheng-mu Hu (School of
Pharmacy, Anhui Medical University, Hefei, China) for
help with the induction of the experimental model of
rheumatoid arthritis.
Fig. 5. Expression levels of c-Jun, caspase-3 and NFjB proteins.
Total protein was extracted from synovial tissue lysates of the indicated groups and subjected to Western blot analysis. a: Western blot
analysis of the levels of c-Jun (p48), c-Jun (p43), caspase-3 (p20), and
NFjB proteins in synovial tissues. Expression of b-actin is included as
a control for protein loading. This image is representative of three
experiments. b: Histogram representing the relative expression levels
of the indicated proteins analyzed in panel (a). The results are
expressed as the fold increases in c-Jun, caspase-3 and NFjB proteins relative to b-actin protein. Data are presented as the mean 6 SD
of three independent experiments. **P < 0.01 versus the rhEndostatintreated group.
initiation and perpetuation of RA (Han et al., 1998;
Sioud et al., 1998; Chen et al., 1999; Campbell et al.,
2000). The main activated form of NF-jB is a heterodimer of the p65 subunit and either a p50 or p52 subunit, and immunohistochemical analyses demonstrated
that p50 and p65 NF-jB proteins are present in the
nuclei of cells in the synovial intimal lining. Activated
NF-jB is a common feature in human RA synovium and
various animal models of RA such as AA in rats. Previous studies have shown that NF-jB activation increases
the expression levels of inflammatory molecules in FLS
and protects cells against TNF-a and Fas ligand-induced
apoptosis. In vivo suppression of NF-jB enhanced apoptosis in the synovium of rats with experimentallyinduced arthritis (Chen et al., 1999; Campbell et al.,
2000). In the present study, we found that the p65 subunit of NF-jB was only weakly induced by rhEndostatin
LITERATURE CITED
Bendele A, McComb J, Gould T, McAbee T, Sennello G, Chlipala E,
Guy M. 1999. Animal models of arthritis: relevance to human disease. Toxicol Pathol 27:134–142.
Bossy-Wetzel E, Bakiri L, Yaniv M. 1997. Induction of apoptosis by
the transcription factor c-Jun. EMBO J 16:1695–1709.
Boyle DL, Han Z, Rutter JL, Brinckerhoff CE, Firestein GS. 1997.
Posttranscriptional regulation of collagenase-1 gene expression in
synoviocytes by adenosine receptor stimulation. Arthritis Rheum
40:1772–1779.
Campbell IK, Gerondakis S, O’Donnell K, Wicks IP. 2000. Distinct
roles for the NF-kappaB1 (p50) and c-Rel transcription factors in
inflammatory arthritis. J Clin Invest 105:1799–1806.
Chen F, Castranova V, Shi X, Demers LM. 1999. New insights into
the role of nuclear factor-kappaB, a ubiquitous transcription factor in the initiation of diseases. Clin Chem 45:7–17.
Chou CT, Yang JS, Lee MR. 2001. Apoptosis in rheumatoid arthritis–expression of Fas, Fas-L, p53, and Bcl-2 in rheumatoid synovial tissues. J Pathol 193:110–116.
Cui R, Ohashi R, Takahashi F, Yoshioka M, Tominaga S, Sasaki S,
Gu T, Takagi Y, Takahashi K. 2007. Signal transduction mediated
by endostatin directly modulates cellular function of lung cancer
cells in vitro. Cancer Sci 98:830–837.
Dhanabal M, Ramchandran R, Waterman MJ, Lu H, Knebelmann
B, Segal M, Sukhatme VP. 1999. Endostatin induces endothelial
cell apoptosis. J Biol Chem 274:11721–11726.
Ferreras M, Felbor U, Lenhard T, Olsen BR, Delaisse J. 2000. Generation and degradation of human endostatin proteins by various
proteinases. FEBS Lett 486:247–251.
Finesilver AG. 2003. Newer approaches to the treatment of rheumatoid arthritis. WMJ 102:34–37.
ENDOSTATIN INDUCES AA FLS APOPTOSIS
Han Z, Boyle DL, Manning AM, Firestein GS. 1998. AP-1 and NFkappaB regulation in rheumatoid arthritis and murine collageninduced arthritis. Autoimmunity 28:197–208.
Han Z, Boyle DL, Chang L, Bennett B, Karin M, Yang L, Manning
AM, Firestein GS. 2001. c-Jun N-terminal kinase is required for
metalloproteinase expression and joint destruction in inflammatory arthritis. J Clin Invest 108:73–81.
Hui A, Kulkarni GV, Hunter WL, McCulloch CA, Cruz TF. 1997.
Paclitaxel selectively induces mitotic arrest and apoptosis in proliferating bovine synoviocytes. Arthritis Rheum 40:1073–1084.
Itoh K, Hase H, Kojima H, Saotome K, Nishioka K, Kobata T. 2004.
Central role of mitochondria and p53 in Fas-mediated apoptosis
of rheumatoid synovial fibroblasts. Rheumatology (Oxford)
43:277–285.
Klareskog L, Ronnelid J, Holm G. 1995. Immunopathogenesis and
immunotherapy in rheumatoid arthritis: an area in transition. J
Intern Med 238:191–206.
Kolbus A, Herr I, Schreiber M, Debatin KM, Wagner EF, Angel P.
2000. c-Jun-dependent CD95-L expression is a rate-limiting step
in the induction of apoptosis by alkylating agents. Mol Cell Biol
20:575–582.
Kurosaka D, Yoshida K, Yasuda J, Yokoyama T, Kingetsu I, Yamaguchi N, Joh K, Matsushima M, Saito S, Yamada A. 2003. Inhibition of arthritis by systemic administration of endostatin in passive murine collagen induced arthritis. Ann Rheum Dis 62:677–
679.
Leppa S, Bohmann D. 1999. Diverse functions of JNK signaling and
c-Jun in stress response and apoptosis. Oncogene 18:6158–6162.
Liu H, Pope RM. 2003. The role of apoptosis in rheumatoid arthritis. Curr Opin Pharmacol 3:317–322.
Matsuno H, Yudoh K, Uzuki M, Nakazawa F, Sawai T, Yamaguchi
N, Olsen BR, Kimura T. 2002. Treatment with the angiogenesis
inhibitor endostatin: a novel therapy in rheumatoid arthritis.
J Rheumatol 29:890–895.
1037
Nishioka K, Hasunuma T, Kato T, Sumida T, Kobata T. 1998. Apoptosis in rheumatoid arthritis: a novel pathway in the regulation
of synovial tissue. Arthritis Rheum 41:1–9.
O’Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn
E, Birkhead JR, Olsen BR, Folkman J. 1997. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell
88:277–285.
Oliver SJ, Brahn E. 1996. Combination therapy in rheumatoid
arthritis: the animal model perspective. J Rheumatol Suppl 44:
56–60.
Padula SJ, Clark RB, Korn JH. 1986. Cell-mediated immunity in
rheumatic disease. Hum Pathol 17:254–263.
Peng SL. 2006. Fas (CD95)-related apoptosis and rheumatoid arthritis. Rheumatology (Oxford) 45:26–30.
Pope RM. 2002. Apoptosis as a therapeutic tool in rheumatoid arthritis. Nat Rev Immunol 2:527–535.
Shaulian E, Karin M. 2002. AP-1 as a regulator of cell life and
death. Nat Cell Biol 4:E131–E136.
Sioud M, Mellbye O, Forre O. 1998. Analysis of the NF-kappa B
p65 subunit, Fas antigen, Fas ligand and Bcl-2-related proteins
in the synovium of RA and polyarticular JRA. Clin Exp Rheumatol 16:125–134.
Wilson RF, Morse MA, Pei P, Renner RJ, Schuller DE, Robertson
FM, Mallery SR. 2003. Endostatin inhibits migration and invasion of head and neck squamous cell carcinoma cells. Anticancer
Res 23:1289–1295.
Yue L, Shen YX, Feng LJ, Chen FH, Yao HW, Liu LH, Wu Q, Wang
H. 2007. Blockage of the formation of new blood vessels by
recombinant human endostatin contributes to the regression of
rat adjuvant arthritis. Eur J Pharmacol 567:166–170.
Yue L, Wang H, Liu LH, Shen YX, Wei W. 2004. Anti-adjuvant arthritis of recombinant human endostatin in rats via inhibition of
angiogenesis and proinflammatory factors. Acta Pharmacol Sin
25:1182–1185.
Документ
Категория
Без категории
Просмотров
2
Размер файла
370 Кб
Теги
like, adjuvant, apoptosis, induced, recombinant, mechanism, synoviocyte, arthritis, endostatin, rats, human, fibroblasts
1/--страниц
Пожаловаться на содержимое документа