close

Вход

Забыли?

вход по аккаунту

?

Pathogenic role of the CXCL16CXCR6 pathway in rheumatoid arthritis.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 52, No. 10, October 2005, pp 3004–3014
DOI 10.1002/art.21301
© 2005, American College of Rheumatology
Pathogenic Role of the CXCL16–CXCR6 Pathway in
Rheumatoid Arthritis
Toshihiro Nanki,1 Takeshi Shimaoka,2 Kenji Hayashida,3 Ken Taniguchi,4
Shin Yonehara,2 and Nobuyuki Miyasaka1
Objective. Rheumatoid arthritis (RA) is a chronic
inflammatory disease associated with massive T cell
infiltration into the synovium. The accumulated T cells
express type 1 cytokines, such as interferon-␥ (IFN␥)
and tumor necrosis factor ␣, and activated markers of
inflammation, such as CD154 and inducible costimulator (ICOS). It is thought that chemokines contribute to
T cell accumulation in the synovium. In this study, we
examined the role of CXCL16 and CXCR6 in T cell
migration and stimulation in RA synovium.
Methods. Expression of CXCL16 and CXCR6
was analyzed by immunohistochemistry, reverse
transcription–polymerase chain reaction, Western blotting, and/or flow cytometry. Migration activity was
assessed using a chemotaxis chamber. IFN␥ production
was analyzed by enzyme-linked immunosorbent assay.
The effect of anti-CXCL16 monoclonal antibody on
murine collagen-induced arthritis (CIA) was evaluated.
Results. CXCL16 was expressed in RA synovium.
CXCR6 was expressed more frequently on synovial T
cells than in peripheral blood. Moreover, CXCR6positive synovial T cells more frequently expressed
CD154 and ICOS than did CXCR6-negative T cells.
Stimulation with interleukin-15 (IL-15) up-regulated
the expression of CXCR6 on peripheral blood T cells,
and then stimulation with CXCL16 induced migration
of IL-15–stimulated T cells and enhanced IFN␥ production. Furthermore, anti-CXCL16 monoclonal antibody
significantly reduced the clinical arthritis score and
reduced infiltration of inflammatory cells and bone
destruction in the synovium of mice with CIA.
Conclusion. Our results indicate that CXCL16
plays an important role in T cell accumulation and
stimulation in RA synovium and suggest that CXCL16
could be a target molecule in new therapies for RA.
Chemokines induce leukocyte migration and are
generally classified as either C, CC, CXC, or CX3C
chemokines, based on the conserved cysteine motifs (1).
The majority of chemokines are secreted as small,
soluble molecules. Two exceptional chemokines,
fractalkine/CX3CL1 and CXCL16, are expressed on the
cell surface as membrane-bound molecules (2–5).
Membrane-bound CXCL16 induces firm adhesion of
cells that express CXCR6 (6), a unique receptor for
CXCL16. The membrane-bound form of CXCL16 is
cleaved by ADAM-10 (7,8), and the cleaved soluble
form of CXCL16 induces migration of activated T cells
(4). It has been reported that CXCL16 is expressed on
dendritic cells, macrophages, B cells, T cells, smooth
muscle cells, and umbilical endothelial cells (4,5,9–11).
CXCL16 was also independently identified as a scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX) (9). In contrast, CXCR6 is expressed on a subset of type 1 polarized peripheral blood
T cells, natural killer (NK) T cells, NK cells, and B cells
(12–15). CXCL16/SR-PSOX is considered to play a
pathogenic role in atherogenesis (16,17), facilitation of
the uptake of various pathogens (18), and development
of inflammatory cardiac valvular disease (19) and experimental autoimmune encephalomyelitis (20).
Rheumatoid arthritis (RA) is characterized by
Supported in part by grants-in-aid from the Ministry of
Health, Labor, and Welfare and the Ministry of Education, Science,
Sports, and Culture, Japan.
1
Toshihiro Nanki, MD, Nobuyuki Miyasaka, MD: Tokyo
Medical and Dental University, Tokyo, Japan; 2Takeshi Shimaoka,
PhD, Shin Yonehara, PhD: Kyoto University, Kyoto, Japan; 3Kenji
Hayashida, MD: Hoshigaoka Koseinenkin Hospital, Osaka, Japan;
4
Ken Taniguchi, MD: Tokyo Metropolitan Bokutoh Hospital, Tokyo,
Japan.
Address correspondence and reprint requests to Toshihiro
Nanki, MD, Department of Medicine and Rheumatology, Graduate
School, Tokyo Medical and Dental University, 1-5-45, Yushima,
Bunkyo-ku, Tokyo 113-8519, Japan. E-mail: nanki.rheu@tmd.ac.jp.
Submitted for publication January 4, 2005; accepted in revised form June 23, 2005.
3004
PATHOGENIC ROLE OF CXCL16 IN RA
chronic inflammation of multiple joints. The affected
synovium shows accumulation of T cells, B cells, macrophages, and dendritic cells (21,22). It was previously
reported that synovial T cells are oligoclonally expanded
(23), suggesting that T cells are antigenically stimulated
in the synovium. Synovial T cells express mainly type 1
cytokines, such as interferon-␥ (IFN␥) and tumor necrosis factor ␣ (TNF␣) (24), and activated surface markers
such as CD154 and inducible costimulator (ICOS)
(25,26). Therefore, the accumulated synovial T cells
might play a role in the pathogenesis of RA. T cell
migration into the synovium is thought to involve the
interaction of chemokines and chemokine receptors,
and the roles of chemokines in RA have been analyzed
extensively (27).
The present study was designed to determine the
role of CXCL16 and CXCR6 in the pathogenesis of RA.
We observed abundant expression of CXCL16 and
accumulation of CXCR6-positive CD4 and CD8 T cells
in RA synovium compared with that in peripheral blood.
Furthermore, CXCL16 induced T cell migration and
enhanced IFN␥ production by IL-15–stimulated T cells.
Moreover, blockade of CXCL16 reduced the severity of
collagen-induced arthritis (CIA) in mice. These results
indicate that the CXCL16–CXCR6 interaction may play
an important role in T cell accumulation and stimulation
in RA synovium, suggesting that CXCL16 could be a
potentially useful therapeutic target in RA.
MATERIALS AND METHODS
Samples. All subjects provided informed consent. Peripheral blood samples were obtained from 6 female patients
with RA, which was diagnosed according to the 1987 criteria of
the American College of Rheumatology (formerly, the American Rheumatism Association) (28). Among the patients with
RA, the mean ⫾ SEM age was 63.2 ⫾ 4.1 years, and the
mean ⫾ SEM disease duration was 12.5 ⫾ 2.0 years. All 6
patients were seropositive for rheumatoid factor and had a
mean ⫾ SEM C-reactive protein concentration of 3.8 ⫾ 0.7
mg/dl. Four of the patients with RA were receiving prednisolone, 5 were receiving methotrexate, 2 were being treated
with sulfasalazine, and 1 was receiving D-penicillamine. Synovial tissue samples from patients with RA and patients with
osteoarthritis (OA) were obtained at the time of total knee
joint replacement surgery (signed consent forms were obtained
before the operations). The experimental protocol was approved in advance by the ethics committee of the Tokyo
Medical and Dental University.
Immunohistochemical analysis. Immunohistochemical
analysis was conducted on OCT compound–embedded sections of frozen synovial tissue. Briefly, 8-␮m–thick cryostat
sections were fixed in 4% paraformaldehyde for 10 minutes,
and then the samples were rehydrated in phosphate buffered
saline (PBS) for 5 minutes, 3 times. Nonspecific binding was
3005
blocked with 1.5% H2O2 in methanol for 15 minutes, and then
with 5% normal goat serum in PBS for 30 minutes. Serial
sections were then incubated overnight at 4°C with rabbit
polyclonal antiserum against human CXCL16 (9) or normal
rabbit serum as a control. The incubation included 5% normal
goat serum in PBS. The samples were then washed twice for 5
minutes in PBS, and expression was detected using the Envision⫹ kit (DakoCytomation, Carpinteria, CA). Sections were
counterstained with hematoxylin for 5 seconds and washed in
tap water for 10 minutes.
Immunocytochemical analysis. Synovial tissue was
minced and then incubated with 0.3 mg/ml of collagenase
(Sigma, St. Louis, MO) for 1 hour at 37°C in Dulbecco’s
modified Eagle’s medium (DMEM; Sigma). Partially digested
pieces of tissue were pressed through a metal screen to obtain
single-cell suspensions. In the next step, 1 ⫻ 105 cells were
cultured overnight on 4-well chamber slides (Lab-Tek II
Chamber Slide System; Nalge Nunc International, Naperville,
IL). The chamber slides were fixed in 4% paraformaldehyde
for 20 minutes, and then the samples were rehydrated in PBS
for 5 minutes, 3 times. Nonspecific binding was blocked with
nonfat milk for 60 minutes. The slides were incubated for 2
hours at room temperature with chicken anti-human CXCL16
IgY (GenWay Biotech, San Diego, CA) or normal chicken IgY
as a control antibody at 61.5 ␮g/ml in PBS–0.2% nonfat milk.
The samples were then washed twice for 5 minutes in PBS–
0.2% nonfat milk and incubated with Alexa Fluor
488–conjugated goat anti-chicken IgY (Molecular Probes,
Eugene, OR) at 20 ␮g/ml for 1 hour at room temperature.
Next, the slides were incubated with 10% normal goat serum in
PBS for 60 minutes.
For staining with CD68 or prolyl 4-hydroxylase, after
washing twice in PBS for 5 minutes the slides were incubated
with mouse anti-human CD68 monoclonal antibody (mAb)
(KP1; DakoCytomation) at 15.6 ␮g/ml, mouse anti-human
prolyl 4-hydroxylase mAb (5B5; DakoCytomation) at 6.2 ␮g/
ml, or mouse IgG1 for 2 hours. Subsequently, the samples were
washed twice for 5 minutes in PBS and incubated with Alexa
Fluor 647–conjugated goat anti-mouse IgG1 (Molecular
Probes) at 20 ␮g/ml for 1 hour at room temperature. The slides
were examined using fluorescence microscopy (FluoView 300;
Olympus, Tokyo, Japan). The number of Alexa Fluor 488–
labeled CXCL16-positive cells among Alexa Fluor 647–labeled
CD68-positive or prolyl 4-hydroxylase–positive cells was
counted.
CXCL16 expression on fibroblast-like synoviocytes
(FLS). FLS were obtained from RA synovial tissue, as described previously (29). FLS were maintained in high-glucose
DMEM with 10% fetal calf serum (FCS; Sigma) and used for
experiments after 5 passages. RA FLS were cultured separately in 60-mm culture dishes at a density of 8 ⫻ 105 cells/well
in DMEM with 10% FCS for 24 hours. The cells were then
incubated in a medium supplemented, as indicated, with TNF␣
(5 ng/ml), interleukin-1␤ (IL-1␤; 5 ng/ml), IFN␥ (5,000 units/
ml), IL-18 (5 ng/ml), transforming growth factor ␤1 (TGF␤1; 1
ng/ml), or IL-10 (5 ng/ml) (PeproTech, Rocky Hill, NJ).
After incubation at 37°C for 24 hours, total RNA was
prepared from RA FLS using Isogen (Qiagen, Valencia, CA)
and treated with DNase I (Invitrogen, Carlsbad, CA). Firststrand complementary DNA (cDNA) was synthesized using
oligo(dT)12-18 primers (Amersham Pharmacia Biotech, Piscat-
3006
away, NJ) and SuperScript II reverse transcriptase (Invitrogen).
The amount of cDNA for amplification was adjusted to the
amount of RNA measured by optical density meter as well as
␤-actin polymerase chain reaction (PCR) products, using
serially diluted cDNA. The cDNA was amplified with primers
for CXCL16 (5⬘-CTGACTCAGCCAGGCAATGG and 3⬘TGAGTGGACTGCAAGGTGGA) or ␤-actin (5⬘-GTCCTCTCCCAAGTCCACACA and 3⬘-CTGGTCTCAAGTCAGTGTACAGGTAA). The PCR conditions have been
described previously (30). The PCR products were then separated by electrophoresis through 1.5% agarose.
After incubation at 37°C for 3 days, FLS were collected
and lysed with extraction buffer (20 mM HEPES, 150 mM
NaCl, 1% Triton X-100, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 10 ␮g/ml leupeptin, and 10 ␮g/ml aprotinin).
Synovial tissue obtained from patients with RA and patients
with OA were also lysed with the extraction buffer. After 30
minutes at 4°C, debris was eliminated by centrifugation at
14,000 rpm for 30 minutes, and the supernatant was collected.
After measuring the protein concentration with a protein assay
kit (Bio-Rad, Richmond, CA), cell lysates were mixed with 6⫻
sample loading buffer containing 6% 2-methoxyestradiol and
10% sodium dodecyl sulfate (SDS), and stored at 4°C until
analyzed.
Twenty micrograms of protein was separated by 10%
SDS–polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes, and blocked overnight with
0.05% Tween 20 and 5% bovine serum albumin (BSA). The
immunoblots were incubated with rabbit polyclonal antiserum
against human CXCL16 (9) in PBS with 1% BSA for 1 hour.
Subsequently, the immunoblots were incubated with horseradish peroxidase (HRP)–conjugated goat anti-rabbit IgG antibody (DakoCytomation) for 1 hour. The ␤-actin protein was
detected by anti–␤-actin mAb (AC-15; Sigma) as first antibody
and HRP-conjugated rabbit anti-mouse IgG antibody (DakoCytomation) as second antibody. All immunoblots were detected by enhanced chemiluminescence (Amersham Pharmacia Biotech). Signal intensities were quantified with NIH
Image 1.63 (National Institutes of Health, Bethesda, MD), and
the relative intensity of CXCL16 (the signal intensity of
CXCL16 protein divided by the signal intensity of ␤-actin
protein) was calculated. The fold increase in the relative
intensity of CXCL16 protein (the relative intensity of CXCL16
with cytokine stimulation divided by the relative intensity of
CXCL16 without stimulation) was calculated.
Fluorescence-activated cell sorting (FACS) analysis.
The following antibodies were used for FACS analysis: phycoerythrin (PE) Cy5–conjugated anti-CD4 mAb (13B8.2; Beckman Coulter, San Jose, CA), PE Cy5–conjugated anti-CD8
mAb (B9.11; Beckman Coulter), PE-conjugated anti-CXCR6
mAb (56811; R&D Systems, Minneapolis, MN), fluorescein
isothiocyanate (FITC)–conjugated anti-CD154 mAb (24-31;
eBioscience, San Diego, CA), FITC-conjugated anti-ICOS
mAb (ISA-3; eBioscience), and isotype-matched control mAb.
Peripheral blood mononuclear cells or synovial tissue cells
were incubated with mAb for 20 minutes and rinsed with
PBS–3% FCS. The stained cells were analyzed with a FACSCalibur (Becton Dickinson, San Jose, CA).
Migration and stimulation by CXCL16. Peripheral
blood mononuclear cells were isolated by Ficoll-Hypaque
(Immuno-Biological Laboratories, Gunma, Japan) gradient
NANKI ET AL
centrifugation. Peripheral blood CD4 and CD8 T cells were
purified by magnetic-activated cell sorting microbead-coupled
mAb and magnetic cell separation columns (Miltenyi Biotec,
Auburn, CA). The purified CD4 and CD8 T cells were
incubated with 30 ng/ml of IL-15 (PeproTech) for 8 days in
RPMI 1640 (Sigma) containing 10% FCS.
Migration of the T cells through ECV304 cells was
conducted as described previously (31). Briefly, 2 ⫻ 105
ECV304 cells were cultured in 24-well chemotaxis chambers
(6.5-mm diameter, 5-␮m pore polycarbonate transwell culture
insert; Costar, Cambridge, MA) for 48–72 hours in Medium
199 (Sigma) with 10% FCS. The migration medium (RPMI
1640:Medium 199 ⫽ 1:1; 0.5% BSA), supplemented where
indicated with various concentrations of CXCL16 (PeproTech), was added to the lower wells. ECV304 cell–coated
chemotaxis chambers were placed in each well, and 5 ⫻ 105
IL-15–stimulated CD4 or CD8 T cells suspended in migration
medium were added to the upper wells. After a 2-hour
incubation, the membrane was removed, the number of migrated cells was counted using FACSCalibur, and the migration index (the number of migrated cells divided by the number
of cells that migrated without CXCL16) was calculated.
IL-15–stimulated CD4 and CD8 T cells (2 ⫻ 105) were
transferred to 96-well microtiter plates, which were precoated
with anti-CD3 mAb (500 ng OKT3; Janssen Pharmaceutical,
Tokyo, Japan) and CXCL16 (0, 2.5, or 25 pg per microwell),
and supplemented where indicated with soluble CXCL16 (150
ng/ml). After incubation at 37°C for 24 hours, the concentration of IFN␥ in the culture supernatant was measured using an
enzyme-linked immunosorbent assay (ELISA) kit (BioSource
International, Camarillo, CA), and the fold increase in the
IFN␥ concentration (the concentration of IFN␥ in the culture
supernatant divided by the concentration of IFN␥ without
CXCL16) was calculated.
Induction of CIA. Eight-week-old male DBA1/J mice
were purchased from Oriental Yeast (Tokyo, Japan). Bovine
type II collagen (Collagen Research Center, Tokyo, Japan)
was dissolved in 0.05M acetic acid at 4 mg/ml and emulsified in
an equal volume of Freund’s complete adjuvant (Difco, Detroit, MI). Mice were immunized intracutaneously with 100 ␮l
of the emulsion (day 1). After 21 days (day 22), the same
amount of bovine type II collagen emulsified in Freund’s
complete adjuvant was injected as a booster immunization.
The experimental protocol was approved by the Institutional
Animal Care and Use Committee of Tokyo Medical and
Dental University.
The expression of CXCL16 and CXCR6 in tissue
specimens obtained from around the ankle joints of mice
with CIA was analyzed using reverse transcription (RT)–PCR,
as described above. The primers used were as follows: for
CXCL16, 5⬘-GGGAAGAGTTTTCACCACCA and 3⬘-GGTTGGGTGTGCTCTTTGTT; for CXCR6, 5⬘-GCTTGCTCATTTGGGTGGTC and 3⬘-TCTGGGTCAGCAGGAACACA; and for GAPDH, 5⬘-ACCCAGAAGACTGTGGATGG
and 3⬘-GTCATCATCCTTGGCAGGTT. CXCL16 expression
was also analyzed by Western blotting, as described above. Rat
anti-mouse CXCL16 mAb (142417; R&D Systems) was used as
first antibody, and anti-rat IgG–HRP (DakoCytomation) was
used as second antibody. Expression of ␤-actin as a loading
control was also analyzed, as described above.
PATHOGENIC ROLE OF CXCL16 IN RA
3007
Figure 1. Expression of CXCL16 in rheumatoid arthritis (RA) synovium. A–C, Synovial tissue
samples obtained from 6 patients with RA were stained with polyclonal antiserum against human
CXCL16 (A and C) or with normal rabbit serum as a control (B). All sections were counterstained
with hematoxylin. Photomicrographs representative of those with similar staining patterns are
shown (original magnification ⫻ 100 in A and B; ⫻ 200 in C). D and E, Single-cell suspensions from
RA synovial tissue were cultured overnight on 4-well chamber slides. The slides were double
stained for CD68, a macrophage marker (D), or prolyl 4-hydroxylase, a fibroblast marker (E), and
CXCL16, and analyzed with fluorescence microscopy. Representative staining results from 4
patients with RA (original magnification ⫻ 200) are shown. F, The number of CXCL16-positive
cells among CD68-positive or prolyl 4-hydroxylase–positive cells in samples from 4 patients with
RA was counted. The numbers of CXCL16-positive cells/numbers of counted CD68-positive or
prolyl 4-hydroxylase–positive cells are shown. G, The expression of CXCL16 in synovial tissue
obtained from 6 patients with RA and 3 patients with osteoarthritis (OA) was analyzed by Western
blotting.
Treatment with anti-mouse CXCL16 mAb. Five hundred micrograms of rat anti-mouse CXCL16 mAb (20) or
control antibody (rat IgG; ICN Pharmaceuticals, Aurora, OH)
was injected into the peritoneal cavity of mice 3 times weekly,
from day 15 to day 39. Anti-mouse CXCL16 mAb inhibited
migration of murine CXCR6-expressed L1.2 cells induced by
murine CXCL16 (20). Mice were observed for signs of arthritis. Disease severity for each limb was recorded as follows: 0 ⫽
normal, 1 ⫽ erythema and mild swelling confined to the
midfoot (tarsal joints) or ankle joint, 2 ⫽ erythema and mild
swelling extending from the ankle to the midfoot, 3 ⫽ erythema and moderate swelling extending from the ankle to the
metatarsal joint, and 4 ⫽ erythema and severe swelling of the
ankle, foot, and digits. The clinical arthritis score was defined
as the sum of the scores for all 4 paws of each mouse. On day
41, the thickness of the hind paw was measured.
On days 18, 27, and 41, the ankle joints were harvested
and examined histologically, after hematoxylin and eosin staining. The severity of arthritis was evaluated using the following
2 parameters: synovial inflammation (0 ⫽ normal, 1 ⫽ focal
inflammatory infiltrates, and 2 ⫽ inflammatory infiltrate that
dominates the cellular histology) and bone destruction (0 ⫽
normal, 1 ⫽ small areas of bone destruction, 2 ⫽ widespread
bone destruction), as described previously (32,33).
3008
NANKI ET AL
Figure 2. Expression of CXCL16 on rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS). RA FLS were incubated
in 60-mm dishes with tumor necrosis factor ␣ (TNF␣; 5 ng/ml), interleukin-1␤ (IL-1␤; 5 ng/ml), interferon-␥ (IFN␥; 5,000
units/ml), IL-18 (5 ng/ml), transforming growth factor ␤1 (TGF␤1; 1 ng/ml), or IL-10 (5 ng/ml). After a 24-hour stimulation,
the expression of CXCL16 mRNA was analyzed using reverse transcription–polymerase chain reaction (PCR). A, PCR
products were separated by electrophoresis through 1.5% agarose. B, After a 3-day stimulation, cell lysates were analyzed
by Western blotting with antiserum against CXCL16. Representative results from 2–3 independent experiments are shown.
C, Signal intensities of CXCL16 protein were normalized to those of ␤-actin protein, and the fold increase in relative
CXCL16 intensities was calculated. Top, Relative CXCL16 intensity with cytokine stimulation divided by the relative
CXCL16 intensity without stimulation. Bottom, Relative CXCL16 intensity with TGF␤1 ⫹ TNF␣ or IL-1␤ stimulation
divided by the relative CXCL16 intensity with TNF␣ or IL-1␤ stimulation alone. Values are the mean ⫾ SEM. ⴱ ⫽ P ⬍
0.05.
Statistical analysis. Wilcoxon’s signed rank test was
used to compare paired samples of peripheral blood and
synovium from the same subjects for the expression of
CXCR6, CD154, and ICOS on CD4 and CD8 T cells; the
expression of CD154 and ICOS on CXCR6-negative versus
CXCR6-positive synovial CD4 and CD8 T cells; and the
expression of CXCR6 with versus without IL-15 stimulation.
Differences in the migration index and IFN␥ production
induced by CXCL16 stimulation and in the arthritis score and
histologic score between control antibody– and anti-mouse
CXCL16 mAb–treated mice were examined for statistical
significance using the Mann-Whitney U test. All data are
expressed as the mean ⫾ SEM. P values less than 0.05 were
considered significant.
RESULTS
Expression of CXCL16 in RA synovium. The
expression of CXCL16 in synovial tissue from patients
with RA was assessed by immunohistochemical analysis.
CXCL16 expression was widespread in all of the RA
synovium samples analyzed, with dense staining of the
synovial lining cells and moderate staining of the sublining cells (Figures 1A and C). To identify CXCL16expressing synoviocytes, a single-cell suspension of RA
synoviocytes was cultured overnight on chamber slides.
The cells were then double stained for CXCL16 and
CD68, a macrophage marker, or prolyl 4-hydroxylase, a
fibroblast marker. Both CD68-positive macrophage-like
synoviocytes and prolyl 4-hydroxylase–positive FLS expressed CXCL16 (Figures 1D and E). The frequency of
CXCL16-positive cells in macrophage-like synoviocytes
or FLS from 4 patients with RA was analyzed. On
average, 43% of macrophage-like synoviocytes and 49%
of FLS expressed CXCL16 (Figure 1F).
We next compared the expression level of
CXCL16 in synovial tissue from patients with RA and
patients with OA. CXCL16 was highly expressed in RA
synovium compared with OA synovium, in which it was
weakly expressed (Figure 1G). In order to examine the
effect of cytokine stimulation on the expression of
CXCL16, the expression of CXCL16 messenger RNA
(mRNA) and protein on RA FLS was analyzed using
RT-PCR and Western blotting. FLS were stimulated
with TNF␣, IL-1␤, IFN␥, IL-18, TGF␤1, or IL-10, all of
which are expressed in RA synovium. CXCL16 was
expressed on unstimulated FLS in vitro. Stimulation
with TNF␣ and IL-1␤ significantly up-regulated the
expression of CXCL16 mRNA (Figure 2A) and protein
(Figures 2B and C). In contrast, stimulation with TGF␤1
down-regulated the expression of CXCL16. Moreover,
PATHOGENIC ROLE OF CXCL16 IN RA
Figure 3. Expression of CXCR6 on CD4 and CD8 T cells. A, The
proportion of CXCR6-expressing CD4 and CD8 T cells in peripheral
blood (PB) and synovium (SY) was assessed by fluorescence-activated
cell sorting (FACS) (n ⫽ 6 samples). B, The proportion of CD154expressing and inducible costimulator (ICOS)–expressing CXCR6negative and CSCR6-positive synovial CD4 and CD8 T cells was
analyzed by FACS (n ⫽ 6). Each symbol represents an individual
subject.
TGF␤1 decreased the expression of CXCL16 on TNF␣and IL-1␤–stimulated FLS. Stimulation with IFN␥, IL18, and IL-10 did not change the expression of CXCL16.
These results indicate that macrophage-like synoviocytes
and FLS in RA synovium express CXCL16, and that the
production of CXCL16 by FLS is regulated by TNF␣,
IL-1␤, and TGF␤1.
3009
Expression of CXCR6 by CD4 and CD8 T cells.
The expression of CXCR6 on peripheral blood and
synovial CD4 and CD8 T cells from patients with RA
was analyzed by flow cytometry. A few peripheral blood
CD4 and CD8 T cells expressed CXCR6. The proportion of CXCR6-positive CD4 and CD8 T cells in synovium was significantly higher than the proportion of
these cells in peripheral blood (Figure 3A).
It was previously reported that activated T cells
express CD154 and ICOS (34,35). We used flow cytometry to analyze CD154 and ICOS expression on peripheral blood and synovial CD4 and CD8 T cells from
patients with RA. Few peripheral blood CD4 and CD8 T
cells expressed CD154 (mean ⫾ SEM 0.4 ⫾ 0.2% and
1.5 ⫾ 0.6%, respectively; n ⫽ 6 samples) and ICOS
(0.8 ⫾ 0.2% and 0.9 ⫾ 0.3%, respectively; n ⫽ 6). In
contrast, synovial CD4 and CD8 T cells more frequently
expressed CD154 (mean ⫾ SEM 14.4 ⫾ 4.6% and
14.5 ⫾ 5.2%, respectively [P ⬍ 0.05]; n ⫽ 6) and ICOS
(15.3 ⫾ 2.4% and 10.8 ⫾ 2.2%, respectively [P ⬍ 0.05];
n ⫽ 6) compared with peripheral blood CD4 and CD8 T
cells.
To analyze the association between CXCR6 and
the expression of CD154 or ICOS, we compared the
proportions of CD154-expressing and ICOS-expressing
CXCR6-negative and CXCR6-positive synovial CD4
and CD8 T cells. The proportions of CD154-expressing
and ICOS-expressing CXCR6-positive CD4 and CD8 T
cells were significantly higher than the proportions of
CXCR6-negative CD4 and CD8 T cells, respectively
(Figure 3B). These results showed that CXCR6 was
more frequently expressed on synovial T cells, and that
in RA synovium, CXCR6-positive T cells might be more
activated than CXCR6-negative T cells.
T cell stimulation by CXCL16. Previous studies
demonstrated the expression of IL-15 on synoviocytes
and synovial endothelial cells in RA (36,37). Although a
few peripheral blood T cells expressed CXCR6 (Figure
3A), stimulation with 30 ng/ml of IL-15 for 8 days
significantly increased CXCR6 expression in vitro (for
CD4, mean ⫾ SEM 30.2 ⫾ 6.5%; for CD8, 16.9 ⫾ 1.4%
[P ⬍ 0.05]; n ⫽ 5) compared with expression without
IL-15 stimulation (for CD4, 4.0 ⫾ 1.0%; for CD8, 7.1 ⫾
2.0%; n ⫽ 5); these findings are similar to those previously reported (38). Although IL-15 stimulation upregulated CXCR6 expression by both CD154-negative
and CD154-positive CD4 and CD8 T cells (for CD4,
mean ⫾ SEM 18.1 ⫾ 5.7% and 32.8 ⫾ 10.5%, respectively; for CD8, 14.9 ⫾ 0.9% and 42.1 ⫾ 7.8%, respectively [P ⬍ 0.05]; n ⫽ 3) compared with unstimulated T
cells (for CD4, 0.5 ⫾ 0.1% and 2.0 ⫾ 2.0%, respectively;
3010
Figure 4. CXCL16-induced T cell migration and stimulation. A, Peripheral blood CD4 and CD8 T cells were stimulated with
interleukin-15 (IL-15) for 8 days. Next, the T cells were cultured with
various concentrations of CXCL16 for 2 hours. The number of cells
migrating through ECV304-coated transwells was assessed by
fluorescence-activated cell sorting. The migration index (the number
of cells that migrated divided by the number of cells without CXCL16
that migrated) for 4 donors was calculated. B, IL-15–stimulated CD4
and CD8 T cells were transferred to microtiter plates coated with 500
␮g of anti-CD3 monoclonal antibody and various amounts of CXCL16,
and were cultured with or without soluble CXCL16 for 24 hours. The
interferon-␥ (IFN␥) concentration in the culture supernatant was
analyzed by enzyme-linked immunosorbent assay. The fold increase in
the IFN␥ concentration (IFN␥ concentration divided by the concentration of IFN␥ without CXCL16) for 3–5 donors was calculated.
Values are the mean ⫾ SEM. ⴱ ⫽ P ⬍ 0.05.
for CD8, 1.7 ⫾ 0.3% and 5.4 ⫾ 2.5%, respectively; n ⫽
3), IL-15-stimulated CXCR6-positive T cells expressed
CD154 more frequently than IL-15-stimulated CXCR6negative T cells (for CD4, mean ⫾ SEM 3.0 ⫾ 1.2% and
17.4 ⫾ 6.1%, respectively; for CD8, 0.4 ⫾ 0.3% and
3.2 ⫾ 0.5%, respectively [P ⬍ 0.05]; n ⫽ 3).
Similarly, CXCR6 expression was also upregulated by both ICOS-negative and ICOS-positive
CD4 and CD8 T cells (for CD4, mean ⫾ SEM 20.3 ⫾
7.6% and 59.4 ⫾ 8.3%, respectively; for CD8, 15.7 ⫾
1.0% and 56.1 ⫾ 6.7%, respectively [P ⬍ 0.05]; n ⫽ 3)
compared with unstimulated T cells (for CD4, 0.4 ⫾
0.2% and 1.6 ⫾ 1.6%, respectively; for CD8, 1.7 ⫾ 0.5%
and 0.0 ⫾ 0.0%, respectively; n ⫽ 3). Stimulated CXCR6positive T cells expressed ICOS more frequently than did
CXCR6-negative T cells (for CD4, 16.2 ⫾ 1.5% and 30.4 ⫾
4.1%, respectively; for CD8, 0.8 ⫾ 0.6% and 3.4 ⫾ 0.7%,
respectively [P ⬍ 0.05]; n ⫽ 3).
NANKI ET AL
In order to analyze the functional effects of
CXCL16 on IL-15–stimulated CXCR6-positive T cells,
we analyzed the effects of CXCL16 on migration activity
and IFN␥ production. Soluble CXCL16 induced the
migration of both peripheral blood CD4 T cells and
peripheral blood CD8 T cells, which were cultured with
IL-15 for 8 days (Figure 4A). Without stimulation of
precoated anti-CD3 mAb during ELISA, IL-15–
stimulated CD4 or CD8 T cells did not produce IFN␥
when incubated with soluble CXCL16 or precoated
CXCL16. Although stimulation with anti-CD3 mAb
induced IFN␥ production by IL-15–stimulated CD4 and
CD8 T cells, culture with soluble CXCL16 did not
change the level of IFN␥ production by the cells. However, culture in wells precoated with CXCL16 enhanced
IFN␥ production by anti-CD3 mAb-stimulated peripheral blood CD4 and CD8 T cells stimulated with IL-15
(Figure 4B). Soluble CXCL16 blocked the enhancement
of IFN␥ production by precoated CXCL16. These results suggest that peripheral blood T cells could respond
to stimulation by IL-15 in the synovium. Stimulation
with IL-15 up-regulates CXCR6 expression, and
CXCL16 induces migration and enhances IFN␥ production by CXCR6-positive T cells.
Effect of anti-mouse CXCL16 mAb on mice with
CIA. We first analyzed the expression of CXCL16 and
CXCR6 in the synovium of mice with CIA. The expression of CXCL16 was higher in synovium from mice with
CIA compared with that in synovium from normal mice
(Figures 5A and B). Furthermore, the expression of
CXCR6 mRNA was also up-regulated in synovium from
mice with CIA (Figure 5A). In order to analyze the
effect of inhibition of the CXCL16–CXCR6 interaction
on mice with CIA, 500 ␮g of anti-mouse CXCL16 mAb
or control antibody was injected into the peritoneal
cavity 3 times per week, from day 15 to day 39.
Clinical scores for arthritis were recorded. Treatment
with anti-CXCL16 mAb significantly reduced the clinical arthritis score compared with treatment with
control antibody (Figure 5C). On day 41, the thickness
of the hind paw was measured. The paw thickness was
also significantly suppressed by treatment with antiCXCL16 mAb compared with control antibody treatment (Figure 5D).
Finally, on day 18, day 27, and day 41 the ankle
joints were harvested, stained with eosin and hematoxylin, and examined microscopically. On day 18, mild focal
inflammatory infiltrates were observed in joints from a
few mice, without a significant difference between the
mice treated with anti-CXCL16 mAb and those that
PATHOGENIC ROLE OF CXCL16 IN RA
3011
Figure 5. Expression of CXCL16 and CXCR6 in mice with collagen-induced arthritis (CIA), and inhibition of clinical
arthritis in mice with CIA by treatment with anti-CXCL16 monoclonal antibody (mAb). A and B, The expression of
CXCL16 and CXCR6 mRNA in synovium from 3 normal mice and 3 mice with CIA was analyzed by reverse
transcription–polymerase chain reaction (PCR). PCR products were separated by electrophoresis through 1.5% agarose
(A), and the expression of CXCL16 in the synovium was analyzed by Western blotting with anti-CXCL16 antibody (Ab) (B).
C and D, Five hundred micrograms of rat anti-mouse CXCL16 mAb or control antibody was injected into the peritoneal
cavity 3 times per week from day 15 to day 39. Disease severity was recorded as an arthritis score until day 41 (C), and hind
paw thickness was measured on day 41 (D). Values are the mean ⫾ SEM of 20 animals in 2 separate experiments.
ⴱ ⫽ P ⬍ 0.05; ⴱⴱ ⫽ P ⬍ 0.01.
received control antibody treatment (Figures 6A and B).
On day 27, mild-to-moderate mononuclear cell infiltration was observed in the joints from some mice (Figures
6C and D). Treatment with anti-CXCL16 mAb tended
to reduce the histology score compared with control
antibody treatment, although the difference was not
statistically significant (Figure 6G). On day 41, the joints
from control antibody–treated mice showed massive
mononuclear cell infiltration and bone destruction (Figure 6E). In comparison, the joints from mice treated
with anti-CXCL16 mAb showed milder histologic
changes (Figure 6F). Analysis of the histology scores
indicated that anti-CXCL16 mAb treatment significantly
reduced both synovial inflammation and bone destruction in the ankle joint (Figures 6G and H). These results
indicate that treatment with anti-CXCL16 mAb reduces
the clinical arthritis score and histologic changes in mice
with CIA.
DISCUSSION
The major findings of the present study were as
follows: 1) expression of CXCL16 was abundant in
synovium from patients with RA, 2) the proportion of
CXCR6-positive CD4 and CD8 T cells in the synovium
was higher than the proportion in peripheral blood, 3)
the expression of CXCR6 on peripheral blood T cells
was up-regulated by stimulation with IL-15, 4) CXCL16
induced migration of T cells and enhanced IFN␥ production by IL-15–stimulated T cells, and 5) blockade of
3012
Figure 6. Histologic changes induced by treatment with anti-CXCL16
monoclonal antibody (mAb). A–F, Ankle joints harvested on day 18 (A
and B), day 27 (C and D), and day 41 (E and F) were stained with
hematoxylin and eosin. Representative photomicrographs from mice
treated with control antibody (A, C, and E) and mice treated with
anti-CXCL16 mAb (B, D, and F) are shown. Mononuclear cell (MC)
infiltration and bone erosion (BE) are indicated. (Original magnification ⫻ 40.) G, Scores for synovial inflammation. H, Scores for bone
destruction. Values are the mean ⫾ SEM scores in 7–20 samples.
ⴱ ⫽ P ⬍ 0.05.
CXCL16–CXCR6 interaction ameliorated murine CIA.
These results indicate that CXCL16 may play an important role in T cell migration and stimulation in the
synovium of patients with RA.
The proportion of CXCR6-positive CD4 and
CD8 T cells in RA synovium was higher than that in
peripheral blood. Synovial CXCR6-positive CD4 and
NANKI ET AL
CD8 T cells, respectively, expressed CD154 and ICOS,
which are markers of T cell activation, more frequently
than did CXCR6-negative CD4 and CD8 T cells. Moreover, previous studies showed that CXCR6 was expressed by peripheral blood memory T cells, which could
express type 1 cytokines (12). Taken together, these
results indicate that CXCL16 could induce migration of
CXCR6-positive T cells (which are activated, memory,
and type 1 cytokine–producing T cells) from peripheral
blood into synovial tissue. It is also possible that migrated CD4 and CD8 T cells are stimulated with IL-15,
which is expressed in the RA synovium (36,37), and then
express CXCR6. Consequently, CXCL16 could retain
the CXCR6-positive CD4 and CD8 T cells in the
synovial tissue. CXCL16 could also enhance IFN␥ production by IL-15–stimulated CD4 and CD8 T cells. We
could not measure the CXCL16 concentration in RA
synovial tissue. However, chemokines bind surface proteoglycans (39), and they could therefore be sequestered
and presented to target cells at high concentrations
within the local microenvironment. Consequently, we
suggest that the CXCL16–CXCR6 interaction might
contribute to CD4 and CD8 T cell accumulation and
stimulation in the RA synovium.
A high proportion of CCR5-positive T cells in
RA synovium has also been reported (30,40–43). Furthermore, Unutmaz et al (38) showed that IL-15 stimulation increased the number of CXCR6 and CCR5
double-positive CD4 and CD8 T cells in vitro. These
results suggest that CCR5 could also have an important
role in T cell migration into the synovium. However, the
severity of murine CIA was not altered in genetically
engineered CCR5-deficient mice (44). Moreover, some
patients with RA do not have functional CCR5 because
of a homozygous ⌬32 deletion (45,46). Thus, blockade of
CCR5 only may not be sufficient in T cell target therapy
for RA. Based on results of the present study, we believe
that CXCR6 is potentially a better target molecule for
RA treatment aimed at T cell inhibition, because inhibition of the CXCL16–CXCR6 interaction was effective
in CIA.
Our results showed that CXCL16 is expressed on
synovial macrophage-like synoviocytes and FLS in patients with RA and that its production by FLS is
regulated by TNF␣, IL-1␤, and TGF␤1. Previous studies
demonstrated the expression of CXCL16 on dendritic
cells, macrophages, T cells, B cells, smooth muscle cells,
and umbilical endothelial cells (4,5,9–11). FLS from
patients with RA are additional and new members of the
group of cells producing CXCL16. Because membranous CXCL16 is expressed on the cell surface (4,5,9),
PATHOGENIC ROLE OF CXCL16 IN RA
macrophage-like synoviocytes and FLS could activate T
cells by cell–cell contact via the CXCL16–CXCR6 interaction in the synovial tissue. Furthermore, membranebound CXCL16 can be cleaved by ADAM-10 (7,8), and
thus, soluble CXCL16 subsequently induces the migration and stimulation of CXCR6-positive T cells in the
RA synovium.
Treatment with anti-CXCL16 mAb reduced the
clinical arthritis score and the histopathology score in
mice with CIA. Blockade of the CXCL16–CXCR6 interaction might inhibit T cell migration into the synovium and inhibit T cell stimulation by CXCL16, suggesting that CXCL16 inhibition could decrease the number
of activated T cells in the synovium. It is interesting that
anti-CXCL16 mAb reduced not only cellular infiltration,
but also bone destruction in mice with CIA. Kotake et al
(47) reported that RANKL is expressed on activated T
cells in the RA synovium, and that such expression
induces differentiation and activation of osteoclasts. It is
possible that blockade of the CXCL16–CXCR6 interaction can reduce RANKL expression on synovial T cells
by inhibiting T cell stimulation or reducing the number
of activated T cells in the RA synovium. Therefore,
treatment with CXCL16 inhibitors could also prevent
bone destruction, but further study of this is necessary.
Our group previously reported that treatment
with anti-fractalkine (CX3CL1) mAb ameliorated CIA
and reduced macrophage migration into the synovium
(48). Matthys et al (49) showed that CXCR4 antagonist
inhibited CIA in IFN␥ receptor–deficient mice. Inhibition of fractalkine and CX3CR1, as well as the stromal
cell–derived factor 1–CXCR4 interaction, might prevent
the migration of not only T cells, but also macrophages
into the synovium. In contrast, CXCL16 inhibition may
affect only T cells and not macrophages. In fact, antiCXCL16 mAb reduced the arthritis score up to 25%,
although inhibition of the fractalkine–CX3CR1 interaction reduced the arthritis score up to 50%. Collectively,
these results suggest that the combination of macrophage inhibition and blockade of the CXCL16–CXCR6
interaction may be a better treatment strategy for RA
compared with either of these approaches individually.
In conclusion, in the present study, we observed
expression of CXCL16 in RA synovium and demonstrated that such expression might induce the migration
and stimulation of synovial T cells. Moreover, we
showed that inhibition of CXCL16 significantly improved the clinical arthritis score and the histopathology
score in mice with CIA. Thus, blockade of the CXCL16–
CXCR6 interaction could be a new, potentially useful
therapy for RA.
3013
ACKNOWLEDGMENT
We thank Fumiko Inoue for excellent technical support.
REFERENCES
1. Yoshie O, Imai T, Nomiyama H. Chemokines in immunity. Adv
Immunol 2001;78:57–110.
2. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, et
al. A new class of membrane-bound chemokine with a CX3C
motif. Nature 1997;385:640–4.
3. Pan Y, Lloyd C, Zhou H, Dolich S, Deeds J, Gonzalo JA, et al.
Neurotactin, a membrane-anchored chemokine upregulated in
brain inflammation. Nature 1997;387:611–7.
4. Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A
transmembrane CXC chemokine is a ligand for HIV-coreceptor
Bonzo. Nat Immunol 2000;1:298–304.
5. Wilbanks A, Zondlo SC, Murphy K, Mak S, Soler D, Langdon P,
et al. Expression cloning of the STRL33/BONZO/TYMSTRligand
reveals elements of CC, CXC, and CX3C chemokines. J Immunol
2001;166:5145–54.
6. Shimaoka T, Nakayama T, Fukumoto N, Kume N, Takahashi S,
Yamaguchi J, et al. Cell surface-anchored SR-PSOX/CXC chemokine ligand 16 mediates firm adhesion of CXC chemokine receptor
6-expressing cells. J Leukoc Biol 2004;75:267–74.
7. Gough PJ, Garton KJ, Wille PT, Rychlewski M, Dempsey PJ,
Raines EW. A disintegrin and metalloproteinase 10-mediated
cleavage and shedding regulates the cell surface expression of
CXC chemokine ligand 16. J Immunol 2004;172:3678–85.
8. Abel S, Hundhausen C, Mentlein R, Schulte A, Berkhout TA,
Broadway N, et al. The transmembrane CXC-chemokine ligand 16
is induced by IFN-␥ and TNF-␣ and shed by the activity of the
disintegrin-like metalloproteinase ADAM10. J Immunol 2004;172:
6362–72.
9. Shimaoka T, Kume N, Minami M, Hayashida K, Kataoka H, Kita
T, et al. Molecular cloning of a novel scavenger receptor for
oxidized low density lipoprotein, SR-PSOX, on macrophages.
J Biol Chem 2000;275:40663–6.
10. Shashkin P, Simpson D, Mishin V, Chesnutt B, Ley K. Expression
of CXCL16 in human T cells. Arterioscler Thromb Vasc Biol
2003;23:148–9.
11. Hofnagel O, Luechtenborg B, Plenz G, Robenek H. Expression of
the novel scavenger receptor SR-PSOX in cultured aortic smooth
muscle cells and umbilical endothelial cells. Arterioscler Thromb
Vasc Biol 2002;22:710–1.
12. Kim CH, Kunkel EJ, Boisvert J, Johnston B, Campbell JJ,
Genovese MC, et al. Bonzo/CXCR6 expression defines type
1-polarized T-cell subsets with extralymphoid tissue homing potential. J Clin Invest 2001;107:595–601.
13. Motsinger A, Haas DW, Stanic AK, van Kaer L, Joyce S, Unutmaz
D. CD1d-restricted human natural killer T cells are highly susceptible to human immunodeficiency virus 1 infection. J Exp Med
2002;195:869–79.
14. Thomas SY, Hou R, Boyson JE, Means TK, Hess C, Olson DP, et
al. CD1d-restricted NKT cells express a chemokine receptor
profile indicative of Th1-type inflammatory homing cells. J Immunol 2003;171:2571–80.
15. Sharron M, Pohlmann S, Price K, Lolis E, Tsang M, Kirchhoff F,
et al. Expression and coreceptor activity of STRL33/Bonzo on
primary peripheral blood lymphocytes. Blood 2000;96:41–9.
16. Minami M, Kume N, Shimaoka T, Kataoka H, Hayashida K,
Akiyama Y, et al. Expression of SR-PSOX, a novel cell-surface
scavenger receptor for phosphatidylserine and oxidized LDL in
human atherosclerotic lesions. Arterioscler Thromb Vasc Biol
2001;21:1796–800.
3014
17. Wuttge DM, Zhou X, Sheikine Y, Wagsater D, Stemme V, Hedin
U, et al. CXCL16/SR-PSOX is an interferon-␥-regulated chemokine and scavenger receptor expressed in atherosclerotic lesions.
Arterioscler Thromb Vasc Biol 2004;24:750–5.
18. Shimaoka T, Nakayama T, Kume N, Takahashi S, Yamaguchi J,
Minami M, et al. Cutting edge: SR-PSOX/CXC chemokine ligand
16 mediates bacterial phagocytosis by APCs through its chemokine
domain. J Immunol 2003;171:1647–51.
19. Yamauchi R, Tanaka M, Kume N, Minami M, Kawamoto T, Togi
K, et al. Upregulation of SR-PSOX/CXCL16 and recruitment of
CD8⫹ T cells in cardiac valves during inflammatory valvular heart
disease. Arterioscler Thromb Vasc Biol 2004;24:282–7.
20. Fukumoto N, Shimaoka T, Fujimura H, Sakoda S, Tanaka M, Kita
T, et al. Critical roles of CXC chemokine ligand 16/scavenger
receptor that binds phosphatidylserine and oxidized lipoprotein in
the pathogenesis of both acute and adoptive transfer experimental
autoimmune encephalomyelitis. J Immunol 2004;173:1620–7.
21. Morimoto C, Romain PL, Fox DA, Anderson P, DiMaggio M,
Levine H, et al. Abnormalities in CD4⫹ T-lymphocyte subsets in
inflammatory rheumatic diseases. Am J Med 1988;84:817–25.
22. Kinne RW, Brauer R, Stuhlmuller B, Palombo-Kinne E, Burmester GR. Review: macrophages in rheumatoid arthritis. Arthritis Res 2000;2:189–202.
23. Yamamoto K, Sakoda H, Nakajima T, Kato T, Okubo M, Dohi M,
et al. Accumulation of multiple T cell clonotypes in the synovial
lesions of patients with rheumatoid arthritis revealed by a novel
clonality analysis. Int Immunol 1992;4:1219–23.
24. Nanki T, Lipsky PE. Cytokine, activation marker, and chemokine
receptor expression by individual CD4⫹ memory T cells in
rheumatoid arthritis synovium. Arthritis Res 2000;2:415–23.
25. MacDonald KP, Nishioka Y, Lipsky PE, Thomas R. Functional
CD40 ligand is expressed by T cells in rheumatoid arthritis. J Clin
Invest 1997;100:2404–14.
26. Okamoto T, Saito S, Yamanaka H, Tomatsu T, Kamatani N,
Ogiuchi H, et al. Expression and function of the co-stimulator
H4/ICOS on activated T cells of patients with rheumatoid arthritis.
J Rheumatol 2003;30:1157–63.
27. Szekanecz Z, Kim J, Koch AE. Chemokines and chemokine
receptors in rheumatoid arthritis. Semin Immunol 2003;15:15–21.
28. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, et al. The American Rheumatism Association 1987
revised criteria for the classification of rheumatoid arthritis.
Arthritis Rheum 1988;31:315–24.
29. Nanki T, Nagasaka K, Hayashida K, Saita Y, Miyasaka N.
Chemokines regulate IL-6 and IL-8 production by fibroblast-like
synoviocytes from patients with rheumatoid arthritis. J Immunol
2001;167:5381–5.
30. Nanki T, Hayashida K, El-Gabalawy HS, Suson S, Shi K, Girschick
HJ, et al. Stromal cell-derived factor-1-CXC chemokine receptor 4
interactions play a central role in CD4 T cell accumulation in
rheumatoid arthritis synovium. J Immunol 2000;165:6590–8.
31. Imai T, Hieshima K, Haskell C, Baba M, Nagira M, Nishimura M,
et al. Identification and molecular characterization of fractalkine
receptor CX3CR1, which mediates both leukocyte migration and
adhesion. Cell 1997;91:521–30.
32. Gong JH, Ratkay LG, Waterfield JD, Clark-Lewis I. An antagonist of monocyte chemoattractant protein 1 (MCP-1) inhibits
arthritis in the MRL-lpr mouse model. J Exp Med 1997;186:131–7.
33. Bruhl H, Cihak J, Schneider MA, Plachy J, Rupp T, Wenzel I, et
al. Dual role of CCR2 during initiation and progression of
collagen-induced arthritis: evidence for regulatory activity of
CCR2⫹ T cells. J Immunol 2004;172:890–8.
NANKI ET AL
34. Nanki T, Lipsky PE. Cutting edge: stromal cell-derived factor-1 is
a costimulator for CD4⫹ T cell activation. J Immunol 2000;164:
5010–4.
35. Hutloff A, Dittrich AM, Beier KC, Eljaschewitsch B, Kraft R,
Anagnostopoulos I, et al. ICOS is an inducible T-cell co-stimulator
structurally and functionally related to CD28. Nature 1999;397:
263–6.
36. McInnes IB, Al-Mughales J, Field M, Leung BP, Huang FP, Dixon
R, et al. The role of interleukin-15 in T-cell migration and
activation in rheumatoid arthritis. Nat Med 1996;2:175–82.
37. Oppenheimer-Marks N, Brezinschek RI, Mohamadzadeh M, Vita
R, Lipsky PE. Interleukin 15 is produced by endothelial cells and
increases the transendothelial migration of T cells in vitro and in
the SCID mouse-human rheumatoid arthritis model in vivo. J Clin
Invest 1998;101:1261–72.
38. Unutmaz D, Xiang W, Sunshine MJ, Campbell J, Butcher E,
Littman DR. The primate lentiviral receptor Bonzo/STRL33 is
coordinately regulated with CCR5 and its expression pattern is
conserved between human and mouse. J Immunol 2000;165:
3284–92.
39. Tanaka Y, Adams DH, Hubscher S, Hirano H, Siebenlist U, Shaw
S. T-cell adhesion induced by proteoglycan-immobilized cytokine
MIP-1␤. Nature 1993;361:79–82.
40. Qin S, Rottman JB, Myers P, Kassam N, Weinblatt M, Loetscher
M, et al. The chemokine receptors CXCR3 and CCR5 mark
subsets of T cells associated with certain inflammatory reactions.
J Clin Invest 1998;101:746–54.
41. Suzuki N, Nakajima A, Yoshino S, Matsushima K, Yagita H,
Okumura K. Selective accumulation of CCR5⫹ T lymphocytes
into inflamed joints of rheumatoid arthritis. Int Immunol 1999;11:
553–9.
42. Mack M, Bruhl H, Gruber R, Jaeger C, Cihak J, Eiter V, et al.
Predominance of mononuclear cells expressing the chemokine
receptor CCR5 in synovial effusions of patients with different
forms of arthritis. Arthritis Rheum 1999;42:981–8.
43. Loetscher P, Uguccioni M, Bordoli L, Baggiolini M, Moser B,
Chizzolini C, et al. CCR5 is characteristic of Th1 lymphocytes.
Nature 1998;391:344–5.
44. Quinones MP, Ahuja SK, Jimenez F, Schaefer J, Garavito E, Rao
A, et al. Experimental arthritis in CC chemokine receptor 2-null
mice closely mimics severe human rheumatoid arthritis. J Clin
Invest 2004;113:856–66.
45. Cooke SP, Forrest G, Venables PJ, Hajeer A. The D32 deletion of
CCR5 receptor in rheumatoid arthritis [concise communication].
Arthritis Rheum 1998;41:1135–6.
46. Garred P, Madsen HO, Petersen J, Marquart H, Hansen TM,
Freiesleben Sorensen S, et al. CC chemokine receptor 5 polymorphism in rheumatoid arthritis. J Rheumatol 1998;25:1462–5.
47. Kotake S, Udagawa N, Hakoda M, Mogi M, Yano K, Tsuda E, et
al. Activated human T cells directly induce osteoclastogenesis
from human monocytes: possible role of T cells in bone destruction in rheumatoid arthritis patients. Arthritis Rheum 2001;44:
1003–12.
48. Nanki T, Urasaki Y, Imai T, Nishimura M, Muramoto K, Kubota
T, et al. Inhibition of fractalkine ameliorates murine collageninduced arthritis. J Immunol 2004;173:7010–6.
49. Matthys P, Hatse S, Vermeire K, Wuyts A, Bridger G, Henson
GW, et al. AMD3100, a potent and specific antagonist of the
stromal cell-derived factor-1 chemokine receptor CXCR4, inhibits
autoimmune joint inflammation in IFN-␥ receptor-deficient mice.
J Immunol 2001;167:4686–92.
Документ
Категория
Без категории
Просмотров
3
Размер файла
352 Кб
Теги
cxcl16cxcr6, pathogens, arthritis, role, pathways, rheumatoid
1/--страниц
Пожаловаться на содержимое документа