close

Вход

Забыли?

вход по аккаунту

?

Putative-farnesoic acid O-methyltransferase (FAMeT) in medfly reproduction.

код для вставкиСкачать
A r t i c l e
PUTATIVE-FARNESOIC ACID
O-METHYLTRANSFERASE (FAMeT)
IN MEDFLY REPRODUCTION
Laura Vannini, Silvia Ciolfi, Romano Dallai,
and Francesco Frati
Department of Evolutionary Biology, University of Siena, Siena, Italy
Klaus H. Hoffmann and Martina Meyering-Vos
Department of Animal Ecology I, University of Bayreuth, Bayreuth,
Germany
A gene potentially involved in juvenile hormone (JH) biosynthesis was
previously identified in Ceratitis capitata as the putative-farnesoic acid
O-methyltransferase (FAMeT). Since JH is involved in insect reproduction, we silenced the putative-FAMeT expression by RNA interference
in Ceratitis capitata to evaluate its implication in egg production.
FAMeT gene expression was knocked down in females and males after
eclosion and in 1- and 2-day-old females. Treated specimens were left to
mate with each other or with untreated partners to evaluate the extent of
each sex influencing egg production. Gene silencing was investigated by
Real-Time PCR. Results unambiguously showed that FAMeT has a
C 2010 Wiley
measurable role on the fertility of both medfly sexes. Periodicals, Inc.
Keywords: medfly; juvenile hormone; Real-Time PCR; RNA interference
INTRODUCTION
Farnesoic acid O-methyltransferase (FAMeT) catalyzes the methylation of farnesoic
acid (FA) to methyl farnesoate (MF) in one of the insect juvenile hormone (JH)
biosynthetic pathways (Feyereisen et al., 1981; Hui et al., 2010). The main enzyme
known to be involved in methylation of FA is the juvenile hormone acid
O-methyltransferase (JHAMT) in Diptera (Niwa et al., 2008; Mayoral et al., 2009),
Grant sponsor: MIUR; Grant number: PRIN 2006–2008; Grant sponsor: University of Siena.
Correspondence to: Dr. Laura Vannini, Department of Evolutionary Biology, University of Siena, via A.
Moro 2, 53100, Siena, Italy. E-mail: vannini18@unisi.it
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 75, No. 2, 92–106 (2010)
Published online in Wiley Online Library (wileyonlinelibrary.com).
& 2010 Wiley Periodicals, Inc. DOI: 10.1002/arch.20382
Medfly Putative-FAMeT Silencing
93
whereas the role of FAMeT is still almost unknown. Ceratitis capitata Wiedemann
(Diptera, Tephritidae), also referred to as the Mediterranean fruit fly or the medfly, is
one of the most relevant agricultural pests in the Mediterranean area, parts of Central
and South America, and tropical Africa (Malacrida et al., 2006) where this species may
infest over 250 host species among fruits, nuts, and vegetables (Liquido, 1991).
Insecticide treatments and the sterile insect technique (SIT) are the most widely used
methods against this pest despite the limitations of these approaches (Peck and
McQuate, 2000; Rossi and Rainaldi, 2000; Karalliedde et al., 2001; Bisset, 2002;
Robinson, 2002; Enkerlin, 2005; Magaña et al., 2007). A transcript referred to as
putative-FAMeT is known in C. capitata (GenBank accession no. EU596457), which has
a pre-imaginal life expression profile consistent with the JH titers in Holometabola,
and this led to the assumption that this gene is involved in JH biosynthesis (Vannini
et al., 2010). Juvenile hormone has a central role in the growth, development, and
reproduction of arthropods since it is involved in many physiological processes, such as
moulting and metamorphosis, oogenesis and embryogenesis (Bellés et al., 2005). Any
interference in JH biosynthesis, using JH agonists or antagonists, produces anomalous
development or disorders on reproduction of the target species. Thus, JH biosynthesis
is a potential target for strategies in insect pest control (Hoffmann and Lorenz, 1998;
Tunaz and Uygun, 2004).
In light of the previous study that hypothesized the role of medfly putative-FAMeT
in JH biosynthesis (Vannini et al., 2010) and considering the role of JH in
reproduction, we examined the extent to which the putative-FAMeT is involved in
medfly egg production through RNA interference (RNAi), an RNA-mediated gene
silencing. RNAi is a conserved mechanism in eukaryotes allowing the knockdown of
genes to investigate their functions in vivo in a highly specific way (Fire et al., 1998;
Agrawal et al., 2003; Mello and Conte, 2004). Injection of long double-stranded RNA
(dsRNA) fragments into the insects’ body cavity can silence endogenous gene
transcripts carrying identical sequences (Amdam et al., 2003; Goto et al., 2003;
Meister and Tuschl, 2004; Meyering-Vos and Müller, 2007; Griebler et al., 2008;
Tomoyasu et al., 2008). First, we established the number of laid eggs daily over the two
weeks following eclosion and then we injected specific dsRNA for medfly putativeFAMeT (dsFAMeT) in recently emerged males and females, and in 1- and 2-day-old
females. Successively, gene knockdown was investigated by quantitative Real-Time
PCR (qRT-PCR). The results indirectly assessed the effective role of the putativeFAMeT in JH biosynthesis as already hypothesized in Vannini et al. (2010) and
unambiguously showed that putative-FAMeT is highly involved in medfly egg
production and oviposition, suggesting a role in male and female fertility for this
gene. The interest of this work lies in the fact that the post-transcriptional FAMeT
silencing may be a powerful instrument in controlling the worldwide pest C. capitata
since it allows high species-specific interference with reproduction.
MATERIALS AND METHODS
Medfly Rearing
Ceratitis capitata flies were reared in standard laboratory conditions following Rabossi
et al. (1991). In order to determine the daily number of eggs produced, emerging
adults were isolated 12 h after eclosion and kept in plastic cages (12.5 6 6 cm)
Archives of Insect Biochemistry and Physiology
94
Archives of Insect Biochemistry and Physiology, October 2010
closed with gauze through which eggs were laid. Eight cages containing four females
and four males were prepared for each experiment and the number of eggs laid per
cage was monitored for 14 days, given that during the first two weeks of female adult
life there is the largest egg production.
The average daily number of eggs produced was calculated as the number of eggs
produced daily in each cage divided by the number of females that survived up to that
day and the obtained values were averaged. The amount of eggs produced by virgin
females was also established in experimental cages where males were not introduced.
Sampling, RNA Extraction, and Reverse Transcriptase-Polymerase Chain Reaction
(RT-PCR)
To investigate the putative-FAMeT mRNA expression level in adult females, pools of
six females (approximately 50 mg) were collected and prepared for two-step qRT-PCR
analysis. Independent pools were made with females after eclosion and with females at
each age from day 1 to 14. To inspect the FAMeT transcription rate in females treated
after eclosion and on day 1 (for treatment details see below), pools of six females, 1-, 2-,
3-, 5-, and 9-day-old, were collected. Three replicates of each sample were carried out.
Each batch of samples was frozen in liquid nitrogen and subsequently
homogenized using a Polytron homogenizer (Kinematica AG, Lucerne, Switzerland).
Total RNA was extracted from six individuals (50 mg) as described in Chomczynski
and Sacchi (1987). For each sample, 1 mg of total RNA was used to make Oligo(dT)
cDNA using M-MLV Reverse Transcript RNase H minus, Point Mutant (Promega,
Madison, WI), according to the manufacturer’s instructions.
dsRNA Synthesis
To obtain a dsRNA corresponding to most of the coding region of the C. capitata
putative-FAMeT (GenBank accession no. EU596457), cDNA was made as described
above and two species-specific primers elongated by the T7 promoter tail at their 50
end (Table 1) were used in the following amplification. PCR conditions were: 951C for
1 min, 521C for 1 min, 721C for 1 min, for 35 cycles. PCR amplification was performed
in a total reaction volume of 25 ml containing 1 ml of cDNA, 1 mM dNTPs, 1 PCR
reaction buffer (Fermentas, Canada, Burlington), 2.5 mM Mg21, 1 mM each of the
Table 1. Designed Primers Used in qRT-PCR and in RNAi Experiments
qRT-PCR
Gene
b-tub
FAMeT
Name
Sequence 50 -30
Amplicon length
Cc_TUB_FW
Cc_TUB_RV
Cc_FAMeT_FW
Cc_FAMeT_RV
TCGTCGAATGGATTCCAAAT
TTTCATCCATACCTTCGCCTG
CAGCGAACTACCACCCTTTG
TCATGTTTATTCACCTCCTCACC
195 bp
95,5
3,435
165 bp
99,5
3,333
E(%)
S
RNAi
Species
Name
C. capitata
T7_FAMeT_FW
T7_FAMeT_RV
G. bimaculats T7GbSKf10
T7GbSKr10
Sequence 50 -30
TAATACGACTCACTATAGGGAAATGGCTGAACACCACTGGG
TAATACGACTCACTATAGGGCCTCATAATTGGTCAGTGTCACCTCC
TAATACGACTCACTATAGGGAAGCGCCCCTGCACTCGCA
TAATACGACTCACTATAGGGACTGCCTCTTGCTCATCTCGC
E 5 efficiency; S 5 slope.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
95
forward and reverse primers, and 1U of recombinant Taq DNA polymerase
(Fermentas). The PCR product was gel purified (GFX PCR DNA and Gel Band
Purification kit, Amersham, Piscataway, NJ), cloned in a pGEM-T easy vector
(Promega), and clones were sequenced in both directions to confirm specificity. One
clone identified as FAMeT was used as a template in a second PCR in the same
conditions with the same primers. The PCR product was gel purified (GFX PCR DNA
and Gel Band Purification kit, Amersham) and 1 mg (Z170 ng/ml) was used in an in
vitro transcription (MEGAscript High Yield Transcription Kit, Ambion, Austin, TX)
following the manufacturer’s specifications to make a C. capitata putative-FAMeT
dsRNA, namely dsFAMeT. Lithium chloride precipitation was carried out to purify the
product of the transcription reaction adding 15 ml of nuclease-free water and 30 ml of
LiCl Precipitation Solution (Ambion). The reaction was chilled overnight at 701C and
centrifuged at 41C for 15 min at maximum speed on a microcentrifuge to pellet the
RNA. The pellet was rinsed with 1 ml 70% ethanol and resuspended in 50 ml of
nuclease-free water (not DEPC-treated). Double-strand RNA was denatured for 5 min
at 951C and annealed at room temperature overnight. Quantification of the dsRNA
was done spectrophotometrically (A 5 260 nm) and the absence of incomplete
transcript products was checked by running 200 ng of the sample in a 1.5% agarose
gel in 1 TBE (in DEPC water). The Mediterranean field cricket Gryllus bimaculatus
(Orthopteroidea; Gryllidae) sulfakinin gene (SK, GenBank accession no. AM403493)
was amplified with the primers reported in Table 1 and processed in the same way to
obtain dsRNA (dsSK).
Injections
The dsFAMeT obtained by in vitro transcription was diluted in the injection buffer
(0.1 M phosphate buffer pH 6.8, 10 mM KCl) to obtain concentrations ranging from
0.3 to 2.5 mg/ml. Injections were performed introducing 1 ml of this solution with a 10-ml
Hamilton syringe (Hamilton AG, Bonaduz, Switzerland) equipped with a 40-gauge
needle into the intersegmental membrane between the ventral thoracic segments.
The optimal concentration of dsRNA to be injected was determined on the basis of
a preliminary series of injections (0.3, 0.5, 0.75, 1, 1.5, 2, 2.5 mg of dsFAMeT). Eggs
produced by females injected with various concentrations of dsFAMeT were counted
daily for 7 days and since 1.5 mg of dsFAMeT had the most severe effect on daily
oviposition rate (data not shown), this was the amount chosen for subsequent injections
performed in a final volume of 1 ml.
Injections were performed in males and females after eclosion (recently emerged)
since they tolerated the treatment well (Table 2). Thereafter, injected females were mated
with non-injected males and injected males were mated with non-injected females; in
addition, treated males were allowed to mate with treated females. Females 1 and 2 days
old also were treated to verify with a delayed injection possible effects on oviposition.
The transcript corresponding to a G. bimaculatus SK gene fragment (dsSK) was
injected into males and females after eclosion as non-specific dsRNA, which was used
as a control.
Quantitative Real-Time PCR
FAMeT expression was evaluated in adult females, both injected and non-injected with
specific (dsFAMeT) and non-specific (dsSK) dsRNA by qRT-PCR in a 7500 Real-Time
PCR System (Applied Biosystems, Carslbad, CA). b-tubulin (b-tub) was chosen to
Archives of Insect Biochemistry and Physiology
96
Archives of Insect Biochemistry and Physiology, October 2010
Table 2. Survival Percentage of Females and Males Over the Two Weeks After Eclosion
Age (days)
Survival
% of
Females
Males
Status
1
2
3
4
5
6
7
8
9
10
11
12
13
14
NI
I_dsSK_AE
I_dsFAMeT_AE
I_dsFAMeT_1D
I_dsFAMeT_2D
NI
I_dsSK_AE
I_dsFAMeT_AE
96,8
100
100
100
100
100
100
100
96,8
100
100
100
100
100
96,8
96,8
96,8
100
93,8
81,2
100
100
93,8
96,8
96,8
100
93,8
78,1
87,5
100
93,8
96,8
96,8
87,5
90,6
71,9
78,1
100
93,8
90,6
96,8
81,2
87,5
68,8
78,1
100
90,6
90,6
96,8
81,2
87,5
68,8
78,1
100
90,6
90,6
96,8
80,6
84,4
68,8
78,1
96,8
90,6
90,6
96,8
78,1
84,4
68,8
78,1
96,8
90,6
90,6
93,7
78,1
81,3
68,8
78,1
96,8
90,6
87,5
93,7
75
59,4
56,4
59,4
96,8
90,6
78,1
93,7
75
46,9
56,4
59,4
96,8
90,6
50
93,7
71,9
40,6
43,8
56,2
96,8
87,5
43,8
93,7
71,9
40,6
40,6
53,1
96,8
87,5
43,8
NI: non-injected; I_dsSK_AE: injected with dsSK after eclosion; I_dsFAMeT_AE: injected with dsFAMeT after
eclosion; I_dsFAMeT_1D: injected with dsFAMeT at day 1 of adult life; I_dsFAMeT_2D: injected with dsFAMeT at
day 2. Grey boxes underline the sharp decrease in survival percentage of individuals injected with dsFAMeT. n 5 32.
normalize the expression values of the gene (Vannini et al., 2010). Primers were
designed through a Beacon Designer 2.06 (Premier Biosoft International, Palo Alto, CA)
using medfly b-tub and FAMeT sequences available in GenBank (accession nos.
EU665678 and EU596457, respectively). Special attention was given to the annealing
temperature, base composition and 30 -stability (for primers details see Table 1).
Each reaction was run in triplicate and no-template negative controls were added.
Each reaction contained 0.8 ml of cDNA (about 32 ng), 0.6 ml of each primer (10 mM,
Invitrogen, Carlsbad, CA), 10 ml of 2X iQ SYBR Green Supermix with Rox (Biorad,
Hercules, CA) and RNase/DNase-free sterile water for a total volume of 20 ml. After an
initial incubation at 951C for 1 min, the thermal profile consisted of 40 cycles of
denaturation at 951C for 10 sec and annealing/polymerization at 601C for 30 sec. To
control the specificity of each amplification, a melting curve analysis was performed
increasing the temperature by 0.51C every 10 sec from 561 to 951C. Dissociation curve
analysis produced a single melting peak for each of the two genes, demonstrating
specificity in the amplification. An internal standard curve based on five serial dilutions
(1:10) was constructed for both genes in each plate. Standards were the same
fragments cloned in the pGEM-T easy vector (Promega) and assayed in qRT-PCR. The
initial concentration of the clones was 20.5 ng/ml for FAMeT and 83 ng/ml for b-tub. The
relative expression level of putative-FAMeT was determined relative to the b-tub
transcript by the DDCt method (Pfaffl, 2001). DDCt values have been reported as
normalized expression values (n.e.v.).
Statistical Data Analysis
Data relative to the daily egg production were reported as mean7SEM and data relative
to putative-FAMeT transcriptional rate were reported as mean7SD One-way analysis of
variance (ANOVA) was conducted to test for treatment differences in egg production
and putative-FAMeT expression, considering a significance level of Po0.05. Before
running ANOVA, the assumptions of normality and homogeneity of variance were
checked, respectively, by Shapiro-Wilk’s test and Levene’s test. Data were log(x11)
transformed when assumptions were not tenable. Statistical analyses were performed
using the R statistical software version 2.9.2 (R Development Core Team, 2009).
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
97
RESULTS
Oviposition by Mated and Unmated Females
On day 3, mated females started consistent oviposition and reached a maximum rate
on day 5. Egg laying decreased sharply from day 6 to day 10. Oviposition rate
up-surged again on day 11 and finally decreased on day 13 (Fig. 1).
Egg production rate of C. capitata virgin females was drastically lower compared to
mated females (Fig. 1). Virgin females started egg production on day 3 as in mated
females, but they reached the oviposition peak one day earlier. Also, the second peak in
the oviposition rate on day 9 occurred two days earlier than in mated females (Fig. 1).
The down-regulation of egg laying in virgin females was particularly evident in the
first 8 days of the oviposition period.
FAMeT Silencing and Oviposition Rate
Controls. Gryllus bimaculatus dsSK was injected in medfly females and males after
eclosion as a control. This unspecific control dsRNA seemed to have little effect on the
oviposition rate compared to that of untreated flies (Fig. 2). There was a 13.1%
reduction of laid eggs in injected females mated with untreated males and a 14.9%
reduction in untreated females mated with injected males. In addition, males seemed
to tolerate unspecific dsRNA injection better than females with a death rate reduction
of 9.4% compared to 21.9% of females over the first 10 days (Table 2).
dsFAMeT Injection in Females After Eclosion
Females were injected after eclosion with 1.5 mg of dsFAMeT according to preliminary
experiments performed to determine the amount of dsFAMeT that down-regulates
oviposition rate most (data not shown).
The egg-laying profile in treated females was similar to that of untreated females
with two peaks in the oviposition rate, the first on day 5 and a smaller one on day 11.
However, after injection, female fecundity was clearly reduced as a consistent decrease
in the number of laid eggs was observed (Fig. 3A). The effect of dsFAMeT injection
seemed to be stronger in the first 7 days. Untreated females started consistent
Figure 1. Oviposition of non-injected females mated with non-injected males (dark grey) compared to egg
laying of non-injected virgin females (light-grey). Means7SEM, n 5 32.
Archives of Insect Biochemistry and Physiology
98
Archives of Insect Biochemistry and Physiology, October 2010
Figure 2. Daily laid eggs of females non-injected (~NI) mated with males non-injected (#NI) against:
females injected with dsSK (~I) mated with males non-injected; females non-injected mated with males
injected with dsSK (#I). Means7SEM, n 5 32.
oviposition on day 3, but there was little production on day 2 as well. Oviposition in
treated females was delayed, starting on day 3 and never reached the levels detected in
untreated specimens.
The amount of eggs laid by treated females over the entire 14-day observation
period was in total 57.2% compared to the controls and 59.6% on day 5, the oviposition
peak in untreated females.
dsFAMeT Injection in Males After Eclosion
Injections were also performed in males after eclosion under the same conditions used
for females. Males were then mated with non-injected females and the daily oviposition
rate was established.
Injections of dsFAMeT in males led to a reduction of female fecundity, which
seemed to be strongest from day 5 to 9 (Fig. 3B). The first peak in oviposition rate
occurred one day earlier with respect to non-injected females (day 4). From day 10 to 14,
the amount of laid eggs produced was comparable to that of non-injected females mated
with non-injected males. The amount of laid eggs over the 14 days was 55.8%, a
percentage similar to the effect observed in treated females, but the oviposition rate
dropped by 50.5% compared to that of treated females on day 5.
Mating of Males and Females Injected With dsFAMeT
The daily oviposition rate was drastically reduced when females after eclosion were
mated with males treated with the same dose of dsFAMeT (1.5 mg) (Fig. 3C). On the
first few days after treatment, the number of laid eggs declined sharply but
up-surged again after day 5. Considering the oviposition rate of non-treated females,
fecundity was significantly compromised until day 9 when egg production peaked in
treated animals. The number of laid eggs was slightly reduced with respect to
non-treated females on the last day. Treated females produced 26% of total eggs laid
by untreated flies over the 14 days, whereas the treated fly oviposition rate decreased
to 22% on day 5.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
99
Figure 3. Daily laid eggs. ~NI: females non-injected; #NI: males non-injected; ~I: females injected with
1.5 mg of dsFAMeT; #I: males injected with 1.5 mg of dsFAMeT. Means7SEM, n 5 32.
dsFAMeT Injection in 1- and 2-Day-Old Females
Injections of dsFAMeT were also performed in 1- and 2-day-old females in an attempt
to obtain better silencing of the oviposition peak on day 5.
Injections on the first day of adult life seemed to be more effective than injections
in flies after eclosion, whereas injections on the second day had little effect (Fig. 4).
Survival percentage was lower in females injected at day 1 and 2 than in females
Archives of Insect Biochemistry and Physiology
100
Archives of Insect Biochemistry and Physiology, October 2010
Figure 4. Daily laid eggs of non-injected females (~NI) mated with non-injected males (#NI) against:
injected females at day 1 (~I_1D) and injected females at day 2 (~I_2D) mated with non-injected males.
Means7SEM, n 5 32.
Figure 5. Relative transcript levels of the putative-FAMeT in whole body of untreated females of C. capitata.
Values have been normalized following the DDCt method (Pfaffl, 2001). Mean7SD, n 5 3.
injected after eclosion (Table 2) indicating that flies were more sensitive to the simple
injection after the first few hours of adult life, especially in 1-day-old females; for this
reason we focused on flies injected after eclosion.
To exclude the fact that the slight effect observed in the oviposition rate of females
injected at day 2 was due to the amount of dsFAMeT used, a smaller and bigger dose of
dsRNA (1 and 2 mg) was injected. The result showed that changing quantities also has
little effect on fecundity in these females (data not shown).
Putative-FAMeT Expression in Untreated Flies
A main target of this study was to quantify the putative-FAMeT mRNA production in
the first 2 weeks of female life and to evaluate whether silencing of FAMeT
can compromise the oviposition rate by qRT-PCR. As shown in Figure 5, this
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
101
Figure 6. Putative-FAMeT expression in untreated females against treated females. Dark grey: untreated;
black: unspecific control; light grey: injected after eclosion with dsFAMeT; white: injected 1-day-old with
dsFAMeT. Values have been normalized following the DDCt method (Pfaffl, 2001). Mean7SD, n 5 3,
ANOVA 5 Po0.05.
O-methyltransferase transcript was at the minimum level in 13-day-old females (20.55
n.e.v.) and had two peaks of expression. The higher peak was at the second day of
adult life (56.24 n.e.v.) and the other at days 9 and 10 of adult life (48.23 and 47.01
n.e.v.). Between these two stages, there was a decrease in putative-FAMeT expression
level with the lowest expression in 5-day-old females (25.43 n.e.v.).
Putative-FAMeT Expression in Treated Flies
FAMeT expression was evaluated by qRT-PCR in females injected with dsFAMeT after
eclosion and at day 1 in order to evaluate the occurrence of gene silencing. To exclude
any possible unspecific interference of dsRNA injection with gene transcription,
FAMeT expression was detected also in females injected with dsSK after eclosion. No
consistent reduction of FAMeT transcriptional levels was observed on the injection
following day which otherwise seemed to be highly reduced (66.5%) two days after
injection in females treated after eclosion. RNA silencing seemed to be effective until
day 9. Females treated at day 1 soon showed a lower FAMeT transcription rate, which
remained low throughout. Injection of dsSK had little effect on the FAMeT expression
level (Fig. 6).
DISCUSSION
Putative-FAMeT titers seem to be regulated at different times in adult females. Since
FAMeT has been suggested as to be involved in JH biosynthesis, we correlated its
expression profile with the only known JH titers in the medfly reported by Moshitzky
et al. (2003). We speculate that the first FAMeT expression peak could be related to the
JH peak and that it is likely that the increase of JH between days 3 to 6 is correlated to
the high amount of eggs laid between day 3 to 7. Due to this consideration, a future
Archives of Insect Biochemistry and Physiology
102
Archives of Insect Biochemistry and Physiology, October 2010
study addressed to establish whether JH titers in the medfly are influenced by FAMeT
silencing should be encouraged.
Transcript levels of putative-FAMeT were drastically reduced after injection of
dsFAMeT in females after eclosion and in 1-day-old females, whereas injection of dsSK
did not seem to affect the FAMeT transcriptional rate (Fig. 6) suggesting a specific and
systemic effect of RNAi. However, dsFAMeT injections did not allow complete
silencing of the gene since a little expression was found in treated flies. Although
complete gene silencing was demonstrated in honeybees (Farooqui et al., 2004), the
incomplete silencing of target genes by RNAi has been reported in other species (Goto
et al., 2003; Meyering-Vos et al., 2006). Gene silencing in medflies was effective for a
long time after treatment and was even able to interfere with the second gene
expression peak (Fig. 6).
Injections of dsFAMeTwere shown to interfere with egg production in females and
fertility in males (Fig. 3). A drastic reduction in the number of laid eggs occurred when
injected males and females were mated, with an overall effect comparable to the sum of
the effects detected when individuals of both sexes were mated with a non-treated
partner. Males and females seemed poorly sensitive to simple injections of 1.5 mg of
double-strand RNA (in this case G. bimaculatus dsSK) (Fig. 2) pointing out a slight
aspecific effect on the observed fertility (13.1% for females and 14.9 % for males), but
could not completely explain the profound effect observed when the same amount of
specific dsFAMeT was injected. This evidence suggests a significant role for FAMeT on
the fertility of both medfly sexes and inevitably leads to an indirect correlation with the
role of JH in insects, in the light of the previous observations on FAMeT in JH
biosynthesis, reported in Vannini et al. (2010), and considering that JH is involved in
several aspects of fertility in both sexes in insects. The relation between JH and the
putative-FAMeT genes isolated so far in insects is unclear. The gene is only known
in the dipterans Drosophila melanogaster (GeneBank accession no. CG10527) and
C. capitata (GeneBank accession no. EU596457), and in the hymenopteran Melipona
scutellaris (Genebank accession nos.: CAM35481, isoform 1; CAM35482, isoform 2).
The Drosophila putative-FAMeT protein cannot convert FA to MF (Burtenshaw et al.,
2008). In Melipona, where two isoforms exist, only the expression of isoform 2
transcript seems to be negatively modulated by topical application of JH-III to larvae
(Vieira et al., 2008). The putative-FAMeT transcript isolated in C. capitata shows a low
similarity with both these sequences and the only evidence of its role in JH biosynthesis
is that its pre-imaginal expression profile may be related to JH titers in Holometabola
(Vannini et al., 2010). The influence of JH in egg maturation in insects varies from
species to species: vitellogenin synthesis by fat body, separation of a new follicle from
the germarium, previtellogenic growth of the oocytes, and vitellogenesis. Stimulation
of vitellogenin synthesis by JH occurs in all major taxa examined so far, from
apterygotes to Diptera, and is one of the major and best-known roles of JH in insect
reproduction (Nijhout, 1994; Wyatt and Davey, 1996; Handler, 1997; Bellés, 1998;
Borst et al., 2000; Pellissier Scott et al., 2004; Simonet et al., 2004; Corona et al., 2007;
Dong et al., 2009). JH controls male accessory gland secretion and consequently affects
female reproduction, since sperm fluid substances may modulate JH synthesis in
females after mating (Hartfelder, 2000) and, in turn, vitellogenin synthesis rate. The
‘‘sex peptide’’ identified in such secretion in D. melanogaster has been directly
correlated with several post-copulatory changes in female behaviour such as materejection and oviposition behaviour in mated females (Schmidt et al., 1993). The
severe effects on the reproductive cycle of the medfly caused by FAMeT interference
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
103
can be related to the function of JH, which is involved in various reproductive
mechanisms such as egg maturation in females and secretion of accessory glands
in males, other than several post-mating behaviours in females. The decrease in
C. capitata egg production by untreated females mated with treated males (Fig. 3B)
showed a profile similar to that of virgin females (Fig. 1) suggesting that mating
triggers several mechanisms that had been severely compromised by FAMeT silencing
in males.
FAMeT dsRNA injected in 2-day-old females had a weaker effect on the
oviposition rate compared to that observed with dsFAMeT injections in younger
females (Fig. 4). We cannot exclude that treating flies at the peak of gene expression
leads to incomplete depletion of the protein in the tissues causing little effect on
oviposition, which is probably controlled at this stage of female adult life. Early
suppression of FAMeT expression seems to be necessary for interfering with the
function of the enzyme.
A secondary effect of RNAi was the decrease in survival rate in dsFAMeT-treated
individuals (Table 2). Females and males injected after eclosion as well as females
injected at day 1 and day 2 showed a consistent increase in death rate from day 11 (this
decrease is not evident in samples treated with control dsRNA). In the light of this
finding, we propose a potential role of Ceratitis putative-FAMeT on some traits
correlated with longevity.
The present study points out the effect of FAMeT silencing in adult medflies, and
the extent to which it affects offspring, reducing female and male reproductive
capabilities by 44.2 and 42.8%, respectively. When males and females, both treated,
were left to mate, fertility decreased by 74% and such data may have important
implications for planning control strategies based on the reduction of the reproductive
success of this pest. Post-transcriptional FAMeT silencing, therefore, may be a powerful
instrument in controlling the medfly.
ACKNOWLEDGMENTS
We thank Marion Preiss (Department of Animal Ecology I of Bayreuth) for technical
assistance and Dr. Mauro Taormina (Department of Evolutionary Biology of Siena) for
statistical analysis of data. The work was supported by the University of Siena (P.A.R.).
All experiments described in this work have been performed in compliance with the
current laws in Italy.
LITERATURE CITED
Agrawal N, Dasaradhi PVN, Mohmmed A, Malhotra P, Bhatnagar RK, Mukherjee SK. 2003.
RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67:
657–685.
Amdam GV, Simões ZL, Guidugli KR, Norberg K, Omholt SW. 2003. Disruption of vitellogenin
gene function in adult honeybees by intra-abdominal injection of double-stranded RNA.
BMC Biotechnol 3:1–8.
Bellés W. 1998. Endocrine effectors in insect vitellogenesis. In: Coast GM, Webster SG, editors.
Recent Advances in Arthropod Endocrinology. Cambridge: Cambridge University Press.
p 71–90.
Bellés X, Martin D, Piulachs M-D. 2005. The mevalonate pathway and the synthesis of juvenile
hormone in insects. Annu Rev Entomol 50:81–199.
Archives of Insect Biochemistry and Physiology
104
Archives of Insect Biochemistry and Physiology, October 2010
Bisset JA. 2002. Correct use of insecticides: management of resistance. Rev Cubana Med Trop
54:202–219.
Borst DW, Eskew MR, Wagner SJ, Shores K, Hunter J, Luker L, Hatle JD, Hecht LB. 2000.
Quantification of juvenile hormone III, vitellogenin, and vitellogenin-mRNA during the
oviposition cycle of the lubber grasshopper. Insect Biochem Mol Biol 30:813–819.
Burtenshaw SM, Su PP, Zhang JR, Tobe SS, Dayton L, Bendena WG. 2008. A putative farnesoic
acid O-methyltransferase (FAMeT) orthologue in Drosophila melanogaster (CG10527):
relationship to juvenile hormone biosynthesis? Peptides 29:242–251.
Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.
Corona M, Velarde RA, Remolina S, Moran-Lauter A, Wang Y, Hughes KA, Robinson GE. 2007.
Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc Natl
Acad Sci USA 104:7128–7133.
Dong SZ, Ye GY, Guo JY, Hu C. 2009. Roles of ecdysteroid and juvenile hormone in
vitellogenesis in an endoparasitic wasp, Pteromalus puparum (Hymenoptera: Pteromalidae).
Gen Comp Endocrinol 160:102–108.
Enkerlin WR. 2005. Impact of fruit fly control programmes using the sterile insect technique.
In: Dyck VA, Hendrichs J, Robinson AS, editors. Sterile insect technique: principles and
practice in area-wide integrated pest management. Dordrecht: Springer. p 651–676.
Farooqui T, Vaessin H, Smith BH. 2004. Octopamine receptors in the honeybee (Apis mellifera)
brain and their disruption by RNA-mediated interference. J Insect Physiol 50:701–713.
Feyereisen R, Pratt GE, Hamnett AF. 1981. Enzymatic synthesis of juvenile hormone in locust
corpora allata: evidence for a microsomal cytochrome P-450 linked methyl farnesoate
epoxidase. Eur J Biochem 118:231–238.
Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent and
specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature
391:806–811.
Goto A, Blandin S, Royet J, Reichhart J-M, Levashina EA. 2003. Silencing of Toll pathway
components by direct injection of double-stranded RNA into Drosophila adult flies. Nucleic
Acids Res 31:6619–6623.
Griebler M, Westerlund SA, Hoffmann KH, Meyering-Vos M. 2008. RNA interference with the
allotoregulating neuropeptide genes from the fall armyworm Spodoptera frugiperda and its
effects on the JH titer in the hemolymph. J Insect Physiol 54:997–1007.
Handler AM. 1997. Developmental regulation of yolk protein gene expression in Anastrepha
suspense. Arch Insect Biochem Physiol 36:25–35.
Hartfelder K. 2000. Insect juvenile hormone: from ‘‘status quo’’ to high society. Braz J Med Biol
Res 33:157–177.
Hoffmann KH, Lorenz MW. 1998. Recent advances in hormones in insect pest control.
Phytoparasitica 26:1–8.
Hui JHL, Hayward A, Bendena WG, Takahashi T, Tobe SS. 2010. Evolution and functional
divergence of enzymes involved in sesquiterpenoid hormone biosynthesis in crustaceans
and insects. Peptides 31:451–455.
Karalliedde L, Eddleston M, Murray V. 2001. The global picture of organophosphate insecticide
poisoning. In: Karalliedde L, Feldman S, Henry J, Marrs T, editors. Organophosphates and
health. London: Imperial College Press. p 431–471.
Liquido NJ. 1991. Effect of ripeness and location of papaya fruits on the parasitization rates of
Oriental fruit fly and melon fly (Diptera: Tephritidae) by braconid (Hymenoptera)
parasitoids. Environ Entomol 20:1732–1736.
Magaña C, Hernández-Crespo P, Ortego F, Castañera P. 2007. Resistance to malathion in field
populations of Ceratitis capitata. J Econ Entomol 100:1836–1843.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT Silencing
105
Malacrida AR, Gomulski LM, Bonizzoni M, Bertin S, Gasperi G, Guglielmino GR. 2006.
Globalization and fruitfly invasion and expansion: the medfly paradigm. Genetica 131:1–9.
Mayoral JG, Nouzova M, Yoshiyama M, Shinoda T, Hernandez-Martinez S, Dolghih E, Turjanski AG,
Roitberg AE, Priestap H, Perez M, Mackenzie L, Li Y, Noriega FG. 2009. Molecular and
functional characterization of a juvenile hormone acid methyltransferase in the corpora allata of
mosquitoes. Insect Biochem Mol Biol 39:31–37.
Meister G, Tuschl T. 2004. Mechanisms of gene silencing by double-stranded RNA. Nature
431:343–349.
Mello CC, Conte Jr D. 2004. Revealing the world of RNA interference. Nature 431:338–342.
Meyering-Vos M, Müüller A. 2007. Structure of the sulfakinin cDNA and gene expression from
the Mediterrranean field cricket Gryllus bimaculatus. Insect Mol Biol 16:445–454.
Meyering-Vos M, Merz S, Sertkol M, Hoffmann KH. 2006. Functional analysis of the allatostatinA type gene in the cricket Gryllus bimaculatus and the armyworm Spodoptera frugiperda. Insect
Biochem Mol Biol 36:492–504.
Moshitzky P, Gilbert LI, Applebaum SW. 2003. Biosynthetic maturation of the corpus allatum of
the female adult medfly, Ceratitis capitata, and its putative control. J Insect Physiol
49:603–609.
Nijhout HF. 1994. The endocrine control of molting and metamorphosis. In: Insect Hormones.
New Jersey: Princeton University Press. p 89–141.
Niwa R, Niimi T, Honda N, Yoshiyama M, Itoyama K, Kataoka H, Shinoda T. 2008. Juvenile
hormone acid O-methyltransferase in Drosophila melanogaster. Insect Biochem Mol Biol
38:714–720.
Peck SL, McQuate GT. 2000. Field tests of environmentally friendly malathion replacements to
suppress wild Mediterranean fruit fly (Diptera: Tephritidae) populations. J Econ Entomol
93:280–289.
Pellissier Scott M, Panaitof SC, Carleton KL. 2004. Quantification of vitellogenin-mRNA during
maturation and breeding of a burying beetle. J Insect Physiol 51:323–331.
Pfaffl MW. 2001. A new mathematic model for relative quantification in real-time RT-PCR.
Nucleic Acids Res 29:2004–2007.
R Development Core Team. 2009. R: A language and environment for Statistical Computing. R
Foundation for Statistical Computing, Vienna, Austria. URL: http://www.R-Project.org
Rabossi A, Boccaccio GL, Wappner P, Quesada-Alluè LA. 1991. Morphogenesis and cuticular
markers during the larval-pupal transformation of the medfly Ceratitis capitata. Entomol Exp
Appl 60:135–141.
Robinson AS. 2002. Genetic sexing strains in medfly, Ceratitis capitata, sterile insect technique
field programmes. Genetica 116:5–13.
Rossi E, Rainaldi G. 2000. Induction of Malathion resistance in CCE/CC128 cell line of
Mediterranean fruit fly (Ceratitis capitata (Wied.)) (Diptera: Tephritidae). Cytotechnology 34:
11–15.
Schmidt T, Choffat Y, Klauser S, Kubli E. 1993. The Drosophila melanogaster sex peptide: a
molecular analysis of structure-function relationships. J Insect Physiol 39:361–368.
Simonet G, Poels J, Claeys I, Van Loy T, Franssens V, De Loof A, Vanden Broeck J. 2004.
Neuroendocrinological and molecular aspects of insect reproduction. J Neuroendocrinol
16:649–659.
Tomoyasu Y, Miller SC, Tomita S, Schoppmeier M, Grossmann D, Bucher G. 2008. Exploring
systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium.
Genome Biol 9:R10.
Tunaz H, Uygun N. 2004. Insect growth regulators for insect pest control. Turk J Agric For
28:377–387.
Archives of Insect Biochemistry and Physiology
106
Archives of Insect Biochemistry and Physiology, October 2010
Vannini L, Ciolfi S, Spinsanti G, Panti C, Frati F, Dallai R. 2010. The putative-farnesoic acid
O-methyltransferase (FAMeT) gene of Ceratitis capitata: characterization and pre-imaginal
life expression. Arch Insect Biochem Physiol 73:106–117.
Vieira CU, Bonetti AM, Simões ZLP, Maranhão AQ, Costa CS, Costa MCR, Siquieroli AC,
Nunes FM. 2008. Farnesoic acid O-methyltransferase (FAMeT) isoforms: conserved traits
and gene expression patterns related to caste differentiation in the stingless bee, Melipona
scutellaris. Arch Insect Biochem Physiol 67:97–106.
Wyatt GR, Davey KG. 1996. Cellular and molecular actions of juvenile hormone II. Roles of
juvenile hormones in adult insects. Adv in Insect Physiol 24:213–274.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
0
Размер файла
406 Кб
Теги
acid, fame, methyltransferases, medfly, reproduction, putative, farnesoic
1/--страниц
Пожаловаться на содержимое документа