close

Вход

Забыли?

вход по аккаунту

?

The putative-farnesoic acid O-methyl transferase FAMeT gene of Ceratitis capitatacharacterization and pre-imaginal life expression.

код для вставкиСкачать
A r t i c l e
THE PUTATIVE-FARNESOIC ACID
O-METHYL TRANSFERASE (FAMeT)
GENE OF Ceratitis capitata:
CHARACTERIZATION AND
PRE-IMAGINAL LIFE EXPRESSION
Laura Vannini, Silvia Ciolfi, Giacomo Spinsanti
Cristina Panti, Francesco Frati, and Romano Dallai
Department of Evolutionary Biology, University of Siena, Siena, Italy
Farnesoic acid O-methyl transferase (FAMeT) is the enzyme involved
in the penultimate step of insect juvenile hormone (JH) biosynthesis and
is thus a key regulator in insect development and reproduction. We report
the characterization of the putative-FAMeT in the medfly or Mediterranean fruit fly, Ceratitis capitata. This gene was identified by
suppressive subtractive hybridization and completely sequenced by the
screening of a medfly cDNA library. The obtained sequence was analyzed
for conserved protein domain identification and its expression profile was
evaluated by quantitative Real-Time PCR in medfly pre-imaginal life.
The tissue expression of the isolated gene was verified by in situ
hybridization on third instar larvae sections. The characterization of the
isolated gene pointed out several typical features of methyl transferase
genes. The pre-imaginal putative-FAMeT expression levels were
consistent with JH titer change in Diptera. As recognized in some
crustaceans, this gene seems to be widely expressed in the medfly as well.
Ceratitis capitata is one of the most relevant agricultural pests against
which insecticides and the sterile insect technique (SIT) are extensively
used in spite of the well-known limitations of these approaches. Although
results are not conclusive for the physiological role of the isolated gene,
they suggest the characterization of a new gene in the Mediterranean
fruit fly potentially involved in JH biosynthesis and may, therefore, have
C 2010 Wiley Periodicals, Inc.
implications for pest control. Grant sponsor: MIUR; Grant number: PRIN 2006–2008; Grant sponsor: University of Siena.
Correspondence to: Dr. Laura Vannini, Department of Evolutionary Biology, University of Siena, via A.
Moro 2, 53100, Siena, Italy. E-mail: vannini18@unisi.it
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 73, No. 2, 106–117 (2010)
Published online in Wiley InterScience (www.interscience.wiley.com).
& 2010 Wiley Periodicals, Inc. DOI: 10.1002/arch.20344
Medfly Putative-FAMeT
107
Keywords: farnesoic acid O-methy transferase; suppressive subtractive
hybridization; medfly
INTRODUCTION
Ceratitis capitata Wiedemann (Diptera, Tephritidae) is one of the most relevant
agricultural pests in the Mediterranean area, parts of Central and South America,
and tropical Africa (Malacrida et al., 2006). In spite of the role of the juvenile hormone
(JH) in insect development and other physiological processes (Bellés et al., 2005), very
little is known about JH titer, function, and regulation in the medfly. JH biosynthesis
has at least two branches in cyclorrhaphous Diptera: one produces the JH-bisepoxide,
which represents 95% of the total JH titer; the other leads to JH-III, which is produced
at lower levels via methyl farnesoate (MF) (Moshitzky and Applebaum, 1995). Despite
the lower synthesis rate, JH-III has been suggested to be directly involved in the
vitellogenin transcriptional rate during oogenesis (Hartfelder, 2000). This implies a key
role of farnesoic acid O-methyl transferase (FAMeT) in egg maturation, which catalyzes
the methylation of farnesoic acid (FA) to MF (Feyereisen et al., 1981). The FAMeT gene
was well identified in crustaceans (Kuballa et al., 2007) in which MF production is
specific to the mandibular organ, homologous to insect corpora allata (Chang, 1993).
The distribution of FAMeT mRNA and protein in Crustacea is rather widespread (Hui
et al., 2008; Ruddell et al., 2003; Silva Gunawardene et al., 2001, 2002) and this has also
been hypothesized for insects (Feyereisen et al., 1981). Among known Drosophila
melanogaster sequences, the transcript CG10527 (GeneBank accession no.) has the
highest amino acid identity with the well-known crustacean FAMeT (19–22%). However,
another molecular/genetic study revealed that the putative protein encoded by this
sequence cannot convert FA to MF (Burtenshaw et al., 2008). In insects, the only other
FAMeT known is in the stingless bee, Melipona scutellaris, which has two isoforms
(Genebank accession nos.: CAM35481, isoform 1; CAM35482, isoform 2) of which only
the expression of isoform 2 seems to be modulated by JH-III (Vieira et al., 2008).
A suppressive subtractive hybridization (SSH) (Diatchenko et al., 1996; von Stein,
2001; Wang et al., 2005; Xiong et al., 2001) allowed us to isolate the first fragment of
C. capitata putative-FAMeT that then was used as a probe to screen a cDNA library,
obtaining the complete transcript. By means of quantitative Real-Time PCR (qRTPCR), we characterized the variation of FAMeT expression during juvenile instars and
by in situ hybridization of third-instar larvae sections, we observed the tissue
expression of this gene.
This report focuses on putative-FAMeT gene characterization and its transcriptional expression during the pre-imaginal life in the medfly. Several features are
pointed out because this gene is likely to be involved in the JH synthesis pathway, and
therefore cannot be underestimated.
MATERIALS AND METHODS
Ceratitis capitata Rearing and Staging
Ceratitis capitata flies were reared in standard laboratory conditions following Rabossi
et al. (1991). Adults were kept in plastic cages closed with gauze, through which eggs
Archives of Insect Biochemistry and Physiology
108
Archives of Insect Biochemistry and Physiology, February 2010
were laid. Eggs were collected a few hours after laying, and plated in a larval culture
medium in closed Petri dishes. Three days later, eggs hatch and the three following
larval stages take 7–10 days to pupate: first larval instar (LI) 5 1–2 days; second larval
instar (LII) 5 1–2 days; third larval instar (LIII) 5 5–6 days. Plates with LIII were
opened and placed into a pupation box; this allowed larvae to exit from the food
medium and ‘‘jump’’ to pupate. Under these conditions, the pupal stage takes 7–8 days.
RNA Extraction and cDNA Synthesis
Whole animal bodies were frozen in liquid nitrogen and then homogenized using a
Polytron homogenizer (Kinematica AG). Total RNA was extracted from 50 mg of
Ceratitis eggs (n4100), LI (n 5 50), LII (n 5 25), LIII (n 5 6–10), pupae (n 5 6), and
adults (n 5 6) as described in Chomczynski and Sacchi (1987). Each sample was treated
with DNaseI (Sigma) for 30 min at 371C. After phenol and chloroform extraction and
ethanol precipitation, 6 mg of total RNA was used to synthesize cDNA using
StrataScript Reverse Transcriptase (Stratagene), in combination with Oligo(dT)primer, according to the manufacturer’s instructions.
Subtracted cDNA Library Construction
We performed an SSH experiment using a pool of pupae cDNA as driver, and a
pool of third instar larvae cDNA as tester (our primary scope was to identify a
gene expressed only in the larval stage). The tester and driver polyA RNAs were
isolated from total RNA using the Micro-FastTrack 2.0 mRNA isolation Kit (Invitrogen).
SSH and subtracted cDNA library were carried out as described in Diatchenko
et al. (1996).
Identification of C. capitata FAMeT Complete Transcript
White colonies from the subtracted library were randomly chosen and sequenced on a
CEQ 8000XL automated DNA Analysis System (Beckman Coulter). Sequences were
edited using the software Sequencer (version 4.2.2; Genes Codes) and nucleic acid or
deduced amino acid homologies were searched using the BLAST program. Among
the isolated gene fragments, we found the first portion of the gene on which this study
is focused (154 bp). This fragment was labeled with [a-32P]dCTP (Amersham
Biosciences) using a ‘‘random-primed DNA labeled kit’’ (Roche) and then used as a
probe to screen a medfly third larval instar cDNA library (SMART cDNA Library
Construction Kit, Clontech). Hybridization was performed overnight at 651C in 1 Denhardt’s solution, 2 SSC (300 mM NaCl, 30 mM sodium citrate, pH 7.0), 50 mg/ml
salmon sperm DNA. Nitrocellulose filters were washed twice in 2 SSC, SDS 0.1% for
5 min at room temperature and three more times at 651C for 30 min. After a second
hybridization, performed to confirm the positive signal, the isolated clone was
subcloned in pBluescript II SK() vector (Stratagene) and sequenced on both strands
using M13 forward and reverse primers. Sequence accuracy was checked by eye on the
chromatograms and sequence identity was established with BLAST and ClustalX
(Thompson et al., 1997) alignment with possible orthologous genes.
The amino acid sequence was analysed to identify putative conserved motifs by
submitting it to the Prosite database (Hulo et al., 2007). The sequence of the isolated
transcript was submitted to GenBank with accession no. EU596457.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT
109
In Situ Hybridization
For in situ hybridization experiments, third-instar larvae were collected and washed in
PBS 1 pH6.8 (NaCl 130 mM, Na2HPO4 7 mM, NaH2PO4 3 mM). To facilitate entry
of the fixative, the cuticle was pierced several times with forceps and then larvae were
incubated overnight at 41C in 4% paraformaldehyde/PBS 1 pH7.4. Larvae were
dehydrated in a graded ethanol series, paraffin-embedded, cut in 7 mm sections with a
rotary microtome, and mounted on SuperFrost Ultra Pluss (Menzel-Gläser) slides.
After deparaffinization and rehydration, the sections were treated and hybridized as
described by Matsui et al. (2000). The probe was generated following the instruction of
the PCR DIG Probe Synthesis Kit (Roche) using the primer pair Farn-F (50 -ATTCGGATGGTTCGCCAATCTTTG-30 ) versus Farn-R (50 -GGTGAGGAGGTGAATAAACATGA-30 ). As an unspecific probe, a plasmidic DNA (pBR328 DNA) DIG-labeled
(Roche) was used. Hybridization was immunodetected following the manufacturer’s
instruction in the Nucleic Acid Detection Kit (Roche).
Quantitative Real-Time PCR
For qRT-PCR experiments, larvae and pupae were synchronized, removing the nonhatched eggs and isolating individuals that pupated at the same moment. Eggs were
collected on the laying day (E/1) and on the hatching day (E/2); LI and LII were
collected at 1 day old; LIII were collected every 24 h until the larvae ‘‘jump’’ to pupate
(LIII/1–LIII/5 and LIII/J for ‘‘jumping’’ individuals). A pool of immobile larvae that
started to pupate was collected (LIII/P) and after 12 h we started to collect the first
pupae pool (P/1). Subsequently, pupae individuals were collected at 1 day old (P/2), in
the middle (P/3: 4 days old), and at the end (P/4: 7 days old) of the pupal stage.
C. capitata b-actin (Act) and b-tubulin (Tub) were used as house-keeping genes. The
partial sequence of medfly b-actin and b-tubulin (respectively, GeneBank accession
nos.: EU665679 and EU665678) genes and the complete sequence for the medfly
putative-FAMeT obtained were used to design species-specific primers for qRT-PCR
assays (Table 1) using Beacon Designer 2.06 (Premier Biosoft International) (Table 1).
Amplifications of cDNA fragments from 150–200 bp with a 1:3 serial dilution of
templates were performed to assess the efficiency of each primer pair (as described
below), using cDNA as template. From each experiment, an efficiency value (E), a
slope value (S), and a correlation value (R2) were determined to be subsequently used
in the calculation of interest gene expression levels (Table 1). Amplifications
were performed in triplicate (as well as the no-template control) on an iQ5 machine
(Bio-Rad) using SYBR Green detection chemistry, following Spinsanti et al. (2006).
Table 1. Primer Pairs Used in qRT-PCR. Efficiency (E), Slope (S), and Correlation Values (R2) of the
Three Primer Pairs Used in qRT-PCR
Gene
Primer name
Primer sequences [50 -30 ]
Amplicon (bp)
E%
S
R2
FAMeT
Cc_Farn-FW
Cc_Farn-RV
Cc_Act-FW
Cc_Act-RV
Cc_Tub-FW
Cc_Tub-RV
CAGCGAACTACCACCCTTTG
TCATGTTTATTCACCTCCTCACC
GGGACGATATGGAGAAGATCTGGC
ACGGTCCATGGCCACATACATGGC
TCGTCGAATGGATTCCAAAT
TTTCATCCATACCTTCGCCTG
165
98.3
3.362
0.999
179
95.8
3.428
0.991
195
95.1
3.445
0.996
Act
Tub
Archives of Insect Biochemistry and Physiology
110
Archives of Insect Biochemistry and Physiology, February 2010
Baseline and threshold values were automatically determined by the Biorad iQ5
Software 2.0 and a relative quantification strategy was performed (Hendriks-Balk
et al., 2007; Huggett et al., 2005; Spinsanti et al., 2006). To compare data obtained
from different experimental plates, the mean threshold value was calculated and then
manually set to analyze again the data. Starting from the same RNA samples, a second
set of cDNAs was performed; thus gene expression experiments were performed twice
to verify the reproducibility of data.
RESULTS
Features of C. capitata Putative-FAMeT Sequence
The complete cDNA sequence of putative-FAMeT in C. capitata is 646 bp long and
shows a poly(A)31 sequence at the 30 -end. A predicted coding region of 146 amino
acids, as well as 50 (102 bp) and 30 (75 bp) untranslated portions are present in this
sequence. Analysis of the 30 -untranslated cDNA sequence revealed the presence of
putative 30 -end formation signals: TATATA (‘‘efficiency element’’) and AAAAAA
(‘‘positioning element’’) (Fig. 1). Protein domain analysis revealed the presence of two
DM9 domains of 71 amino acids each, which cover positions 3–73 and 75–145 (Fig. 1).
Prosite database search allowed the identification of several functional sites along
the deduced amino acid sequence: three casein kinase II (CK2), three phosphorylation
sites (8-TTID-13, 97-SLGE-102, and 136-TNYE-141), and two N-myristoylation
sites (83-GAVPAG-90 and 88-GAVACG-95). No signal peptide was predicted (SignalP
3.0., Bendtsen et al., 2004) indicating that this protein is not secreted in the
hemolymph.
Analysis of Putative-FAMeT Deduced Protein
A BLAST search in the C. capitata Expressed Sequence Tags (ESTs) database using a
nucleotide query revealed that the gene had been previously isolated in this species
identified as UI-FF-IF0-aab-k-23-0-UI.r1 and that it had been isolated from an
embryo cDNA library of the medfly (GenBank accession no.: FG068732).
BLAST analysis of the complete amino acid sequence showed the highest amino
acid identities (61–66%) with possible orthologue sequences not yet described or
characterized in different Drosophila species (GenBank accession nos.: GI19977,
GK20771, GJ21230, GL11485, GH20307).
Regarding non-Drosophila sequences, the best matches were obtained with Culex
quinquefasciatus, Aedes aegypti, and Anopheles gambiae (GenBank accession nos.:
XP001866971, XP001661472 and XP316431, respectively) with an amino acid
identity of 54–55%. It is worthy to note that those sequences are different in length
compared to the C. capitata transcript due to the presence of four DM9 domains
that represent most of the sequences of each deduced protein. Among known
D. melanogaster transcripts, only one (GenBank accession no.: CG31086) shows two
DM9 domains (protein regions: 3–72 and 74–144) and 57% amino acid identity with
the medfly sequence.
Among sequences reported as FAMeT in GenBank, the highest identity (46–49%)
was found with a sequence of Anopheles darlingi (accession no.: ACI30085), Nasonia
vitripennis (accession no.: XP_001599775), and Bombix mori (accession no.:
NP_001091815), which also have two DM9 domains.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT
111
Figure 1. Nucleotide and deduced amino acid sequences of the C. capitata putative-FAMeT transcript.
Asterisk shows the first STOP codon in the ORF. Underlined sequence portions are the two DM9 domains.
Bold nucleotide sequences represent the ‘‘efficiency element’’ and the ‘‘positioning element.’’ Bold amino
acid sequences represent CKII phosphorylation sites.
The isolated transcript shows 19% amino acid similarity with the only
D. melanogaster FAMeT identified in Flybase (GenBank accession no. CG10527), which
is, among the known Drosophila sequences, the protein most similar to the well-known
crustacean FAMeT (Burtenshaw et al., 2008). The putative-FAMeT of C. capitata has
11–13% amino acid identity with the crustacean sequences present in GeneBank, while
that of D. melanogaster has 19–22%.
The putative-FAMeT of C. capitata shows 24% of amino acid identity with the two
isoforms of M. scutellaris (GenBank accession nos.: AM493718 and AM493719)
Archives of Insect Biochemistry and Physiology
112
Archives of Insect Biochemistry and Physiology, February 2010
described by Vieira et al. (2008). As observed for the Ceratitis sequence, the isoform 1
shows two DM9 domains (GenBank accession no.: smart00696) at the C-terminal,
although this isoform shared one CF domain at the N-terminal, which the medfly
sequence lacked.
Tissue Expression
In situ hybridization was performed with a DIG-labelled PCR probe on medfly LIII
sections in order to analyse tissue expression. The in situ hybridization revealed that the
putative-FAMeT mRNA is expressed in most of the observed tissues (Fig. 2C,F). This
datum was confirmed by a preliminary tissue expression analysis of FAMeT through
reverse transcriptase PCR, which permits verifying the transcript presence in the brain,
fat bodies, midgut, salivary glands, and carcass of medfly jumping larvae (data not
shown). No signals were detected in the sections hybridized with unlabelled putativeFAMeT gene (Fig. 2B,E) or with DIG-labelled unspecific DNA probe (Fig. 2A,D),
indicating the specificity of the signal.
Putative-FAMeT Pre-Metamorphosis Expression
Quantitative Real-Time PCR (relative quantification method) was used to quantify the
putative-FAMeT mRNA production in the entire body of C. capitata juvenile stages.
The O-methyl transferase is up- and down-regulated in defined stages and ages of the
pre-imaginal life. Its level was lowest in the homogenate of recently laid eggs (E/1:
0.004) and increased threefold at the end of embryonic development (E/2: 0.012)
(Fig. 3A). At the beginning of larval life, a consistent increase of gene expression (LI:
18.391) was observed and began to decrease at the second larval stage (LII: 14.227)
and went on to be down-expressed in the first third of LIII (LIII/2: 7.679). Twentyfour hours later, putative-FAMeT transcript levels up-surged to peak at the end of the
second third of the last larval stage (LIII/4: 54.746). At the end of the LIII stage, the
enzyme levels fell to the lowest value in immobile larvae (LIII/P: 1.424), which begin
pupating (Fig. 3B). Across the pupal stage (P/1–P/4), the expression of putativeFAMeT gene was characterized by relatively low levels with respect to the other stages,
with the lowest expression at the middle (P/3: 0.273) (Fig. 3C).
DISCUSSION
BLAST analysis does not completely clarify the identity of the isolated sequence because
the highest similarities obtained in GeneBank are with genes known as putative- or
FAMeT-like. Since the FAMeT gene seems to be fairly conserved among insects, gene
identification based only on its nucleotide or deduced amino acid sequence is difficult.
A domains and motif analysis is therefore necessary, as suggested for the M. scutellaris
FAMeT (Vieira et al., 2008). As reported for M. scutellaris FAMeT, the Ceratitis sequence
shows three CK2 phosphorylation sites, suggesting a similar biosynthetic pathway for
both genes. Moreover, the long crustacean FAMeT isoform has one CK2 phosphorylation site that is probably involved in the catalytic activity of the enzyme (Kuballa et al.,
2007). Like Crustacea and M. scutellaris sequences, the sequence in C. capitata does not
show any SAM-binding motif, which would allow S-adenosyl methionine binding in the
MF synthesis. As mentioned previously for crustaceans, C. capitata putative-FAMeT may
be a new sub-family of SAM-dependent methyl transferases (Silva Gunawardene et al.,
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT
113
Figure 2. Ceratitis capitata putative-FAMeT expression in sections of whole third instar larvae analysed by in
situ hybridization with DIG-labelled unspecific DNA probe (A,D), with unlabelled putative-FAMeT gene
probe (B,E), and with a DIG-labelled medfly putative-FAMeT gene probe (C,F). FAMeT probe binding is
evident in pharynx (Ph), muscle (M), brain (Br), gut (G), cuticle and epidermis (C). Scale bar 5 50 mm.
2001). More evidence of the homology with crustaceans comes from the in situ
hybridization and reverse transcriptase PCR (data not shown) analysis, which confirm
the ubiquitous expression of the C. capitata FAMeT in larval tissues. Prior findings on
the crustaceans Metapenaeus ensis, Cancer pagurus, and Litopenaeus vannamei reveal a
FAMeT expression in hepatopancreas, ovary, heart, epidermis, eyes, mandibular organ,
muscle, and central nervous system (Hui et al., 2008; Ruddell et al., 2003; Silva
Gunawardene et al., 2001, 2002). This supports the possibility that the gene is involved
in several physiological processes besides development, metamorphosis, and gametogenesis (Silva Gunawardene et al., 2002).
The deduced amino acid sequence of C. capitata putative-FAMeT contains two
DM9 domains identified through their homology with uncharacterized domains of
70 amino acids of a Drosophila gene family with a methyl transferase function
(Rosinski-Chupin et al., 2006). This supports the role of methyl transferase for
the isolated gene in the medfly. Moreover, two DM9 domains are present in the
FAMeT isoforms of M. scutellaris (Vieira et al., 2008) as well as in the putative-FAMeT of
Archives of Insect Biochemistry and Physiology
114
Archives of Insect Biochemistry and Physiology, February 2010
Figure 3. The putative-FAMeT transcriptional profile: (A) embryo, (B) larval stages, (C) pupal stage.
Vertical axis gives the ‘‘normalized expression values’’ relative to the two HKGs used (Act and Tub)7S.D. For
sample names, see Quantitative Real-Time PCR paragraph in Materials and Methods.
D. melanogaster (Burtenshaw et al., 2008). Both these genes also shared a CF domain at
the N-terminal related to ‘‘metal-binding’’ proteins (Vieira et al., 2008), which is
lacking in the medfly.
A D. melanogaster sequence (GenBank accession no. CG31086) with 57% identity
against the C. capitata amino acid sequence is known and has two DM9 domains
that make up most of the protein. Such protein has never been characterized but the
highest homology with the C. capitata sequence points out that it is probably the actual
D. melanogaster homolog of the putative-FAMeT reported here, rather than the
D. melanogaster putative-FAMeT (GenBank accession no. CG10527). A possible explanation for this might be that the putative-FAMeT protein isolated in D. melanogaster cannot
convert FA to MF (Burtenshaw et al., 2008) suggesting a different role for this gene.
Gene expression appears to be up- and down-regulated during imaginal life,
according to the literature on JH biosynthesis in Diptera. The expression of the
putative-FAMeT starts in the late embryo, peaks at the last larval stage of C. capitata, and
drastically decreases in the pupal stage. This is consistent with the JH profile in
Holometabola, which is necessarily lower in the pupal hemolymph in order to proceed
to the adult stage, and higher during larval life to prevent early adulthood (Hartfelder,
2000; Riddiford, 1994). In M. sexta and D. melanogaster, main examples of
holometabolous development (Riddiford, 1994), JH titer remains high in the first
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT
115
larval stages and decreases during the first third of the final larval instar to upsurge
again prior to pupation (Nijhout, 1994; Riddiford, 1994). In each Holometabola larval
stage, there is a JH-sensitive period concomitant with the moult-inducing ecdysone
peak, which serves to repress early adulthood. In the last larval stage, there is an
additional JH-sensitive period that occurs prior to the ecdysone moult-inducing peak
when the larva reaches its critical weight. It is early in the last larval instar that the
absence of JH is required to allow a switch to pupal determination (Nijhout, 1994). In
the FAMeT expression profile of LIII, there is no complete disappearance of the
FAMeT mRNA, but the lowest levels observed in the LIII/2 sample suggest that there
is a sharp decrease in the enzyme synthesis rate during the first third of the last larval
stage. The highest level of gene expression observed in LIII/4 provides evidence for a
sharp increase in the putative-FAMeT transcriptional rate reaching a peak between
LIII/3 and LIII/5. During the LIII stage of C. capitata, the two phases at which the
putative-FAMeT transcriptional level was lowest (LIII/2) and highest (LIII/4) can be
related to the JH-sensitive periods occurring at the last larval stage in Holometabola.
The putative-FAMeT expression in the pupal stage is always lower than in larval
stages and reaches the lowest expression in 4-day-old pupae (at the middle of the
stage). It is known that the main metabolizing enzymes in the D. melanogaster pupal
stage are JH esterases (Campbell et al., 1992), which cause a decline in JH titer to
undetectable levels.
Regardless of the fact that the sequence features of medfly putative-FAMeT are
difficult to interpret, the gene expression profile obtained in pre-imaginal life indicates
a likely functional role in JH biosynthesis. Ceratitis capitata is one of the most harmful
agricultural pests. To control this pest, insecticide treatments and sterile insect
technique (SIT) are widely used despite their limitations. In this context, a gene likely
to be linked to JH should not be underestimated especially in the light of a new
effective control strategy against this species based on JH biosynthesis interference.
ACKNOWLEDGMENTS
We thank Prof. M. Cristina Fossi (Department of Environmental Sciences, University
of Siena) for the use of the iCycler iQ Real-Time PCR Detection System. The work was
supported by grants from MIUR (PRIN 2006-2008) and the University of Siena
(P.A.R.). All experiments described in this work have been performed in compliance
with the current laws in Italy.
LITERATURE CITED
Bellés X, Martin D, Piulachs M-D. 2005. The mevalonate pathway and the synthesis of juvenile
hormone in insects. Annu Rev Entomol 50:181–199.
Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improved prediction of signal peptidesSignalP 3.0. J Mol Biol 16:783–795.
Burtenshaw SM, Su PP, Zhang JR, Tobe SS, Dayton L, Bendena WG. 2008. A putative farnesoic
acid O-methyltransferase (FAMeT) orthologue in Drosophila melanogaster (CG10527):
relationship to juvenile hormone biosynthesis? Peptides 29:242–251.
Campbell PM, Healy MJ, Oakeshott JG. 1992. Characterisation of juvenile hormone esterase in
Drosophila melanogaster. Insect Biochem Mol Biol 22:665–677.
Archives of Insect Biochemistry and Physiology
116
Archives of Insect Biochemistry and Physiology, February 2010
Chang ES. 1993. Comparative endocrinology of molting and reproduction: insects and
crustaceans. Annu Rev Entomol 38:161–180.
Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.
Diatchenko L, Chenchik L, Siebert PD. 1996. Suppression subtractive hybridization: a method
for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc
Natl Acad Sci USA 93:6025–6030.
Feyereisen R, Pratt GE, Hamnett AF. 1981. Enzymic synthesis of juvenile hormone in locust
corpora allata: evidence for a microsomal cytochrome P-450 linked methyl farnesoate
epoxidase. Eur J Biochem 118:231–238.
Hartfelder K. 2000. Insect juvenile hormone: from ‘‘status quo’’ to high society. Braz J Med Biol
Res 33:157–177.
Hendriks-Balk MC, Michel MC, Alewijnse AE. 2007. Pitfalls in the normalization of real-time
polymerase chain reaction data. Basic Res Cardio 102:195–197.
Huggett J, Dheda K, Bustin S, Zumla A. 2005. Real-time RT-PCR normalization; strategies and
considerations. Genes Immun 6:279–284.
Hui JH, Tobe SS, Chan S-M. 2008. Characterization of the putative farnesoic acid
O-methyltransferase (LvFAMeT) cDNA from white shrimp, Litopenaeus vannamei: evidence
for its role in molting. Peptides 29:252–260.
Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C, LangendijkGenevaux PS, Sigrist CJ. 2007. The 20 years of PROSITE. Nucleic Acids Res
36:D245–D249.
Kuballa AV, Guyatt K, Dixon B, Thaggard H, Ashton AR, Paterson B, Merritt DJ, Elizur A.
2007. Isolation and expression analysis of multiple isoforms of putative farnesoic acid
O-methyltransferase in several crustacean species. Gen Comp Endocrinol 150:48–58.
Malacrida AR, Gomulski LM, Bonizzoni M, Bertin S, Gasperi G, Guglielmino GR. 2006.
Globalization and fruitfly invasion and expansion: the medfly paradigm. Genetica 131:1–9.
Matsui T, Usuda N, Arai H, Nakazawa A, Matsushita S, Higuchi S, Sasaki H. 2000. Rapid
nonradioactive in-situ hybridization for mRNA detection of calcineurin in rat brain using
PCR DNA probe. Acta Histochem Cytochem 33:115–122.
Moshitzky P, Applebaum SW. 1995. Pathway and regulation of JHIII-bisepoxide biosynthesis in
adult Drosophila melanogaster corpus allatum. Arch Biochem Physiol 30:225–237.
Nijhout HF. 1994. The endocrine control of molting and metamorphosis. In: Insect hormones.
Princeton, NJ: Princeton University Press. p 89–141.
Rabossi A, Boccaccio GL, Wappner P, Quesada-Alluè LA. 1991. Morphogenesis and cuticular
markers during the larval-pupal transformation of the medfly Ceratitis capitata. Entomol Exp
Appl 60:135–141.
Riddiford LM. 1994. Cellular and molecular actions of juvenile hormone I. General
considerations and premetamorphic actions. Adv Insect Physiol 24:213–274.
Rosinski-Chupin I, Briolay J, Brouilly P, Perrot S, Gomez SM, Chertemps T, Roth CW, Keime C,
Gandrillon O, Couble P, Brey PT. 2006. SAGE analysis of mosquito salivary gland
transcriptomes during Plasmodium invasion. Cell Microbiol 9:708–724.
Ruddell CJ, Wainwright G, Geffen A, White MRH, Webster SG, Rees HH. 2003. Cloning,
characterization, and developmental expression of a putative-farnesoic acid O-methyl
transferase in the female edible crab Cancer pagurus. Biol Bull 205:308–318.
Silva Gunawardene YIN, Chow BKC, He JG, Chan SM. 2001. The shrimp FAMeT cDNA is
encoded for a putative enzyme involved in the methyl farnesoate (MF) biosynthetic pathway
and is temporally expressed in the eyestalk of different sexes. Insect Biochem Mol Biol
31:1115–1124.
Archives of Insect Biochemistry and Physiology
Medfly Putative-FAMeT
117
Silva Gunawardene YIN, Tobe SS, Bendena WG, Chow BKC, Yagi KJ, Chan S-M. 2002.
Function and cellular localization of farnesoic acid O-methyltransferase (FAMeT) in the
shrimp, Metapenaeus ensis. Eur J Biochem 269:3587–3595.
Spinsanti G, Panti C, Lazzeri E, Marsili L, Casini S, Frati F, Fossi CM. 2006. Selection of reference
genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies.
BMC Mol Biol 7:32.
Thompson JD, Gibson TJ, Plewniak F, Jeanmoungin F, Higgins DG. 1997. The CLUSTAL_X
windows interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Res 25:4876–4882.
Vieira CU, Bonetti AM, Simões ZLP, Maranhão AQ, Costa CS, Costa MCR, Siquieroli ACS,
Nunes FMF. 2008. Farnesoic acid O-methyltransferase (FAMeT) isoforms: conserved traits
and gene expression patterns related to caste differentiation in the stingless bee, Melipona
scutellaris. Arch Insect Biochem Physiol 67:97–106.
von Stein OD. 2001. Isolation of differentially expressed genes through subtractive suppression
hybridization. Methods Mol Biol 175:263–278.
Wang X-L, He R-F, He G-C. 2005. Construction of suppression subtractive hybridization
libraries and identification of brown planthopper-induced genes. J Plant Physiol 162:
1254–1262.
Xiong L, Lee MW, Qi M, Yang Y. 2001. Identification of defense-related rice genes by
suppression subtractive hybridization and differential screening. Mol Plant Microbe Interact
14:685–692.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
3
Размер файла
362 Кб
Теги
expressions, acid, capitatacharacterization, fame, pre, ceratitis, farnesoic, methyl, genes, life, imaginal, transferase, putative
1/--страниц
Пожаловаться на содержимое документа