close

Вход

Забыли?

вход по аккаунту

?

Expression of sequences homologous to htlv-i tax gene in the labial salivary glands of japanese patients with sjgren's syndrome.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM Volume 37
Number 4, April 1994, pp 545-550
01994, American College of Rheumatology
545
EXPRESSION OF SEQUENCES HOMOLOGOUS TO
HTLV-I tax GENE IN
THE LABIAL SALIVARY GLANDS OF
JAPANESE PATIENTS WITH
SJOGREN'S SYNDROME
TAKAYUKI SUMIDA, FUMIKO YONAHA, TOSHIRO MAEDA, YASUHIKO KITA, ITSUO IWAMOTO,
TAKA0 KOIKE, and SHO YOSHIDA
Objective. To address the question of whether the
human T cell leukemia virus type I (HTLV-I) gene is
associated with the etiology of Sjogren's syndrome (SS).
Methods. RNA expression of HTLV-I gag, pol,
env, and tax genes in labial salivary glands (LSGs) from
SS patients who were seronegative for antibodies to
HTLV-I was examined using reverse transcription and
polymerase chain reaction techniques.
Results. The HTLV-I tax gene, but not the
HTLV-I gag, pol, or env genes, was detected in LSG
samples from 4 of 14 patients (29%). The nucleotide
sequences of the HTLV-I pXIV region in these 4 patients' LSGs showed 100% homology to the HTLV-I
pXIV gene from the MT-2 cell line.
Conclusion. These findings suggest that products
encoding sequences homologous to the HTLV-I pXIV
gene in SS patients' LSGs might be candidates for selfantigen andor lead to activation of autoreactive T lymphocytes through trans-acting transcriptional activation.
Sjogren's syndrome (SS) is an autoimmune
disease characterized by lymphocytic infiltration into
lacrimal and salivary glands, leading to symptoms of
dry eyes and dry mouth (1). Immunohistologic studies
Supported by grants from the Japan Rheumatism Foundation and Uehara Memorial Foundation.
Takayuki Sumida, MD: Chiba University, Chiba, Japan;
Fumiko Yonaha, MD: Chiba University; Toshiro Maeda, MD:
Chiba University; Yasuhiko Kita, MD: Chiba University; Itsuo
Iwamoto, MD: Chiba University; Takao Koike, MD: School of
Medicine, Hokkaido University, Sapporo, Japan; Sho Yoshida,
MD: Chiba University.
Address reprint request to Takayuki Sumida, MD, The
Second Department of Internal Medicine, School of Medicine, Chiba
University, 1-8-1 Inohana, Chuo-ku, Chiba City, Chiba 260, Japan.
Submitted for publication February 3, 1993; accepted in
revised form September 7, 1993.
have clarified that the majority of infiltrating lymphocytes around the salivary glands are CD4-positive T
cells. We have reported that the repertoire of T cell
receptor V, gene on the infiltrating T cells from the
labial salivary glands (LSGs) of SS patients is not
restricted, but the V,2 and V,13 genes are predominantly expressed in the LSGs of these patients (2).
Furthermore, these Vp2- and VP13-positive T cells
expand polyclonally , but the junctional usage is relatively limited and an amino acid at position 106 in
complementarity-determining region 3 (CDR3) is conserved (3). These findings indicate that expanded T
cells in the LSGs of SS patients might recognize the
restricted epitope of antigen on major histocompatibility complexes (MHC).
While self-antigens in SS have not been identified, several observations (4-8) suggest that EpsteinBan- virus (4) and retroviruses such as human T cell
leukemia virus type I (HTLV-I) (5,6), human immunodeficiency virus type 1 (HIV-1) (7), and human intracisternal A-type retroviral particle (8) might be etiologically associated with SS. HTLV-I is an etiologic
agent of adult T cell leukemia (ATL) (9). A viral gene
pX encodes for p40'"", and it has been proposed that
this protein transactivates the viral long terminal repeat and, possibly, a variety of cellular genes, including interleukin-2 (IL-2), the IL-2 receptor (IL-2R), or
other lymphokines (10-12). Because these activated
cellular genes may have a role in the pathogenesis of
SS, we performed experiments to determine whether
the HTLV-I gene is associated with the etiology of SS.
PATIENTS AND METHODS
Patients. Fourteen S S patients were referred for
study at Chiba University Hospital. All of them met the
SUMIDA ET AL
546
Table 1. Oligonucleotide sequences used in polymerase chain reaction amplification
Primer
Position
Sequence (5' -+ 3')
5'-GAG
3'-GAG
5'-POL
3'-POL
S'-ENV/SG221
3'-ENVlSG221
5'-pXIV
3'-pXIV
5'-pXIVRI
3'-pXIV4RI
842-864
1354-1 316
3366-3385
3466-3484
519S58 18
6106-6125
1622-1639
7192-1809
1622-1639
1792-1809
CGACCGCCCCGGGGGTGGCCGCT
GGTACTGCAGGAGGTCTTGGAGG
CTTCACAGTCTCTACTGTGC
CGGCAGTTCTGTGACAGGG
CTCGAGCCCTCTATACCATG
GGATCCTAGGGTGGGAACAG
ATGCGCAAATACTCCCCC
ACGTGGGGCAGGAGGGGC
TCTAGAATTCATGCGCAA ATACTCCCCC
TCTAGAATTCACGTGGGGCAGGAGGGGC
criteria for a diagnosis of SS: keratoconjunctivitis sicca,
xerostomia, and mononuclear cell infiltration of the salivary
glands in lip biopsy samples (grade 4) (13).
Anti-HTLV-I antibody assay. Sera from the SS patients, from 14 healthy subjects, and from ATL patients were
tested for the presence of circulating antibodies specific for
HTLV-I antigens, including gag and env protein. The
particle-agglutination method, with commercial preparations
of disrupted whole viral particles (Serodia.HTLV-I; Fujirebio, Tokyo, Japan), was used.
Preparation of RNA and polymerase chain reaction
(PCR). Total RNA (5-10 pg) was prepared using RNAzol
solution (Biotecx, East Houston, TX), from lip biopsy
specimens including LSGs and peripheral blood lymphocytes (PBL) from the 14 SS patients and from lip biopsy
specimens from 14 healthy subjects. Lip biopsy specimens
were washed with phosphate buffered saline, frozen,
crushed into small pieces, then mixed with RNAzol solution.
Complementary DNA (cDNA) was synthesized from 5 pg of
RNA by AMV reverse transcriptase in a 20-4 reaction
mixture containing oligo(dT) primer.
Amplification was performed with Taq polymerase in
50 pl of standard buffer, using 0.2 pl of cDNA (corresponding to 50 ng of total RNA) with primers specific for HTLV-I
gag, pol, env, or tax genes. Primer sequences were obtained
from sequences published in the literature (14-16). Oligonucleotides were synthesized in a DNA synthesizer (Applied
Biosystems, Foster City, CA). The denaturing step was
carried out at 94°C for 1.5 minutes, the annealing step at 60°C
for 1.5 minutes, and the extension step at 75°C for 1 minute,
for 25 cycles in a DNA thermal cycler (Zymoreactor V2;
Atto Co. Ltd., Tokyo, Japan).
One-fifth of the samples was loaded on a 2% agarose
gel and hybridized with the 32P-labeled Sac I fragment of the
HTLV-I gene encoding the whole HTLV-I provirus genome
(16). As a positive control for the PCR assay, cDNA
(corresponding to 1 ng of total RNA) prepared from the
HTLV-I-infected MT-2 cell line (17) was used. To examine
the efficiency of each primer, the Sac I fragments of the
HTLV-I DNAs were serially diluted (corresponding to
1-10-' pg) and subjected to PCR with primers specific for
pXIV, gag, pol, or env genes.
DNA sequencing of HTLV-I pXIV region in lip tissues
from SS patients. The cDNAs encoding the HTLV-I pXIV
region in lip tissues from 4 SS patients were amplified using
PCR and the following primers: a 5'-pXIV primer with an
Eco RI cutting site (5'-TCTAGAATTCATGCGCAAATAC-
TCCCCC-3') and a 3'-pXIV primer with an Eco RI cutting
site (5'-TCTAGAATTCACGTGGGGCAGGAGGGGC-3').
The reaction was performed under the conditions described
above. PCR products were purified by phenol extraction,
precipitated with ethanol, and digested by excess amounts of
Eco RI restriction enzyme.
Fragments of expected sizes for the cDNA were
prepared for enrichment using low-melting-point agarose gel
electrophoresis. The recovered DNA fragments were ligated
to M13mp19 plasmids obtained by Eco RI digestion. Phages
were grown on TG-1 Escherichia coli cells. After hybridization with an HTLV-I probe (16), a single phage was allowed
to grow, and recombinant phage DNA was purified for DNA
sequence determination (by automated sequencing; Applied
Biosystems).
Preparation of genomic DNA and PCR. Genomic
DNA was prepared from LSGs and PBL from 2 SS patients
and 2 healthy subjects, using previously described methods
(18). One microgram of genomic DNA was used for PCR to
detect gag, pol, env, or tax gene. The reaction and the
Southern blot analysis were performed under the conditions
described above. Genomic DNA from the MT-2 cell line was
used as a positive control.
Statistical analysis. The chi-square test was used to
examine statistical significance.
RESULTS
Efficiency of primers specific for HTLV-I gag,
pol, env, and tax genes. To examine the efficiency of
primers specific for HTLV-I gag, pol, env, and cax
regions, the HTLV-I DNA were serially diluted (1lo-' pg) and subjected to PCR with individual sets of
primers specific for HTLV-I gag, pol, env, or pXIV
genes (Table 1). Each pair of primers yielded bands of
535 basepairs, 121 bp, 327 bp, and 188 bp (as visualized with ethidium bromide) by PCR, and the amplified
DNA was further confirmed by hybridization with a
radiolabeled HTLV-I probe.
Figure 1 shows that the pXIV, pol, and env
genes could be detected in up to lo-' pg of DNA with
32P-labeledHTLV-I probe, whereas the gag gene was
found with up to
pg of DNA. The radioactive
547
HTLV-I tax GENE EXPRESSION IN SS PATIENTS’ LSGs
TAX
GAG
POL
ENV
J
492 bp
--.
J
369
246
I 1 2 3
Figure 1. Efficiency of primers specific for human T cell leukemia virus type I (HTLV-I) g a g , pol, env, and tar genes. The
HTLV-I DNA were serially diluted
pg, as indicated) and subjected to polymerase chain reaction amplification with
primers specific for HTLV-I g a g , pol, env, and pXIV genes. Amplified DNA were separated on a 2% agarose gel and were
hybridized with 3ZP-labeled HTLV-I probe. DNA markers are shown to the right.
bands detected by primers for pXIV, pol, and env
pg of DNA (data not
genes were not detected in
shown). This indicates that the minimum amount of
DNA detectable by primers for the tax gene is the
same as that detectable by primers for the pol and env
genes.
Figure 2. Expression of human T cell leukemia virus type I pXIV gene in labial salivary glands from Sjogren’s
syndrome (SS) patients. Complementary DNA prepared from biopsy specimens from 14 SS patients (SjS 1-14) and 14
healthy control subjects (Cont. 1-14), from peripheral blood lymphocytes from SS patients 2, 3, 11, and 14 (PBL 2, 3,
11, and 14), and from the MT-2 cell line (positive control) were used for the polymerase chain reaction, with paired
primers specific for f a x (a), g a g (b), pol (c), and env (d) regions. DNA markers are shown to the right.
SUMIDA ET AL
548
5 ’ 1622
ATGCGCAAAT ACTCCCCCTT CCGAAATGGA TACATGGAAC CCACCCTTGG
HTLV-I :
SJS-2
;
__________ __________
________--
_ - _ _ _ _ _ _ _ _ ----------
SJS-3
:
SJs-11
:
SJS-14
:
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ - - - -_________ ---------_ _ _ _ _ _ _ _ _ _ __________ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ - - -____------_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _____-----___----------------
HTLV-G
;
-----A--Gc
--A------A
1112
---------- -G-c------
7809
SJS-3
:
CTTTCCCCCC CCATCACCTG GCCCCTCCTG CCCCACGT
--________ __________ __________ ________
- - _ _ _ _ - _ ____
________ __________ ________
SJS-11
:
---___-__
_ ___ _ _ - _ _ _ _
SJS-14
:
HTLV- I :
SJS-2
:
HTLV-n :
-A-----c--
3’
__________ ________
__________ __________ __________ ____-___
---___--A____ $--A_- _--A_-TA-A _ _ _ _ _ T--
Figure 3. Nucleotide sequences of human T cell leukemia virus
type I (HTLV-I) pXIV regions in the labial salivary glands from
Sjogren’s syndrome (SS) patients. The DNA sequences of HTLV-I
pXIV region in 4 SS patients (SJS-2, 3, 11, and 14) were compared
with the reported sequences of the HTLV-I from the MT-2 cell line
and the HTLV-I1 genes.
Expression of HTLV-I tan gene in LSGs from SS
patients. To investigate the expression of HTLV-I
gag, pol, env, and fax genes in the LSGs of SS
patients, total RNA was prepared from lip biopsy
specimens (from the 14 SS patients as well as the 14
normal subjects), cDNA were synthesized, and the
PCR was carried out. The first-strand cDNA prepared
from the MT-2 cell line were used as a positive control.
The amplified DNA products were then hybridized
with a 32P-labeledHTLV-I probe.
Figure 2 shows that sequences homologous to
HTLV-I fax region were detected in 4 (29%; SjS-2, 3,
1 1 , and 14) of the 14 lip biopsy samples, while genes
encoding gag, pol, and env regions were not expressed. Expression of the sequences homologous to
the tax region was absent in PBL from the same SS
patients as well as the lip biopsy samples from the 14
healthy individuals. The frequency of fax gene expres-
sion was higher in SS patient lip biopsy samples than
in those of healthy subjects ( p < o.05). Thus, gene
sequences homologous to the lax region were expressed specifically in the LSGs of the SS patients.
All SS patients and healthy subjects were seronegative, while ATL patients were uniformly seropositive, for antibodies to HTLV-I, by Serodia.HTLV-I
assay (data not shown).
Nucleotide sequences of HTLV-I pXIV regions in
LSGs from SS patients. To verify the genes detected by
amplification with primers specific for the fax region,
DNA sequences of the pXIV region in the LSGs from
4 SS patients (SjS-2,3, 1 1 , and 14) were determined by
the dideoxynucleotide method. Those sequences, as
well as the reported sequences of HTLV-I and
HTLV-I1 genes (14,19), are shown in Figure 3. The
nucleotide sequences from the 4 SS patients were the
same and had 100% homology to the HTLV-I pXIV
gene derived from the MT-2 cell line. There was 76%
sequence homology between the 4 SS patients and the
HTLV-11 gene. These results suggest that sequences
homologous to the HTLV-I pXIV region were the
same as those in the HTLV-I pXIV gene.
HTLV-I DNA in LSGs and PBL from SS patients
and healthy subjects. To examine HTLV-I DNA in the
genomic DNA from the LSGs and PBL of 2 SS
patients (SJS-2, and 3), PCR was performed using
primers specific for gag, pol, env, and fax genes. Table
2 shows that fax genes, but not gag, pol, or env genes,
were detected in lip biopsy tissues from the 2 SS
patients. In the PBL from these 2 patients, none of the
HTLV-I genes was found. There were no HTLV-I
genes in the lip biopsy and PBL samples from the 2
healthy subjects examined.
DISCUSSION
The RNA expression of HTLV-I gag, pol, env,
and tax genes in the labial salivary glands of SS
patients with no antibodies against HTLV-I was examined to determine the relationship of the HTLV-I
gene to SS. We obtained evidence that sequences
homologous to the HTLV-I faxregion are expressed in
29% of LSGs from SS patients and that HTLV-I gag,
pol, and env regions were not detected. Nucleotide
sequences of the HTLV-I pXIV region in LSGs of SS
patients demonstrated 100%homology to the HTLV-I
pXIV gene from the MT-2 cell line. Thus, sequences
homologous to the HTLV-I pXIV gene expressed in
the LSGs of SS patients were exactly the same as
those in the HTLV-I pXIV region. These findings
suggest that the HTLV-I fax gene present in the lip
HTLV-I tax GENE EXPRESSION IN SS PATIENTS' LSGs
tissues of the SS patients is not due to an infection with
the HTLV-I virus, but rather, represents either a
defective HTLV-I provirus (20), other exogenous retroviral infection, or a part of an endogenous retrovirus
bearing sequences homologous to 188 bp of the
HTLV-I pXIV gene.
Hall et a1 (20) demonstrated the presence of
HTLV-I provirus with a 5.5-kilobase deletion involving large regions of gag and env and all of pol in
samples of blood and cutaneous lesions from patients
with mycosis fungoides who were seronegative for
HTLV-I by both enzyme-linked immunosorbent assay
and Western blot analysis. The deleted HTLV-I provirus is likely to be an explanation for our findings,
because DNA encoding g a g , pol, and env (but not tax)
were not detected in the same salivary glands. It is not
clear why only 29% of the SS patients expressed the
pXIV gene in the salivary glands. We presume that it
may be due to the susceptibility to retroviral infection
or to the regulation of the expression of endogenous
retroviral genes.
Self-antigens recognized by autoreactive T cells
in SS have not been identified, but several observations suggest the possibility of a retroviral etiology in
SS (5-8,21). An endogenous retrovirus, named HTLVrelated endogenous sequence 1 (HRES-I), with an
open reading frame encoding 2 proteins, p15 and p25,
has been documented (22). The calculated molecular
mass of the translated amino acid sequence of p25 is 28
kd. An antibody specific for synthetic peptides pep
117-127 recognized an identical 28-kd protein in H9
human T cells and cross-reacted with HTLV-I gag p24
protein. Furthermore, sera from 10% of the SS patients studied contained significantly higher HRES- l
peptide binding activity; hence, HRES-l/p28 may
serve as an autoantigen eliciting autoantibodies that
are cross-reactive with HTLV-I gag antigens (21). In
addition, Shattles et a1 (6) reported that tissue sections
from 31% of 39 patients with primary SS contained an
epithelial cytoplasmic protein reactive with a monoclonal antibody to the p19 group-specific antigen (gag)
of HTLV-I. However, in the present study, gag proteins from both HTLV-I and HRES-1 are unlikely to
have been an autoantigen(s) because of the absence of
antibodies to HTLV-I, including gag (data not shown),
and the absence of genes encoding the gag region.
Tala1 et a1 (7), on the other hand, showed that
sera from 30% of patients with SS reacted against p24
( g a g ) but failed to react against gp41 or gp120 (env).In
our studies, all patients with SS were seronegative for
antibodies against HIV protein (data not shown),
suggesting that HIV gag may not be associated with
549
Table 2. HTLV-I DNA in LSG and PBL samples obtained from
SS patients and from healthy subjects*
HTLV-I DNA
Subject, tissue
SS patient 2
LSG
PBL
SS patient 3
LSG
PBL
Control subject 1
LSG
PBL
Control subject 2
LSG
PBL
MT-2 cell line
(positive control)
gag
PO1
env
tax
-
-
-
+
-
-
+
-
-
-
-
-
-
-
-
-
-
+
-
-
+
-
+
-
-
+
* HTLV-I = human T cell leukemia virus type I; LSG = labial
salivary gland; PBL = peripheral blood lymphocytes; SS = Sjogren's syndrome.
SS. But further experiments on the reactivity to HIV-1
p24 by Western blot analysis might be necessary to
elucidate the pathogenesis of HIV gag in SS. It is
possible that other endogenous retrovirus+ncoding
genes homologous to the HTLV-I pXIV region are
present in lip tissues of SS patients. However, the
absence of HTLV-I DNA in PBL from SS patients
suggests that the tax gene might not arise from endogenous retrovirus.
Transgenic mice expressing the HTLV-I tax
gene have been shown to develop exocrinopathy resembling that of SS (5). An HTLV-I pX gene has been
shown to encode ~40'""; it is a regulatory protein,
which usually localizes in the nucleus or the cytoplasm, but is rarely expressed on the cell surface (23).
Thus, it is possible that the p40'"" itself, which is
expressed in the LSGs, might be a candidate for
self-antigen in the progression of SS. Moreover, it is
known that p40'"" can transactivate the expression of
various cellular genes, such as IL-2, IL-2R, IL-3, IL-4,
and macrophage-colony-stimulating factor (1 0-12). It
has been reported that a single-point mutation in the
pXIV region results in a loss of transacting transcriptional activity, thereby indicating that p40'"" encoded
by the pXIV gene is responsible for the transcriptional
activation (24). Therefore, expression of the HTLV-I
pXIV gene supports the notion that ~40'"" might act as
a transactivator for T cell expansion.
In previous studies, we clarified that the V,2
and V,13 transcripts were overrepresented in the
labial salivary glands of SS patients (2). Nucleotide
sequences of V,2 and V,13 cDNA from the LSGs of
SUMIDA ET AL
550
SS patients revealed these T cells to be polyclonal, the
junctional usage relatively limited, and an amino acid
at position 106 in the CDR3 conserved (3). These
findings support the notion that expanded T cells in the
labial salivary glands might recognize the restricted
epitope of antigen on MHC. Establishment of autoreactive T cell clones from LSGs of SS patients will shed
light on the role of autoantigens in the progression
of ss.
ACKNOWLEDGMENTS
The HTLV-I gene encoding the entire HTLV-I provirus genome was kindly provided by Prof. M. Yoshida of
The Institute of Medical Science, The University of Tokyo.
We thank M. Ohara for her critical reading of the manuscript.
REFERENCES
1. Bloch KJ, Buchanan WW, Wohl MJ, Bunim JJ: Sjogren’s
syndrome: a clinical, pathological and serological study of
sixty-two cases. Medicine (Baltimore) 44:187-231, 1965
2. Sumida T, Yonaha F, Maeda T, Tanabe E, Koike T, Tomioka
H. Yoshida S: T cell receptor repertoire of infiltrating T cells in
lips of Sjogren’s syndrome patients. J Clin Invest 89:681-685,
1992
3. Yonaha F, Sumida T, Maeda T, Tomioka H, Koike T, Yoshida
S: Restricted junctional usage of T cell receptor Vp2 and Vp13
genes, which are overrepresented on infiltrating T cells in the
lips of patients with Sjogren’s syndrome. Arthritis Rheum
35:1362-1367, 1992
4. Saito I, Servenius B, Compton T, Fox RI: Detection of EpsteinBarr virus DNA by polymerase chain reaction in blood and
tissue biopsies from patients with Sjogren’s syndrome. J Exp
Med 169:2191-2198, 1989
5. Green JE, Hinrichs SH, Vogel J, Jay G: Enocrinopathy resembling Sjogren’s syndrome in HTLV-I tax transgenic mice.
Nature 341:72-74, 1989
6. Shattles WG, Brookes SM, Venables PJ, Clark DA, Maini RN:
Expression of antigen reactive with a monoclonal antibody to
HTLV-1 p19 in salivary glands in Sjogren’s syndrome. Clin Exp
Immunol89:4&51, 1992
7. Tala1 N, Dauphinee MJ, Dang H , Alexander SS, Hart DJ, Gamy
RF: Detection of serum antibodies to retroviral proteins in
patients with primary Sjogren’s syndrome (autoimmune exocrinopathy). Arthritis Rheum 33:774-781, 1990
8. Carry RF, Fermin CD, Hart DJ, Alexander SS, Donehower LA,
Luo-Zhang H: Detection of a human intracisternal A-type
retroviral particle antigenically related to HIV. Science 250:
1127-1 129, 1990
9. Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T,
Kinoshita K, Shirakawa S, Miyoshi I: Adult T-cell leukemia:
antigen in an ATL cell line and detection of antibodies to the
antigen in human sera. Proc Natl Acad Sci U S A 78:6476-6480,
1981
10. Maruyama M, Shibuya H, Harada H, Hatakeyama M, Seiki M,
Fujita T, Inoue J, Yoshida M, Taniguchi T: Evidence for
aberrant activation of the interleukin-2 autocrine loop by
HTLV-I encoded p40x and TYTi complex triggering. Cell
48:343-350, 1987
11. Cross SL, Feinberg MB, Wolf JB, Holbrook NJ, Wong-Staal F,
Leonard WJ: Regulation of the human interleukin-2 receptor
chain promoter: activation of a nonfunctional promoter by
transactivator gene of HTLV-I. Cell 49:47-56, 1987
12. Arai N, Nomura D, Villaret D, Malefigt RD, Seiki M, Yoshida
M, Minoshima S, Fukayama R, Maekawa M, Kudoh J, Shimizu
N, Yokota K, Abe E, Yokota T, Takebe Y, Arai K: Complete
nucleotide sequence of the chromosomal gene for human IL-4
and its expression. J Immunol 142:274-282, 1989
13. Chisholm DM, Mason DK: Labial salivary gland biopsy in
Sjogren’s disease. J CIin Pathol21:656-660, 1968
14. Reddy EP, Sandberg-Wollheim M, Mettus RV, Ray PE, Defreitas E , Koprowski H: Amplification and molecular cloning of
HTLV-I sequences from DNA of multiple sclerosis patients.
Science 243529-533, 1989
15. Greenberg SJ, Ehrlich GD, Abbott MA, Hurwitz BJ, Waldmann
TA, Poiesz BJ: Detection of sequences homologous to human
retroviral DNA in multiple sclerosis by gene amplification. Proc
Natl Acad Sci U S A 86:2879-2882, 1989
16. Seiki M, Hattori S, Hirayama Y, Yoshida M: Human adult
T-cell leukemia virus: complete nucleotide sequence of the
provirus genome integrated in leukemia cell DNA. Proc Natl
Acad Sci U S A 80:3618-3622, 1983
17. Yoshida M, Miyoshi I, Hinuma Y: Isolation and characterization of retrovirus from cell lines of human adult T-cell leukemia
and its implication in the disease. Proc Natl Acad Sci U S A
79:2031-2035, 1982
18. Hogan B, Costantini F , Lacy E: Engineering Mutant Mice:
Manipulation of the Mouse Embryo. Cold Spring Harbor, NY,
Cold Spring Harbor Laboratory Press, 1986
19. Shimotohno K, Takahashi Y, Shimizu N , Gojobori T , Golde
DW, Chen ISY, Miwa M, Sugimura T: Complete nucleotide
sequence of an infectious clone of human T-cell leukemia virus
type 11: an open reading frame for the protease gene. Proc Natl
Acad Sci U S A 82:3101-3105, 1985
20. Hall WW, Liu CR, Schneewind 0, Takahashi H, Kaplan MH,
Roupe G, Vahlne A: Deleted HTLV-I provirus in blood and
cutaneous lesions of patients with mycosis fungoides. Science
253:317-320, 1991
21. Banki K, Maceda J, Hurley E , Ablonczy E, Mattson DH,
Szegedy L, Hung C, Perl A: Human T-cell Iymphotropic virus
(HTLV)-related endogenous sequence, HRES-1, encodes a
28-kDa protein: a possible autoantigen for HTLV-I gag-reactive
autoantibodies. Proc Natl Acad Sci U S A 89:1939-1943, 1992
22. Perl A, Rosenblatt JD, Chen ISY, Divincenzo JP, Poiesz BJ,
Bever R, Abraham GN: Detection and cloning of new HTLVrelated endogenous sequences in man. Nucleic Acid Res 17:
68414854, 1989
23. Siomi H , Shida H, Nam SH, Nosaka T, Maki M, Hatanaka M:
Sequence requirements for nucleolar localization of human T
cell leukemia virus type I pX protein, which regulates viral RNA
processing. Cell 55197-209, 1988
24. Seiki M, Inoue J-I, Takeda T, Yoshida M: Direct evidence that
p4OX of human T-cell leukemia virus type is a trans-acting
transcriptional activator. EMBO J 5561-565, 1986
Документ
Категория
Без категории
Просмотров
0
Размер файла
587 Кб
Теги
expressions, patients, homologous, syndrome, labial, sjgren, tax, japanese, htlv, sequence, gland, salivary, genes
1/--страниц
Пожаловаться на содержимое документа