close

Вход

Забыли?

вход по аккаунту

?

Identification and Characterization of a Novel Retinoic Acid Response Element in Zebrafish cyp26a1 Promoter.

код для вставкиСкачать
THE ANATOMICAL RECORD 295:268–277 (2012)
Identification and Characterization of a
Novel Retinoic Acid Response Element
in Zebrafish cyp26a1 Promoter
JINGYUN LI,1 PING HU,1 KUI LI,1 AND QINGSHUN ZHAO1,2*
Model Animal Research Center, MOE Key Laboratory of Model Animal for Disease Study,
Nanjing University, Nanjing, China
2
Zhejiang Provincial Key Lab for Technology & Application of Model Organisms, School of
Life Sciences, Wenzhou Medical College, University Park, Wenzhou, China
1
ABSTRACT
Cyp26A1 is a major enzyme that controls retinoic acid (RA) homeostasis by metabolizing RA into bio-inactive metabolites. Previously, we demonstrated that zebrafish cyp26a1 promoter possesses two conserved RA
response elements (RAREs; proximal R1 and distal R2) in response to RA.
Here, we report that it contains a novel RARE (R3) lying between R1 and
R2. Mutagenesis analysis reveals that R3 works together with R1 and R2
to ensure the maximum RA inducibility of cyp26a1 promoter. Performing
electrophoretic mobility shift assay and chromatin immunoprecipitation
assay, we show that RA receptor alpha can bind the novel RARE. Creating
and analyzing transgenic zebrafish of Tg(cyp26a1-R3mut:eYFP)nju3/+ that
harbor enhanced yellow fluorescent protein reporter gene (eYFP) driven by
cyp26a1 promoter with mutated R3, we demonstrate that the reporter is
mainly expressed in tissues of endogenous RA independent but not regions
of RA dependent. Like Tg(cyp26a1:eYFP)nju1/+, which harbor eYFP driven
by wild-type cyp26a1 promoter, the reporter in Tg(cyp26a1R3mut:eYFP)nju3/+ responds to excessive RA dose dependently. However,
it is expressed in a significantly lower level than the reporter in Tg(cyp26a1:eYFP)nju1/+ in response to exogenous RA. Taken together, our
results demonstrate that zebrafish cyp26a1 promoter contains a novel
RARE that plays crucial roles in regulating cyp26a1 expression during
C 2011
early development of zebrafish. Anat Rec, 295:268–277, 2012. V
Wiley Periodicals, Inc.
Key words: zebrafish; cyp26a1; retinoic acid response element;
promoter; transgenic zebrafish; development
Retinoic acid (RA) plays crucial roles in vertebrate
embryogenesis. However, it could be a potent teratogen
if it is available to embryos in the wrong places or at the
wrong times. To prevent the specific tissues and cells
from inappropriate RA exposure, animals use Cyp26s
(Cytochrome P450, family 26) to convert RA into bioinactive polar forms (Niederreither and Dolle, 2008).
Three members of Cyp26 family (Cyp26A1, Cyp26B1,
and Cyp26C1) are characterized in vertebrates (Gu
et al., 2006; Hernandez et al., 2007). Cyp26A1 (Cytochrome P450, family 26, subfamily A, polypeptide 1) is
the major enzyme that involves the maintenance of RA
homeostasis during vertebrate early development
C 2011 WILEY PERIODICALS, INC.
V
Grant sponsor: Ministry of Science and Technology of China;
Grant numbers: 2007CB947101 and 2011CB943804; Grant
sponsor: The National Natural Science Foundation of China;
Grant number: 30871439; Grant sponsor: Natural Science
Foundation of Jiangsu Province; Grant number: BK2010390.
*Correspondence to: Qingshun Zhao, Model Animal Research
Center, Nanjing University, 12 Xuefu Road, Pukou High-tech
Development Zone, Nanjing 210061, China. Fax: þ86 25
58641500. E-mail: qingshun@nju.edu.cn
Received 11 June 2011; Accepted 5 September 2011.
DOI 10.1002/ar.21520
Published online 20 December 2011 in Wiley Online Library
(wileyonlinelibrary.com).
A NOVEL RARE IN ZEBRAFISH CYP26A1 PROMOTER
(Dobbs-McAuliffe et al., 2004). Cyp26A1 null mouse
embryos die during mid-late gestation, exhibiting a phenotype similar to wild-type embryos treated with
teratogenic doses of RA (Abu-Abed et al., 2001; Sakai
et al., 2001). In zebrafish, the mutant embryo with
cyp26a1 null mutation (giraffe) displays a phenotype
opposite to aldh1a2 mutated embryos (neckless or no
fin) that are depleted the major RA synthesis enzyme,
Aldh1a2 (Begemann et al., 2001; Grandel et al., 2002;
Emoto et al., 2005). When Cyp26A1/ mice are bred
into an Aldh1a2þ/ background, the Cyp26A1 null phenotypes are partially rescued (Niederreither et al.,
2002). These results suggest that Cyp26A1 is essential
to controlling RA levels during development.
Other than the specific substrate for Cyp26A1, RA is
also an inducer of the gene expression though certain
tissues express Cyp26A1 in a RA-independent manner
during embryogenesis (Dobbs-McAuliffe et al., 2004; Hu
et al., 2008). During gastrulation of zebrafish embryos,
the endogenous RA controls cyp26a1 expression in cells
within or adjacent to the presumptive hindbrain to
establish a robust RA gradient that assigns positional
identities of hindbrain rhombomeres (White et al., 2007).
At 24 hpf (hours post fertilization), endogenous RA
directs cyp26a1 expression in retina and anterior dorsal
spinal cord (Hu et al., 2008). When exposed with exogenous RA, embryos highly express cyp26a1 (DobbsMcAuliffe et al., 2004; Hu et al., 2008), suggesting that a
feedback mechanism is involved in the maintenance of
RA homeostasis by cyp26a1 in vertebrate embryogenesis
(Dobbs-McAuliffe et al., 2004).
It is known that RA regulates transcription through
binding to the heterodimers of retinoic acid receptors
(RARs) and retinoid-X-receptors (RXRs) that bind to RA
response elements (RAREs) in promoters of target genes
(Niederreither and Dolle, 2008). Previous researchers
have demonstrated that Cyp26A1 promoters in mouse,
human and zebrafish all contain two conserved DR5
RAREs, one lying in the proximal region (R1) and the
other lying in the distal region (R2). The two RAREs
function synergistically to provide maximal induction of
Cyp26A1 expression in response to RA (Loudig et al.,
2000; Loudig et al., 2005; Hu et al., 2008). In addition to
the two conserved RARE sites, a recent research
revealed that the Cyp26A1 promoter in rat owns a new
RARE site (R3) lying upstream of R2 and a half RARE
site (R4) lying between R1 and R2. The R3 and R4 work
together with R1 and R2 to enhance the inducibility of
Cyp26A1 expression in rat liver (Zhang et al., 2010). In
this study, we report that zebrafish cyp26a1 promoter
possesses a novel R3 site lying between R1 and R2. Both
in vitro and in vivo analyses demonstrate that the novel
RARE is essential for the promoter to respond to RA
signal.
MATERIALS AND METHODS
Plasmid Constructs and Dual Luciferase Assay
The firefly luciferase reporter constructs with different lengths or mutations of cyp26a1 regulatory sequence
were made from pGL-cyp26a1-2533 (Hu et al., 2008).
Truncated cyp26a1 promoters (cyp26a1-1735 and
cyp26a1-1490) were generated by PCR amplifications
with the primers containing SacI and NcoI sites, respectively. The forward primers were atccgagctcAACGCA
269
CTGCTTACTCAGAGGCA (for cyp26a1-1735) and atccga
gctcTCATGTACCGGTAACCTTGCTCT (cyp26a1-1490),
and the reverse primer is ggggtaccatggTTGAAGCGCGC
AACTGATCGCC. The promoter containing mutations of
R3 was generated by PCR amplification using QuikChange II-E Site-Directed Mutagenesis Kit (Stratagene,
La Jolla, CA). The primers used to generate cyp26a12533-R3mut fragment were AGGATGAAgttTGAAATGCg
ttGCAGGCACAC (forward) and GTGTGCCTGCaacGC
ATTTCAaacTTCATCCT (reverse). The R3 fragment was
generated by annealing two oligonucleotides with complementary 44 bp containing R3 RARE, SacI and SpeI
sites. The sequences were gagctcAGGATGAAAGGTGAAATGCAGGGCAGGCACACactagt (sense strand) and
actagtGTGTGCCTGCCCTGCATTTCACCTTTCATCCTga
gctc (antisense strand). The 146 bp fragment upstream
of zebrafish cyp26a1 translation start codon containing
its basal promoter (cyp26a1-146) was PCR amplified
using forward primer actagtAATTTATCTGAGGAAGTTA
and reverse primer ggggtaccatggTTGAAGCGCGCAACT
GATCGCC containing SpeI and NcoI sites, respectively.
Both R3 RARE and cyp26a1-146 were subcloned into
pGEM-T Easy vector (Promega, Madison, WI) and then
recombined to produce pGEM-T-R3-cyp26a1-146.
The amplified promoters (cyp26a1-1735, cyp26a11490, cyp26a1-2533-R3mut, and R3-cyp26a1-146) were
sequenced to confirm their identities and then recombined into pGL3 basic luciferase reporter vector
(Promega) between SacI and NcoI sites. The plasmids
were named pGL-cyp26a1-1735, pGL-cyp26a1-1490,
pGL-cyp26a1-2533-R3mut, and pGL-R3-cyp26a1-146,
respectively. To obtain pGL-cyp26a1-R2mut-R3mut, the
fragment containing mutated R2 was generated form
pGL-cyp26a1-2533-R2mut (Hu et al., 2008) by digesting
with NdeI and then recombined into pGL-cyp26a1R3mut.
The coding sequences of zebrafish rars and rxrs were
cloned by RT-PCR. The primers for cloning the nuclear
receptors were ATGTATGAGAGTGTGGATGTGAACCC
and TCATGGTGACTGTGTGGGCG (Q90271: raraa);
ATGTTCGACTGTATGGAGGCTC and TCACTGAGCTC
TTCCTCCG (Q91392: rarca); ATGCACCCGTCACTGCTGAG and TTATGTCATTTGGTGTGGAGC (A2T929: rxr
aa); GATCATGCCACTGAACAGGA and CCGTAATGAA
TGGGTTGGAC (Q90415: rxrab); GAGAGTCGGTGTGAA
CAGCA and CAGGGAGAATGTGGAGGAGA (Q7SYN5:
rxrba); TGGCCAGTCTAGTGTGCATC and AGAGGCTG
ACCAATTGCTGT (Q90417: rxrbb); CTTCTTTCATATTC
GTCCAAACA and GTGCGCTGGGGTTTATTTAC (Q90
416: rxrca); CCTCCAGGACAAGACCTGAC and TCGTC
TTTTCCCTGCCAATA (Q6DHP9: rxrcb). The amplified
genes were sequenced to confirm their identities and
then further PCR amplified by new primers that were
added sequences of XhoI recognition site and Kozak
sequence (ctcgagGCCACC) immediately before above forward primers, and the sequences of KpnI recognition
site immediately before above reverse primers, respectively. The modified sequences were finally recombined
into pcDNA3.1(Invitrogen, Carlsbad, CA) between XhoI
and KpnI or NotI sites to produce expression vectors of
the nuclear receptors for transfection study.
Dual luciferase assays were performed on 293T cells
(American Type Culture Collection, Manassas, VA) and
zebrafish embryos as reported previously (Hu et al.,
2008; Xu et al., 2009) using a commercial kit (Promega).
270
LI ET AL.
Briefly, 400 ng of tested promoter constructs, 8 ng of
renilla luciferase expression plasmid, and 100 ng of
zebrafish nuclear receptor expression vectors were cotransfected into one well of the 24-well plate using Lipofectamine 2000 (Invitrogen) for 6 hr. After transfection,
each well was changed with 500 lL DMEM containing
10% charcoal stripped serum (Invitrogen) and various
concentrations of all-trans RA or vehicle dimethylsulfoxide (DMSO; Sigma, St. Louis, MO). As to the assay on
zebrafish embryos, 125 pg tested promoter constructs
and 62.5 pg zebrafish RARab plus 2.5 pg renilla luciferase expression vector were co-microinjected into each
zebrafish embryo at 1–2-cell stage. DMSO or 100 nM RA
were then administrated to the embryo water immediately. The embryos were grown to 8 hpf. Three pools of
30 microinjected embryos were collected to detect luciferase activities. The luciferase activities were measured
using a plate-reading GloMax 96 Microplate Luminometer (Promega) 24 hr after the treatment (for the cells) or
at 8 hpf (for the embryos), respectively. Firefly luciferase
activity was normalized by dividing by the activity of
renilla luciferase. Relative luciferase activity was
described as the fold change of each treatment to control
experiment. Each treatment was repeated three times
with two independent transfections. Results were subjected to the Student’s t-test.
Electrophoretic Mobility Shift Assays
To perform EMSA, we first transfected 293T cells with
4 lg of pWI-Ef1a-RARab (previously named RARa2.B;
Perz-Edwards et al., 2001) or vehicle vector pWI-Ef1a in
100-mm dish using GenEscort II (Wisegen, Nanjing,
China). After transfection for 24 hr, the cells were collected and then subjected to isolate nuclear proteins
using the Nuclear Extract Kit (Active Motif, Carlsbad,
CA). The protein concentration of the nuclear extracts
was determined with BCA Protein Assay Kit (Pierce,
Rockford, IL) for EMSA. The 32 bp double-stranded
DNA fragment containing putative core sequences of R3
RARE was labeled with [c-32P]dATP as a probe by T4
polynucleotide kinase using Gel Shift Assay System Kit
(Promega). Binding reactions were performed in a 10 lL
buffer provided in the kit by incubating the labeled
probes (10,000 cpm) with 20 lg nuclear extracts at room
temperature for 20 min. For competition assay, 50-fold
molar excess of 22 bp non-specific SP1 DNA fragments,
300-fold molar excess of unlabeled R3, 300-fold molar
excess of unlabeled mutated R3 or 2 lg of the rabbit polyclonal antibody against RARa (Cat. #: sc-551X, human
origin, Santa Cruz, CA) were added to above buffer and
incubated for 20 min at room temperature before adding
the labeled R3. After incubation with the labeled R3 for
30 min at room temperature, the reaction mixture was
subjected to electrophoresis for 90 min under 12.5 V/cm
in 4% native acrylamide gel. The gel was placed on a
sheet of Whatman filter paper and covered with a plastic
wrap and was subjected to autoradiography for 5 days in
dark at 80 C.
Chromatin Immunoprecipitation (ChIP) Assay
To perform ChIP assay, we first recombined zebrafish
RARab coding sequence into pCMV-3Tag-7 vector (Stra-
tagene). The coding sequences of Myc tagged RARab
(Myc-RARab) and zebrafish RXRab were then subcloned
into the pBluescript SK(þ) vector (Stratagene) under T7
promoter direction. mRNAs of Myc-RARab and RXRab
were synthesized and capped in vitro using mMESSAGE
mMACHINE T7 Ultra Kit (Ambion, Austin, TX). About
2 nL of 0.1 ng/nL Myc-RARab mRNA and 0.1 ng/nL
RXRab mRNA were co-microinjected into zebrafish
embryos at 1–2-cell stage. The embryos were grown to 8
hpf for ChIP assay. ChIP analyses were performed using
EZ-ChIP Chromatin Immunoprecipitation Kit (Cat. #:
17-371, Millipore, Billerica, MA) following the manufacture’s instructions. Briefly, 300 of microinjected embryos
at 8 hpf (uninjected embryos were used as control) were
fixed with 1% formaldehyde to allow cross-linking of
macromolecules. 1 lg of anti-Myc Tag mouse monoclonal
antibody (Millipore, Cat. #: 05-724) or mouse IgG (Millipore, Cat. #: 17-731) was used for Myc IP or control IP,
respectively. The IP DNA was amplified by real-time
PCR with primers (forward: TGTGTCATGCGTGAGTATTCC; reverse: AGA GACAGGATGGCTCCAAA) for
detecting the zebrafish cyp26a1 promoter encompassing
the R3 RARE (1686 to 1575; R3N-112bp) or with primers (forward: GAGA GTTTGGAGCCGCTTCT; reverse:
CGCAGGTCTCCTCC TGTTA) for detecting the one
encompassing the R1 RARE (223 to 113; R1-111bp) as
a positive control. The Real-time PCR was performed
using an ABI 7300 detection system (Applied Biosystems, Foster City, CA) with SYBR green I reagents
(Takara, Katsushika, Tokyo, Japan). The relative enrichment of RARab on cyp26a1 R1 or R3 was calculated
using Fold Enrichment Method (Invitrogen) by normalizing the PCR signals obtained from ChIP with anti-Myc
Tag antibody to the signals obtained from control ChIP
with mouse IgG. Results were subjected to the Student’s
t-test.
Generation of Transgenic Zebrafish
To make a construct for generating transgenic zebrafish that express eYFP driven by cyp26a1-2533-R3mut,
we first digested pGL-cyp26a1-R3mut with SacI and
NcoI to get a 2533bp fragment containing the mutated
R3 and then ligated the fragment into the vector of
p2.5kcyp26a1pr_eYFP (Hu et al., 2008) between SacI
and NcoI sites. The construct was then digested from
p2.5kcyp26a1R3mut_eYFP with XhoI and BglII and
recombined into TSG (Zhao et al., 2008) between XhoI
and BglII sites. The resulting plasmid was named TSGcyp26a1-R3mut-eYFP.
To make transgenic zebrafish, one-cell zebrafish
embryos were microinjected with 1 nL of a DNA/RNA solution containing 25 ng/lL of TSG-cyp26a1-R3mut-eYFP
plasmid and 25 ng/lL of transposase mRNA synthesized
in vitro using pCS-TP (Kawakami et al., 2004) as a template with Message mMACHINE SP6 Kit (Ambion). The
microinjected embryos were incubated at 28.5 C and
examined for transient eYFP expression at 24 hpf under
a fluorescent dissecting microscope (MVX10; Olympus,
Tokyo, Japan). The embryos expressing eYFP ubiquitously (except in yolk) were raised to adults as
transgenic founders. The embryos at 24 hpf produced
from a founder and its wild-type partner were subjected
to screen YFP signal using the dissecting microscope.
A NOVEL RARE IN ZEBRAFISH CYP26A1 PROMOTER
The transgenic offspring (F1) was raised to sexual
maturity.
To examine responses of the reporter to altered RA
signaling, transgenic embryos were treated with 1 lM
RA from 24 hpf to 30 hpf. The images of embryos
expressing YFP were photographed under the MVX10
dissecting microscope equipped with a RetigaExit Fast
1394 CCD camera (Olympus). Embryos younger than 18
hpf were placed on a Petri dish to observe directly.
Embryos older than 18 hpf were anaesthetized by 0.1%
tricain (Sigma) before observation. Color micrographs
were pseudo-colored to yellow with Image-Pro Plus Version 6.2 software (Media Cybernetics, Bethesda, MD).
Quantitative PCR to Detect Integrated Copies
of eYFP in Transgenic Zebrafish Genomes and
Expression Levels of the Reporter in Transgenic Zebrafish Embryos
Genomic DNAs isolated from eYFP-positive transgenic
embryos at 24 hpf produced from a female wild-type
zebrafish mated by a male transgenic zebrafish were
used as template to detect integrated copies of eYFP in
transgenic zebrafish genomes whereas total RNAs isolated from the same batch of transgenic embryos at 24.5
hpf that had been treated with vehicle control or different amount of RA for 30 min were reverse-transcribed to
cDNA as templates for analyzing expression levels of the
reporter in transgenic embryos. Real-time PCR was performed using an ABI 7300 detection system (Applied
Biosystems, Foster City, CA) with SYBR green I
reagents (Takara). Primers for detecting 133 bp eYFP
genomic DNA fragment or cDNA reverse-transcribed
from eYFP mRNA were CGACCACTACCAGCAGAACA
(forward) and GAACTCC AGCAGGACCATGT (reverse).
Primers for detecting 116 bp zebrafish b-actin promoter fragment were AACACAA CACAGGATCATGGA
(forward) and CGTATTTTTCTGC GACAACG (reverse)
and for detecting zebrafish b-actin cDNA were CGAGCAGGAGATGGGAACC (forward) and CAACGGAAACGCTCATTGC (reverse). Efficiency of amplification and
detection were validated by determining the slope of CT
versus dilution series. The copy number of the transgene
was calculated by normalizing the amount of eYFP to
that of internal control b-actin promoter according to
standard procedures. Transcript level for eYFP was normalized to b-actin mRNA level according to standard
procedures and then further normalized by dividing the
integrated copy numbers of the transgene. Results were
subjected to the Student’s t-test.
RESULTS
The Truncated cyp26a1 Promoter Without the
Distal RARE has the Capacity to Respond to
RA In Vitro
Previously, we found that the zebrafish cyp26a1 promoter with mutated R2 is still RA inducible that cannot
be attributed to R1 (Hu et al., 2008). To confirm that the
promoter without R2 is able to respond to RA, we made
different truncated promoters (Fig. 1A) and then tested
their activities in 293T cells. As shown in Fig. 1B, the
truncated promoter without R2 (1735) showed a good
activity to 100 nM RA treatment though its activity was
271
significantly lower than that of the 2533 promoter.
However, the truncated promoter (1490) showed no
response to 100 nM RA treatment (Fig. 1B). To examine
whether the response of the truncated promoter without
R2 (1735) to RA is dose dependent, we tested the promoter activities with different concentrations of RA. As
shown in Fig. 1C, the promoter activities at 10 nM, 100
nM, and 1000 nM RA treatment were significantly
higher than control experiment (P < 0.05, P < 0.01, and
P < 0.01, respectively). Statistical analysis also revealed
that the promoter activity at 100 nM treatment was significantly higher than that at 10 nM treatment (P <
0.05) and that the promoter activity at 1,000 nM treatment was significantly higher than that at 100 nM
treatment (P < 0.05). Taken together, the results suggest
that some key sequences between 1735 and 1490
must play crucial roles in RA inducibility of the
promoter.
The Novel RARE is Required for the Maximum
RA Inducibility of cyp26a1
To identify the key sequences between 1735 and
1490 that are essential to the RA inducibility of the
promoter, we analyzed the 2533bp promoter of cyp26a1
using MatInspector (http://www.genomatix.de). We found
the promoter has a presumptive novel RARE site (R3)
between R1 and R2 (Fig. 2B). Like R1 and R2, the predicted R3 is also a DR5 RARE and its core sequences
are AGGTGAAATGCAGGGCA locating between 1644
and 1628 of the promoter. Different from R1 and R2
that are positioned in reverse directions (Hu et al.,
2008), R3 is present in forward direction.
To confirm the role of the predicted R3 in RA inducibility, we mutated the core sequences (Fig. 2A), and then
examined the promoter activity in 293T cells after 100
nM RA treatment. Like the R2-mutated promoter, R3mutated promoter exhibited a significantly reduced activity (P < 0.01) compared to the wild-type (WT)
promoter (Fig. 2C). The activity of the promoter with
mutated R2 and mutated R3 was significantly (P < 0.01)
lower than that of either R2-mutated promoter or R3mutated promoter (Fig. 2C). To test whether the R3 is
required for the activity of cyp26a1 promoter in zebrafish embryos, we microinjected the WT and R3mut
constructs into zebrafish embryos and then test the promoters’ activities in the embryos at 8 hpf. The results
showed that the activity of R3-mutated promoter was
significantly lower (P < 0.01) than that of wild-type promoter in the embryos either treated with vehicle DMSO
or 100 nM RA (Fig. 2D). These data demonstrate that
the R3 is required for the maximum RA inducibility of
cyp26a1 in both 293T cells and zebrafish embryos.
Zebrafish RARab can Bind to the R3 Element
In Vitro and In Vivo
To identify whether R3 is a functional RARE, we performed EMSA to check whether zebrafish RAR could
bind to this predicted RARE. To perform EMSA, we
radiolabeled the 32-bp oligonucleotides that contain core
sequences of R3 (32P-R3; Fig. 2A) and then incubated
the probe with nuclear proteins extracted from 293T
cells. Unlabelled oligonucleotides of R3, mutated R3 and
non-specific control were used as competitors of 32P-R3.
272
LI ET AL.
Fig. 1. The activity of the truncated promoter of zebrafish cyp26a1
without R2 is induced by RA in a concentration dependent manner. A:
Schematic diagram showing the truncated promoter fragments of
cyp26a1 driving firefly luciferase reporter gene. The first nucleotide
upstream start codon site is numbered as 1. The numbers (2533,
1735, and 1490) denote the position of first nucleotide of the
zebrafish cyp26a1 promoter upstream start codon site. Three RARE
sites are shown as different shaded rectangles. B: Dual luciferase activity assay showing the relative activities of the different promoters
were induced by 100 nM RA. C: Dual luciferase activity assay showing
that the activity of the 1735 promoter fragment was RA concentration dependent. *P < 0.05; **P < 0.01.
As shown in Fig. 3, a shift band was formed when the
probe of 32P-R3 was incubated with the nuclear proteins
extracted from 293T cells transfected with pWI-Ef1ararab to overexpress zebrafish RARab (Fig. 3A, Lane 3)
whereas the band was not seen when the probe was
incubated with the nuclear proteins extracted from 293T
cells transfected with vehicle vector (Fig. 3A, Lane 2).
The shift band was nearly gone (Fig. 3A, Lane 4, Lane
5) when the antibody that can recognize zebrafish
RARab was added to deplete the overexpressed RARab
or the unlabelled oligonucleotides of R3 was added to
compete with 32P-R3 though we do not know why the
non-specific band disappeared in Lane 5 after adding
the cold R3 oligos and why there was a new band
emerged in this lane (Fig. 3A, Lane 5). However, the
band was only reduced its intensity when mutated R3
was added to compete with 32P-R3 (Fig. 3A, Lane 6) and
it was not affected when non-specific control oligonucleotides were added to compete with 32P-R3 (Fig. 3A, Lane
7). The EMSA results demonstrate that zebrafish RARab
is able to bind R3 in vitro.
To further confirm that zebrafish RARab can bind to
R3 in vivo, we performed ChIP assay. Because the antibody against human RARa did not work in ChIP assay
(data not shown) and there is no ChIP grade antibody
against zebrafish RARab commercially available, we
added a Myc tag in the N-terminal of zebrafish RARab.
We then overexpressed Myc-tagged zebrafish RARab
into zebrafish embryos by microinjecting Myc-tagged
RARab mRNA. When the embryos reached 8 hpf, we
extracted nuclear proteins from the embryos and used
anti-Myc Tag antibody to do ChIP and real-time PCR
assay. The results showed that the fold enrichment value
of RARab on cyp26a1 R1 (a canonical RARE conserved
in vertebrates) is 1.25 in the WT control embryos and
2.55 in the Myc-RARab mRNA microinjected embryos
(Fig. 3B). Similarly, the fold enrichment value of RARab
on cyp26a1 R3 is 1.39 in the WT control embryos and
2.36 in the Myc-RARab mRNA microinjected embryos
(Fig. 3B). Statistical analyses on differences between the
fold enrichment values revealed that like binding to R1,
zebrafish RARab could significantly bind to R3 (P <
0.01).
RA Inducibility of the R3 Activity is Mediated
by Heterodimers of Zebrafish RAR and RXR
Zebrafish own three retinoic acid receptors (raraa,
rarab, and rarca) and six retinoid X receptors (rxraa,
A NOVEL RARE IN ZEBRAFISH CYP26A1 PROMOTER
273
Fig. 2. R3 in the 2533 bp promoter is required for RA inducibility of
zebrafish cyp26a1 gene. A: Sequences of wild-type and mutated
RAREs (R2 and R3) in zebrafish cyp26a1 promoter. The core sequences of wild-type RARE and mutated RAREs are underlined. B: Schematic diagram showing the different promoters of cyp26a1 driving
firefly luciferase reporter gene. WT: the 2533 bp promoter with wildtype R1, R2, and R3; R2mut: the 2533 bp promoter with mutated R2,
wild-type R1 and R3; R3mut: the 2533 bp promoter with mutated R3,
wild-type R1 and R2; R2mut/R3mut: the 2533 bp promoter with
mutated R2, mutated R3, and wild-type R1. C: Dual luciferase activity
assay showing that the relative of the different promoters were
induced by100 nM RA in 293T cells. **P < 0.01. D: Dual luciferase activity assay showing that the activity of cyp26a1 promoter with
mutated R3 is significantly lower than the wild-type promoter in zebrafish embryos at 8 hpf treated with either DMSO or 100 nM RA. **P <
0.01.
rxrab, rxrba, rxrbb, rxrca, and rxrcb; Waxman and
Yelon, 2007). To test whether all the nuclear receptors
involve RA induction of R3 activity, we made an expression vector by recombining the 32bp R3 with 146bp
zebrafish cyp26a1 basal promoter that drives firefly luciferase and then examined the reporter activities in
293T cells that were overexpressed with different nuclear receptors and treated with 100 nM RA. As shown
in Fig. 4, the R3 activity in the cells without receptors
transfected (control experiment) was similar (P > 0.05)
to the ones transfected with RARaa/RXRcb or RARca/
RXRba but significantly lower than (P < 0.01) the ones
transfected with the other 16 combinations of receptors
including RARaa/RXRaa, RARaa/RXRab, RARaa/RXRba,
RARaa/RXRbb, RARaa/RXRca, RARab/RXRaa, RARab/
RXRab, RARab/RXRba, RARab/RXRbb, RARab/RXRca,
RARab/RXRcb, RARca/RXRaa, RARca/RXRab, RARca/
RXRbb, RARca/RXRca, and RARca/ RXRcb. When
induced by 100 nM RA, the R3 activity in the cells transfected with RARaa/RXRcb or RARca/RXRba was similar
(P > 0.05) to the control experiment without receptors
transfected, but significantly lower (P < 0.01) than in
the cells transfected with the other 16 heterodimer
receptors. Furthermore, the R3 activity in the cells
transfected with all 18 heterodimer receptors or vehicle
control was induced to increase significantly (P < 0.05
or P < 0.01) by 100 nM treatment when compared with
DMSO treatment (Fig. 4). Taken together, the results
demonstrate that RARaa/RXRcb and RARca/RXRba do
not but the other 16 heterodimers of zebrafish RAR and
RXR do mediate R3’s response to RA signal.
R3 is Essential to RA Dependent Expression of
cyp26a1 Gene in Zebrafish Early Development
Previously, we reported that the 2533 bp promoter of
zebrafish cyp26a1 almost fully recapitulates endogenous
cyp26a1 expression (Hu et al., 2008). To identify the role
of R3 in the expression of zebrafish cyp26a1 at early development, we mutated R3 in the 2533bp promoter and
then fused the mutated promoter with the enhanced yellow fluorescent protein (eYFP) reporter gene to make
transgenic zebrafish lines. In total, we obtained three
transgenic zebrafish lines from three different founders.
Generally, the three lines of zebrafish [Tg(cyp26a1R3mut:eYFP)nju3/+;
Tg(cyp26a1-R3mut:eYFP)nju4/+;
Tg(cyp26a1-R3mut:eYFP)nju5/+] display similar expression patterns. Figure 5 shows the early expression
pattern of the reporter in the embryos [Tg(cyp26a1R3mut:eYFP)nju3/+] generated from a male transgenic
zebrafish founder mated with a female wild-type zebrafish. Initially, very weak reporter signals were detected
274
LI ET AL.
Fig. 3. The zebrafish RARab is able to bind to R3 element in vitro
and in vivo. A: EMSA was performed to identify that R3 can be bound
by zebrafish RARab. Nuclear proteins extracted from 293T cells that
were overexpressed with vehicle expression vector (pWI-Ef1a; Lane 2)
or zebrafish RARab expression vector (pWI-Ef1a-rarab; Lanes 3–7)
were incubated with 32P-labeled R3 RARE probe (Lanes 2–7). Antibody against human RARa (Lane 4) was added to depleted zebrafish
RARab, and 300-fold excess of unlabelled R3 (300 cold R3; Lane
5), 300-fold excess of unlabelled mutated R3 (300 cold mutant R3;
Lane 6), or 50-fold excess of non-specific DNA sequences (50 cold
non specific; Lane 7) were used to compete the binding to zebrafish
RARab with 32P-labeled R3. The free probe of 32P-labeled R3 was run
in Lane 1 as a control. In addition to non-specific binding bands
(Lanes 2–7), a shift band was formed when the nuclear protein con-
taining zebrafish RARab was incubated with 32P-labeled R3 (Lane 3).
The binding that forms the shift band was gone when adding antibody
against RARa (Lane 4) or 300-fold excess of unlabelled R3 (Lane 5),
but only reduced when adding 300-fold excess of unlabelled mutated
R3 (Lane 6), or even not affected when adding 50-fold excess of nonspecific DNA (Lane 7). B: ChIP – Real-time PCR assay showing the
fold enrichment of zebrafish RARab binding to cyp26a1 R3 and R1.
Myc tagged RARab (Myc-RARab) mRNAs plus with RXRab mRNAs
were co-microinjected into zebrafish embryos at 1–2-cell stage. The
ChIP analysis was performed on the embryos at 8 hpf. The relative
enrichment of RARab on cyp26a1 R1 or R3 was calculated by normalizing the PCR signals obtained from ChIP with anti-Myc Tag antibody
(Myc-RARab) to the signals obtained from control ChIP with mouse
IgG (WT). **P < 0.01.
Fig. 4. Effects of zebrafish RAR/RXR heterodimers on R3 activity in
response to RA treatment in 293T cells. Different heterodimers of
zebrafish RAR and RXR or vehicle control were overexpressed or
transfected in 293T cells, respectively. The relative luciferase activity of
R3 was induced by 100 nM RA or DMSO control. Units represent
ratios of firefly luciferase activity to control renilla luciferase activity for
each sample. The relative activity of R3 in the cells transfected with
vehicle vectors (no receptors) was normalized to 1.00. The statistical
significance of the difference between RA treatment and DMSO control for each tested RAR/RXR heterodimer was examined by Student’s
t-test.*P < 0.05; **P < 0.01.
Fig. 5. Expression pattern and RA inducibility of the reporter in early
development of transgenic zebrafish Tg(cyp26a1-R3mut:eYFP)nju3/þ.
Transgenic embryos were produced by a female wild-type zebrafish
mated with a male transgenic zebrafish of Tg(cyp26a1R3mut:eYFP)nju3/þ (A–G) or Tg(cyp26a1:eYFP)nju1/þ (H–K). Fluorescent images were photographed by a CCD camera with 2 sec (A–G) or
1 sec (H–K) exposure time, respectively. Embryos are laterally viewed
and positioned animal pole top (A), anterior top (B), or anterior left (C–
K). YFP reporter in Tg(cyp26a1-R3mut:eYFP)nju3/þ embryo was initially
detected at presumptive neural plate at 75% epiboly (A), the presumptive brain regions, somites and the tail bud at 11 hpf (B) and caudal
notochord, pharyngeal arches, presumptive jaw and some regions of
diencephalons at 24 hpf (C) or 30 hpf (D). The transgenic embryos produced from Tg(cyp26a1-R3mut:eYFP)nju3/þ (D–G) or Tg(cyp26a1:eYFP)nju1/þ (H–K) were treated with vehicle DMSO (D and H),
10 nM RA (E and I), 100 nM (F and J), or 1000 nM RA (G and K) for 6 hr
from 24 hpf to 30 hpf, respectively. The reporter in embryos from both
Tg(cyp26a1-R3mut:eYFP)nju3/þ (E–G) and Tg(cyp26a1:eYFP)nju1/þ (I–
K) were induced or increased its expression in forebrain, retina, presumptive jaw, anterior dorsal spinal cord, proctodeum, and mesoderm
of tail in a RA-dose dependent way. cn, caudal notochord; di, diencephalon; fr, forebrain; ja, presumptive jaw; mt, mesoderm of tail; pa, pharyngeal arches; re, retina; sc, anterior dorsal spinal cord. (L) Real-time
PCR results showing the relative copy number of integrated eYFP gene
in the genome of Tg(cyp26a1:eYFP)nju1/þ (Control) and Tg(cyp26a1R3mut:eYFP)nju3/þ (R3mut). The copy number of integrated eYFP gene
in the genome of Tg(cyp26a1-R3mut:eYFP)nju3/þ was normalized to 1.
(M) Real-time PCR results showing the relative level of eYFP mRNA in
embryos of Tg(cyp26a1:eYFP)nju1/þ (Control) and Tg(cyp26a1R3mut:eYFP)nju3/þ (R3mut) treated with vehicle DMSO, 10 nM RA, 100
nM or 1000 nM RA for 30 min from 24 hpf to 24.5 hpf, respectively. The
relative level of eYFP mRNA in embryos of Tg(cyp26a1:eYFP)nju1/þ
was divided by the fold (7) of its integrated eYFP copy number to that
of Tg(cyp26a1-R3mut:eYFP)nju3/þ. Results show that the cyp26a1 promoter with mutated R3 has a reduced response to RA signal compared
with wild-type cyp26a1 promoter in vivo.*P < 0.05; **P < 0.01.
276
LI ET AL.
from 75% epiboly (8 hpf) embryos at the presumptive
neural plate (Fig. 5A). At 11 hpf, the transgene signals
were mainly expressed at the presumptive brain regions,
somites and the tail bud (Fig. 5B). At 24 hpf, the reporter expression was mainly detected in caudal
notochord, pharyngeal arches, some regions of diencephalons and a presumptive jaw region (Fig. 5C) but not
in retina, anterior dorsal spinal cord and proctodeum in
which the reporter in Tg(cyp26a1:eYFP)nju1/þ is normally expressed in endogenous RA dependent way (Hu
et al., 2008). At 30 hpf, the expression of cyp26a1 was
maintained in a similar pattern to that in embryos at 24
hpf (Fig. 5D).
When the Tg(cyp26a1-R3mut:eYFP)nju3/þ embryos
were treated with different concentrations of RA for 6 hr
from 24 hpf to 30 hpf, the reporter was induced or
increased to express in forebrain, retina, presumptive
jaw, anterior dorsal spinal cord, proctodeum, and mesoderm of tail in a RA-dose dependent way (Fig. 5D–G).
The induced expression pattern was similar to Tg(cyp26a1:eYFP)nju1/þ embryos treated with different
concentrations of RA (Fig. 5H–K) though the reporter
expression level in the Tg(cyp26a1-R3mut:eYFP)nju3/þ
embryos was much weaker than that in the Tg(cyp26a1:eYFP)nju1/þ embryos.
However, the phenotype that the transgenic reporter
of Tg(cyp26a1-R3mut:eYFP)nju3/þ embryos was not
expressed in endogenous RA dependent regions (Fig.
5C,D) and lower response to excessive RA (Fig. 5E–G)
might be due to the fewer integrated copies of transgenic reporter in Tg(cyp26a1-R3mut:eYFP)nju3/þ than
in Tg(cyp26a1:eYFP)nju1/þ. To exclude the possibility,
we divided the mRNA levels of reporters in the two
transgenic zebrafish embryos by the number of integrated copies of reporters in genomes of the transgenic
zebrafish and then compared their relative expression
levels. Performing real-time PCR, we found the copy
numbers of the reporter in Tg(cyp26a1:eYFP)nju1/þ are
about 7 times as many as that in Tg(cyp26a1R3mut:eYFPnju)3/þ (Fig. 5L). Divided by the copy times
of the integrated transgene, the expression level per reporter copy in Tg(cyp26a1:eYFP)nju1/þ embryos was
significantly (P < 0.01) higher than that in Tg(cyp26a1R3mut:eYFP)nju3/þ embryos at 24.5 hpf when the
embryos had been treated with vehicle control or different concentrations of RA for 30 min, respectively (Fig.
5M). Consistent with the results from the promoter activity assay in 293T cells (Fig. 1), the activities of the
transgenic promoter with mutated R3 at 10 nM, 100 nM,
and 1,000 nM RA treatment were significantly higher
than control experiment (P < 0.05, P < 0.05, and P <
0.01, respectively; Fig. 5M). Statistical analysis also
revealed that its activity at 100 nM treatment was significantly higher than that at 10 nM treatment (P < 0.05)
and that the promoter activity at 1,000 nM treatment
was significantly higher than that at 100 nM treatment
(P < 0.01; Fig. 5M). Taken together, the results demonstrate that the cyp26a1 promoter with mutated R3 has a
reduced response to RA signal when compared with wild
type of cyp26a1 promoter in vivo.
DISCUSSION
Cyp26A1 is crucial to vertebrate early embryogenesis
by playing essential roles in maintaining RA homeosta-
sis in vivo (Abu-Abed et al., 2001; Sakai et al., 2001;
Dobbs-McAuliffe et al., 2004; Emoto et al., 2005). Previously, researches demonstrated that vertebrate Cyp26A1
contains two canonical RAREs (proximal R1 and distal
R2) that work synergistically to respond to RA signal
directly (Loudig et al., 2000; Loudig et al., 2005; Hu
et al., 2008). In addition to the two conserved RARE
sites, a recent research revealed that the rat Cyp26A1
promoter contains a new RARE site (R3) lying upstream
of R2 and a half RARE site (R4) lying between R1 and
R2 (Zhang et al., 2010). Here, we report that the zebrafish contains a third RARE (R3) in its cyp26a1 promoter
that is essential for the promoter to respond to RA signal both in vitro and in vivo.
A RARE is typically composed of two direct repeats of
the motif, PuG(G/T)TCA, or closely degenerate, separated by a 1-base pair (bp), 2-bp, or 5-bp spacer (DR1,
DR2, or DR5), respectively. Like R1 and R2, R3 in both
zebrafish and mammalian Cyp26A1 is also a DR5 element. However, these RAREs are positioned in different
direction in chromosomes. In mammals, R1 in Cyp26A1
is positioned in reverse direction whereas both R2 and
R3 are present in forward direction (Zhang et al., 2010).
In contrast, zebrafish R3 in cyp26a1 is positioned in forward direction whereas R1 and R2 are positioned in
reverse directions (Hu et al., 2008). The different orientation of these elements relative to the promoter region
correspond their roles in controlling the species-specific
expression of Cyp26A1 gene in mammals or fish.
Previously we reported that the 2533 bp promoter of
zebrafish cyp26a1 almost fully recapitulates controlling
endogenous expression of cyp26a1 (Hu et al., 2008). Bioinformatics analysis on the sequences up to 3500 bp
upstream of zebrafish cyp26a1 start codon reveal that no
RARE are present upstream to R2. The results suggest
R2 is the distal one and R1 is the proximal among the
three RAREs in zebrafish cyp26a1 promoter. In contrast,
R3 is the distal one and R1 is the proximal one in mammalian Cyp26A1 promoter (Zhang et al., 2010). However,
the core sequences of R3 in mammalian Cyp26A1 promoter is the same as R2 in the zebrafish cyp26a1
promoter though the two RAREs are positioned in different direction. And the core sequences of R2 in
mammalian Cyp26A1 promoter are more identical with
that of zebrafish R3 than that of zebrafish R2 in
cyp26a1 promoter. Additionally, the R2 and R3 double
mutated promoter of zebrafish cyp26a1 is still RA
responsive (Fig. 2), suggesting there might be other
RAREs present in the promoter. This is consistent with
the presence of a half RARE site (R4) lying between R1
and R2 in mammalian Cyp26A1 promoter. Taken
together, our results suggest that the key cis-elements
such as RAREs are conserved in the Cyp26A1 promoter
of mammals and fish during evolution.
It has been demonstrated in vitro that the multiple
RAREs in rat Cyp26a1 promoter work together to maximize the gene’s response to RA signal (Zhang et al.,
2010). However, Cyp26A1 responds to RA status differently in different tissues. It is highly responsive to RA
level in liver but not in other tissues such as intestine,
lung, and kidney (Ray et al., 1997; Wang et al., 2002; Xi
and Yang, 2008; Zhang et al., 2010). ChIP assays reveal
that both proximal and distal RAREs contribute significantly to the activity of Cyp26A1 promoter in HepG2
cells (from human adult liver) in response to RA whereas
A NOVEL RARE IN ZEBRAFISH CYP26A1 PROMOTER
only the proximal, but not the distal RARE of the
promoter in HEK293T cells (from human embryonic kidney) in response to RA (Zhang et al., 2010). The results
indicate that different RAREs may play different roles
in the activity of a gene’s promoter in response to RA in
different tissues. In this study, our in vitro assay shows
that R3 works with R2 and R1 to maximize the response
of zebrafish cyp26a1 promoter to RA treatment (Fig. 2).
Consistently, our in vivo assays reveal that the reporter
driven by cyp26a1 promoter with mutated R3 in
Tg(cyp26a1-R3mut:eYFP)nju3/þ is not expressed in the
tissues of RA dependent during zebrafish early development but responds to excessive RA in a dose dependent
manner though much more weakly than the reporter
driven by wild-type promoter in Tg(cyp26a1:eYFP)nju1/þ
(Fig. 5). The results suggest that R3 is a key cis-element
that controls cyp26a1’s expression in response to endogenous RA at zebrafish early development. The mutation of
R3 in cyp26a1 promoter would abolish the expression of
cyp26a1 in the regions of retina, anterior dorsal spinal
cord, and proctodeum where cyp26a1 expression is
required to limit RA activity. Therefore, the mutation of
R3 could break RA homeostasis in the specific developmental organs and cause zebrafish embryos to develop
abnormally due to RA toxicity. Taken together, our results
demonstrate that R3 is crucial for zebrafish cyp26a1 to
respond to endogenous RA level during zebrafish early
development.
LITERATURE CITED
Abu-Abed S, Dolle P, Metzger D, Beckett B, Chambon P, Petkovich
M. 2001. The retinoic acid-metabolizing enzyme, CYP26A1, is
essential for normal hindbrain patterning, vertebral identity, and
development of posterior structures. Genes Dev 15:226–240.
Begemann G, Schilling TF, Rauch GJ, Geisler R, Ingham PW. 2001.
The zebrafish neckless mutation reveals a requirement for raldh2
in mesodermal signals that pattern the hindbrain. Development
128:3081–3094.
Dobbs-McAulie B, Zhao Q, Linney E. 2004. Feedback mechanisms
regulate retinoic acid production and degradation in the zebrafish
embryo. Mech Dev 121:339–350.
Emoto Y, Wada H, Okamoto H, Kudo A, Imai Y. 2005. Retinoic acidmetabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Dev Biol 278:
415–427.
Grandel H, Lun K, Rauch GJ, Rhinn M, Piotrowski T, Houart C,
Sordino P, Kuchler AM, Schulte-Merker S, Geisler R, Holder N,
Wilson SW, Brand M. 2002. Retinoic acid signalling in the zebrafish embryo is necessary during pre-segmentation stages to pattern the anterior-posterior axis of the CNS and to induce a
pectoral fin bud. Development 129:2851–2865.
Gu X, Xu F, Song W, Wang X, Hu P, Yang Y, Gao X, Zhao Q. 2006.
A novel cytochrome P450, zebrafish Cyp26D1, is involved in metabolism of all-trans retinoic acid. Mol Endocrinol 20:1661–1672.
277
Hernandez RE, Putzke AP, Myers JP, Margaretha L, Moens CB.
2007. Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development 134:
177–187.
Hu P, Tian M, Bao J, Xing G, Gu X, Gao X, Linney E, Zhao Q.
2008. Retinoid regulation of the zebrafish cyp26a1 promoter. Dev
Dyn 237:3798–3808.
Kawakami K, Takeda H, Kawakami N, Kobayashi M, Matsuda N,
Mishina M. 2004. A transposon-mediated gene trap approach
identifies developmentally regulated genes in zebrafish. Dev Cell
7:133–144.
Loudig O, Babichuk C, White J, Abu-Abed S, Mueller C, Petkovich
M. 2000. Cytochrome P450RAI(CYP26) promoter: a distinct composite retinoic acid response element underlies the complex regulation of retinoic acid metabolism. Mol Endocrinol 14:1483–1497.
Loudig O, Maclean GA, Dore NL, Luu L, Petkovich M. 2005. Transcriptional co-operativity between distant retinoic acid response
elements in regulation of Cyp26A1 inducibility. Biochem J 392:
241–248.
Niederreither K, Abu-Abed S, Schuhbaur B, Petkovich M, Chambon
P, Dolle P. 2002. Genetic evidence that oxidative derivatives of
retinoic acid are not involved in retinoid signaling during mouse
development. Nat Genet 31:84–88.
Niederreither K, Dolle P. 2008. Retinoic acid in development:
towards an integrated view. Nat Rev Genet 9:541–553.
Perz-Edwards A, Hardison NL, Linney E. 2001. Retinoic acid-mediated gene expression in transgenic reporter zebrafish. Dev Biol
229:89–101.
Ray WJ, Bain G, Yao M, Gottlieb DI. 1997. CYP26, a novel mammalian cytochrome P450, is induced by retinoic acid and defines a
new family. J Biol Chem 272:18702–18708.
Sakai Y, Meno C, Fujii H, Nishino J, Shiratori H, Saijoh Y, Rossant
J, Hamada H. 2001. The retinoic acid-inactivating enzyme CYP26
is essential for establishing an uneven distribution of retinoic
acid along the anterio-posterior axis within the mouse embryo.
Genes Dev 15:213–225.
Wang Y, Zolfaghari R, Ross AC. 2002. Cloning of rat cytochrome
P450RAI (CYP26) cDNA and regulation of its gene expression by
all-trans-retinoic acid in vivo. Arch Biochem Biophys 401:235–243.
Waxman JS, Yelon D. 2007. Comparison of the expression patterns
of newly identified zebrafish retinoic acid and retinoid X receptors. Dev Dyn 236:587–595.
White RJ, Nie Q, Lander AD, Schilling TF. 2007. Complex regulation of cyp26a1 creates a robust retinoic acid gradient in the
zebrafish embryo. PLoS Biol 5:e304.
Xi J, Yang Z. 2008. Expression of RALDHs (ALDH1As) and CYP26s
in human tissues and during the neural dierentiation of P19
embryonal carcinoma stem cell. Gene Exp Patterns 8:438–442.
Xu F, Li K, Tian M, Hu P, Song W, Chen J, Gao X, Zhao Q. 2009.
N-CoR is required for patterning the anterior-posterior axis of
zebrafish hindbrain by actively repressing retinoid signaling.
Mech Dev 126:771–780.
Zhang Y, Zolfaghari R, Ross AC. 2010. Multiple retinoic acid
response elements cooperate to enhance the inducibility of
CYP26A1 gene expression in liver. Gene 464:32–43.
Zhao L, Zhao X, Tian T, Lu Q, Skrbo-Larssen N, Wu D, Kuang Z,
Zheng X, Han Y, Yang S, Zhang C, Meng A. 2008. Heart-specific
isoform of tropomyosin4 is essential for heartbeat in zebrafish
embryos. Cardiovasc Res 80:200–208.
Документ
Категория
Без категории
Просмотров
4
Размер файла
476 Кб
Теги
acid, elements, promote, response, retinoic, characterization, identification, novem, zebrafish, cyp26a1
1/--страниц
Пожаловаться на содержимое документа