close

Вход

Забыли?

вход по аккаунту

?

Infection with an intestinal helminth parasite reduces Freund's complete adjuvantinduced monoarthritis in mice.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 63, No. 2, February 2011, pp 434–444
DOI 10.1002/art.30098
© 2011, American College of Rheumatology
Infection With an Intestinal Helminth Parasite Reduces
Freund’s Complete Adjuvant–Induced Monoarthritis in Mice
Meiqing Shi, Arthur Wang, David Prescott, Christopher C. M. Waterhouse, Shuren Zhang,
Jason J. McDougall, Keith A. Sharkey, and Derek M. McKay
Objective. Assessment of infection with helminth
parasites in murine models of disease could identify
antiinflammatory mechanisms that translate into treatments for arthritic disease. The aim of this study was to
test the ability of infection with the tapeworm Hymenolepis diminuta to ameliorate Freund’s complete adjuvant
(CFA)–induced monoarthritis in mice.
Methods. Mice received CFA with or without
H diminuta, and knee swelling, pain, and measures of
inflammation were assessed.
Results. Injection of CFA resulted in rapid
(within 24 hours) and sustained (lasting 20 days) knee
swelling, a decreased pain threshold, increased blood
flow to the knee, and increased production of tumor
necrosis factor ␣ and interleukin-12p40 (IL-12p40). In
mice that were infected with H diminuta 8 days prior to
receiving CFA, the severity of arthritis was reduced as
assessed by these indices of inflammation and infection
2 days after CFA injection and resulted in more rapid
resolution of knee swelling. This antiarthritic effect
required a viable infection and was dependent on adaptive immunity, because infection with H diminuta did not
protect mice lacking T cells and B cells or the IL-4
receptor ␣ chain from CFA-induced inflammation.
Interleukin-10 was of prime importance in the antiarthritic effect, because IL-10–knockout mice were not
protected by infection, the antiarthritic effect was ablated by use of neutralizing IL-10 antibodies, and transfer of CD4ⴙ cells from infected wild-type mice but not
IL-10–knockout mice significantly reduced CFAinduced knee swelling.
Conclusion. In mice, the adaptive immune response to infection with H diminuta involves mobilization of IL-10, which has the concomitant advantage of
dampening the innate immune responses that drive
CFA-induced joint inflammation.
There have been rapid increases in the incidence
of autoimmune and inflammatory diseases such as diabetes, inflammatory bowel disease, and rheumatoid arthritis (RA) in Westernized societies (1). Inflammatory
joint diseases are painful disorders that are particularly
prevalent in the elderly; with life expectancies increasing, an ever larger proportion of the population will be
affected by arthritis (2,3). Current treatments aimed at
symptom relief can be effective in some patients, but
they elicit undesirable side effects (e.g., steroids) or are
expensive (e.g., anti–tumor necrosis factor ␣ [antiTNF␣]). Thus, there is an urgent need to develop better
therapeutics to manage and ultimately cure arthritis and
related musculoskeletal disorders.
Chronic inflammation is often the result of an
imbalance in the production of proinflammatory and
antiinflammatory/proresolution mediators, and the reason(s) for this imbalance frequently are poorly understood. Therefore, rather than attempting to specifically
intervene in the activity of a given molecule, the question arises: can the immune system be provoked to
Supported by an operating grant from the Canadian Institutes
for Health Research to Drs. McDougall, Sharkey, and McKay (MOP218990). Mr. Prescott is recipient of doctoral awards from the Alberta
Heritage Foundation for Medical Research and the Natural Sciences
and Engineering Research Council of Canada. Dr. McDougall is an
Arthritis Society of Canada Investigator and an Alberta Heritage
Foundation for Medical Research Senior Scholar. Drs. Sharkey and
McKay are recipients of Scientist Awards from the Alberta Heritage
Foundation for Medical Research. Dr. Sharkey holds the Crohn’s and
Colitis Foundation of Canada Chair in Inflammatory Bowel Disease
Research at the University of Calgary. Dr. McKay holds a Tier 1
Canada Research Chair in Intestinal Immunophysiology in Health and
Disease at the University of Calgary.
Meiqing Shi, PhD, Arthur Wang, MD, MSc, David Prescott,
BSc, Christopher C. M. Waterhouse, MD, PhD, Shuren Zhang, MD,
Jason J. McDougall, PhD, Keith A. Sharkey, PhD, Derek M. McKay,
PhD: University of Calgary, Alberta, Canada.
Address correspondence to Derek M. McKay, PhD, HSc
1877, Department of Physiology and Pharmacology, University of
Calgary, 3330 Hospital Drive NW, Calgary, Alberta T2N 4N1, Canada.
E-mail: dmckay@ucalgary.ca.
Submitted for publication August 13, 2010; accepted in
revised form October 12, 2010.
434
HELMINTH INHIBITION OF JOINT INFLAMMATION
produce antiinflammatory signals that would downregulate joint inflammation? Proof-of-principal studies
with murine models of colitis, airway inflammation,
diabetes, allergic responses, and experimental autoimmune encephalitis (4–6) have shown that infection
with helminth parasites can protect against concomitant
disease. These studies have been complemented by 2
small clinical trials that provided the provocative findings that some patients with colitis treated with viable
ova of the pig whipworm, Trichuris suis, had amelioration of their disease activity (7). This approach has not
been widely applied to models of arthritis. According to
a serendipitous observation 35 years ago, rats infected
with the nematode parasite Syphacia oblevata were less
susceptible to adjuvant-induced arthritis (8); a mechanism of protection was not presented.
Our group observed that mice infected with the
rat tapeworm Hymenolepis diminuta were protected
against chemically induced colitis (9). Because arthritis
is often an extraintestinal manifestation associated with
colitis (10), and given that current treatments for arthritis and colitis often target the same pathway (11,12), we
reasoned that infection with H diminuta could exert an
antiarthritic effect. Here we show that mice infected
with H diminuta experience significantly less joint inflammation following intraarticular injection of Freund’s
complete adjuvant (CFA) compared with noninfected
CFA-treated mice, and that interleukin-10 (IL-10) and
CD4⫹ T cells are important components of the antiarthritic effect. Thus, mobilization of an adaptive immune
response to combat infection with a tapeworm has the
advantage of down-regulating the innate immune responses that drive joint inflammation in the murine
model of CFA-induced monoarthritis.
MATERIALS AND METHODS
Animals. Male 7–9-week-old BALB/c mice, C57BL/6
mice (Charles River), NOD/SCID mice (BALB/c background;
The Jackson Laboratory), IL-10–knockout mice (C57BL/6
background; breeding pairs were from The Jackson Laboratory), and IL-4 receptor ␣ chain (IL-4R␣)–knockout mice
(BALB/c background; breeding pairs were a gift from Dr. F.
Brombacher, University of Capetown, Capetown, South Africa) (13) were housed with free access to food and water. This
study conformed to the Canadian Guidelines for the use of
animals in biomedical research.
Arthritis induction and H diminuta infection. Fur was
removed from the knees of anesthetized mice using hair
removal lotion (Nair; Church & Dwight Canada), and CFA
(Sigma) was injected into the articular joint space via a
30G1/2-gauge needle, as previously described (14,15).
Mice were infected with H diminuta (10 cysticercoids in
435
100 ␮m phosphate buffered saline [PBS]) 8 days prior to the
administration of CFA (i.e., a time when the helminths are
being expelled from the mouse) (16); we have used this dose in
other experiments, and it is known to elicit a reproducible
immune response in mice (9). Additional mice were gavaged
with 10 H diminuta cysticercoids that had been destroyed by
sonication and boiled for 10 minutes. In other experiments,
mice received CFA and 2 days later were infected with
H diminuta. Other mice were infected with H diminuta and
28 days later received CFA with or without a simultaneous
secondary infection or PBS as a control (by this time, immunologic memory against H diminuta has been generated) (16).
Some mice were treated with indomethacin (250 ␮g/
mouse) (17) or dexamethasone (25 ␮g/mouse) (18,19) (both
from Sigma) on days ⫺1, 0, 1, and 2 after receiving CFA by
subcutaneous injection, for comparison with mice infected with
H diminuta.
Peripheral blood cell counts. Blood (1–2 ␮l) was
smeared onto a glass slide, differential staining was performed
(Modified Wright-Giemsa Stain Pack; Fisher Diagnostics), and
300 immune cells were classified as mononuclear cells, neutrophils, or eosinophils (3% eosinophils was used as an indicator
of successful infection with H diminuta [16,20,21]).
Knee swelling. Following the injection of CFA or PBS,
the knee diameters of anesthetized mice were measured, using
microcalipers (Model 62379-531; Control Company) oriented
in a mediolateral plane across the joint line, with minimal or no
compression exerted on the joint. The average value from 3
separate measurements at each time point was recorded, with
the data presented in millimeters or as the percentage knee
swelling for each individual mouse. In all experiments, the
patterns of knee swelling were similar in PBS-treated mice,
H diminuta–treated mice, CFA-treated mice, and mice treated
with H diminuta plus CFA.
Pain behavior assessment. Secondary mechanical hyperalgesia was assessed using a dynamic plantar algesiometer
(Ugo Basile model 37400), as previously described (22).
Briefly, an unrestrained mouse was placed on a metal mesh
surface, and a touch stimulator unit was positioned below the
plantar surface of the hind paw. Activation of the unit causes
a metal monofilament (0.5 mm diameter) to advance with
constant speed and touch the paw in the proximal metatarsal
region. The filament exerts a gradually increasing force to the
plantar surface, starting below the threshold of detection and
increasing until the stimulus is sensed and the mouse removes
its paw. The threshold force (in grams) at which paw withdrawal occurs is recorded. The mice are habituated to the test
apparatus over a 3-day period prior to assessment. This is a
standard approach to assessing referred pain, which gives an
indication of pain processing changes in the central nervous
system.
Assessment of synovial blood flow. Knee joint blood
flow was determined by laser Doppler perfusion imaging
(Moor Laser Doppler Imager V2; Moor Instruments), using a
validated protocol (23). Briefly, mice were maintained under
deep general anesthesia, an ellipse of skin covering the medial
aspect of the knee was removed, a red He-Ne laser (633 nm)
scanned over the surface of the joint capsulem, and basal blood
flow to the region was calculated. At the end of the experiment, the mouse was killed by sodium pentobarbital overdose
(120 mg/mouse, intracardiac administration), and a dead scan
436
of the joint was performed. This “biological zero” value
corresponding to a tissue reflection artifact was subtracted
from the basal blood flow value, which is presented in arbitrary
perfusion units.
Myeloperoxidase (MPO) activity. Knees and segments
of colon and lung were excised and homogenized, and MPO
activity was determined by a kinetic assay (9), in which 1 unit
of MPO activity is the amount of enzyme required to degrade
1 ␮M H2O2 per minute.
Cytokine production. Messenger RNA (mRNA) measured by real-time polymerase chain reaction (PCR). RNA was
extracted from knee homogenates and reverse transcribed
using the iScript reverse transcriptase kit (Bio-Rad) in a
MyCycler thermal cycler (Bio-Rad). One microliter of complementary DNA was mixed with a reaction buffer containing 1⫻
SYBR Green (Bio-Rad) and 300 nM gene primers. Quantitative PCR was conducted in a Mastercycler real-time thermal
cycler (Eppendorf), and the data were analyzed using realplex
software (Eppendorf). The expression of TNF␣ and IL-10
mRNA is presented relative to the expression of the 18S RNA
housekeeping gene. The primer sequences used are as follows:
for IL-10, forward CCAAGCCTTATCGGAAATGA, reverse
TTTTCACAGGGGAGAAATCG; for TNF␣, forward AGCCCCCAGTCTGTATCCTT, reverse CTCCCTTTGCAGAACTCAGG); for 18S RNA, forward CAGTTATGGTTCCTTTGGTCG, reverse ATCTAGAGTCACCAAGCCGC.
Protein levels measured by enzyme-linked immunosorbent assay (ELISA). The spleen and inguinal lymph nodes
(LNs) were excised separately, and 5 ⫻ 106 cells (inguinal LN
cells from 3 mice were grouped) were cultured with 2 ␮g/ml of
the T cell mitogen concanavalin A (ConA; Sigma) for 48 hours.
Levels of IL-4, IL-10, IL-12p40, and TNF␣ were determined by
ELISA, following the manufacturer’s instructions (R&D Systems). Each ELISA had a detection limit of 2–9 pg/ml. Data
are presented as either pg/ml or as an IL-10:TNF␣ ratio, with
a higher value for the ratio indicating a relative increase in
IL-10 over TNF␣.
Anti–IL-10 antibody treatment. BALB/c mice were
infected with H diminuta, and CFA was administered 8 days
later. A time-matched group of mice received intraperitoneal
injections of 50 ␮g, 100 ␮g, and 50 ␮g rat anti-mouse neutralizing IL-10 antibody (rat IgG1; Thermo Fisher Scientific) on
days 7, 8 (i.e., 30 minutes after administration of CFA), and 9
after H diminuta infection, respectively (previous studies
showed that isotype-matched IgG did not affect the outcome
of colitis) (9). In these studies and those involving IL-10–
deficient mice, tapeworms were not observed in the small
bowel or in intestinal washings, suggesting that normal antiworm expulsion events had occurred (which is in contrast to
the situation in SCID and IL-4R␣–knockout mice [see below]).
Flow cytometry analysis. Spleen cells (5 ⫻ 106) were
stimulated with ConA (2 ␮g/ml) and processed for flow
cytometry (24). Briefly, 43 hours after stimulation, 1 ␮l GolgiPlug (BD PharMingen) was added, and 5 hours later cells
were harvested, washed with PBS, and resuspended at 1 ⫻ 106
cells/100 ␮l PBS containing 0.5% fetal calf serum. Cells were
incubated with phycoerythrin (PE)–conjugated rat anti-mouse
CD4, CD8, CD220, or F4/80, or with PE-conjugated matched
control antibodies (BD PharMingen) for 30 minutes at 4°C in
SHI ET AL
the dark. Following 2 rinses with PBS, the cells were fixed with
1% formalin (20 minutes at room temperature), washed with
PBS, and permeabilized with a solution of PBS and 0.3%
saponin. Cells were incubated with fluorescein isothiocyanate
(FITC)–conjugated rat anti-mouse IL-10 monoclonal antibodies (mAb; BD PharMingen) or FITC-conjugated rat IgG2b
(isotype control) for 30 minutes at room temperature and
washed twice in 500 ␮l PBS–0.3% saponin. Fluorescence was
detected on a FACScan flow cytometer using CellQuest Pro
(both from BD PharMingen) and was analyzed with FlowJo
software (TreeStar).
Isolation and adoptive transfer of CD4ⴙ T cells. Eight
days postinfection, the spleens were removed from wild-type
or IL-10–knockout mice, disrupted into 1 ⫻ 108 cells/ml PBS
suspension, and CD4⫹ cells were purified by negative selection using a mouse CD4⫹ T cell enrichment kit according to
the manufacturer’s instructions (StemCell Technologies). The
purity of the population was assessed using PE-conjugated rat
anti-mouse CD4 mAb (BioLegend), FITC-conjugated rat antimouse CD8 mAb (Abcam), or FITC-conjugated rat antimouse CD14 mAb (Abcam) and was 98% CD4⫹ cells with a
size and granularity pattern typical of lymphocytes. The purified CD4⫹ cell population was resuspended, and 1 ⫻ 107 cells
were injected intravenously into each donor mouse. Two days
later, the mice were injected with CFA.
Statistical analysis. Data are presented as the mean ⫾
SEM. Two-group comparisons were performed using Student’s
t-test, and multiple-group comparisons were performed by
one-way analysis of variance followed by Tukey’s post hoc test.
P values less than 0.05 were considered significant.
RESULTS
No CFA-induced blood neutrophilia in H diminuta–
infected mice. On days 1, 2, and 7 after the administration of CFA, the number of blood neutrophils was
increased, with a proportional reduction in the number
of mononuclear cells; this was not observed in mice
treated with H diminuta plus CFA (data not shown). For
instance, 2 days posttreatment, neutrophils represented
47.3 ⫾ 3.9% (mean ⫾ SEM) of blood leukocytes in
CFA-treated mice compared with 28.6 ⫾ 2.0% and
30.6 ⫾ 4.4% of blood leukocytes in PBS-treated mice
and mice treated with H diminuta plus CFA, respectively
(n ⫽ 4 mice per group; P ⬍ 0.05, CFA-treated mice
versus other groups). H diminuta–infected mice displayed ⬎3% blood eosinophils, indicating successful
infection (25), whereas control mice and CFA-treated
mice displayed 0.5–2.5% blood eosinophils.
Effect of infection with H diminuta on CFAinduced arthritis. The injection of sterile PBS into the
articular space caused increases in knee diameter, typically ⱕ10% of the preinjection size (Figure 1A), and
infection with H diminuta did not result in any knee
swelling. In contrast, the injection of CFA evoked
HELMINTH INHIBITION OF JOINT INFLAMMATION
marked swelling that peaked within 1–3 days and was
sustained for 20 days (e.g., 2 days after the injection of
CFA, the mean ⫾ SEM size of the injected knees
increased from 3.76 ⫾ 0.06 mm to 4.57 ⫾ 0.07 mm [n ⫽
15 mice]), and 20 days after the injection of CFA the size
was 4.22 ⫾ 0.08 mm (Figure 1A). Swelling was not
observed in the noninjected contralateral knees. The
response to CFA was similar in C57BL/6 mice (Figure
1B). In mice infected with H diminuta, the impact of
CFA was significantly reduced, as gauged by a reduction
in maximum knee swelling and enhanced resolution of
swelling (Figures 1A and B).
The injection of CFA resulted in increased pain
sensitivity, whereas the threshold for paw withdrawal
was not different between control mice and those that
received H diminuta plus CFA (Figure 1C). Similarly,
the increase in joint blood flow that followed CFA
treatment was significantly reduced in mice infected with
H diminuta (Figure 1D). MPO activity reflects acute
inflammation and is characteristic of granulocyte infiltration, particularly neutrophils. There was a small but
statistically significant increase in MPO activity in knee
extracts obtained 24 hours after CFA treatment, and this
activity was reduced by ⬃40% in the mice treated with
H diminuta plus CFA (n ⫽ 6). Moreover, and in
accordance with the sustained knee swelling in the mice
treated with CFA only, MPO levels were still elevated
7 days after treatment with CFA and were significantly
reduced in mice treated with H diminuta plus CFA
(Figure 1E). Analysis of MPO levels in the lung and
colon revealed no differences between mice treated with
CFA and those treated with H diminuta plus CFA (n ⫽
4 mice per group; results not shown), supporting a local
effect of CFA.
Based on these findings and the robustness of the
blockade of CFA-induced knee swelling by H diminuta,
joint swelling was used as a measure of joint inflammation throughout the remainder of this study. Additional
studies revealed that infection with H diminuta was as
effective at reducing CFA-induced knee swelling as was
dexamethasone or indomethacin, which are representative steroid and nonsteroidal antiinflammatory drugs
(NSAIDs) (Figure 1F).
Role of H diminuta infection in inhibition of
CFA-induced knee swelling. Oral administration of disrupted cysticercoids (confirmed microscopically), which
provides the same antigen load and antigen complexity
as a viable infection, did not prevent CFA-induced knee
swelling, suggesting that the antiarthritic effect required
437
Figure 1. Infection with Hymenolepis diminuta (H. dim; H.d) protects
against Freund’s complete adjuvant (CFA)–induced arthritis. A, Knees
of BALB/c mice injected with CFA displayed significant swelling that
was significantly less severe in mice infected 8 days previously with
H diminuta. Time-matched control and H diminuta–infected mice
injected with phosphate buffered saline (PBS) are shown (n ⫽ 8–16
mice for days 2–7 after CFA treatment [i.e., days 10–15 postinfection]
and n ⫽ 4 mice thereafter [except for PBS, where n ⫽ 2]; the average
starting knee diameter was 3.40–4.28 mm). B, The effects of
H diminuta infection in C57BL/6 mice (n ⫽ 5–8) were similar to those
observed in BALB/c mice. The numbers in parentheses represent the
average inhibition of knee swelling. C, BALB/c mice receiving CFA
had a reduced pain threshold compared with PBS-treated controls or
mice infected with H diminuta (algesiometry was performed 7 days
after injection of CFA or PBS; n ⫽ 4 mice per group). D, The increase
in joint blood flow that followed CFA treatment was significantly
reduced in mice infected with H diminuta (n ⫽ 4 mice per group). E,
Myeloperoxidase (MPO) levels were significantly reduced in mice
treated with H diminuta plus CFA (n ⫽ 4 mice per group; assessed 7
days after CFA treatment). F, Treatment with H diminuta infection
was as effective as treatment with dexamethasone (Dex) or indomethacin (Indo) in preventing CFA-induced knee swelling (n ⫽ 4 mice per
group). Values are the mean ⫾ SEM. In A and B, ⴱ ⫽ P ⬍ 0.05 versus
starting knee size; # ⫽ P ⬍ 0.05 versus PBS/CFA. In C–F, ⴱ ⫽ P ⬍
0.05 versus control or H diminuta alone; # ⫽ P ⬍ 0.05 versus CFA
alone. PU ⫽ perfusion units.
438
SHI ET AL
Figure 2. Adaptive immune responses are required for the antiarthritic effect of infection with H
diminuta. A, Oral administration of disrupted cysticercoids (dead H.d⫹CFA) did not prevent CFAinduced knee swelling, suggesting that the antiarthritic effect of H diminuta requires a viable infection. B,
Secondary infection with H diminuta at the time of CFA injection (H.d[2°]⫹CFA) evoked increased
resolution of knee swelling in wild-type (WT) BALB/c mice, whereas mice infected with H diminuta 28
days prior to CFA challenge (primary infection; H.d[1°]⫹CFA) were not protected. C and D, Lymphocytes
(which are absent in SCID mice) (C) and functional interleukin-4 (IL-4)/IL-13 receptors (which are absent
in IL-4 receptor ␣-chain–knockout [IL-4R␣ KO] mice) (D) are required for H diminuta inhibition of
CFA-induced knee swelling. Values are the mean ⫾ SEM results from 3–4 mice per group. ⴱ ⫽ P ⬍ 0.05
versus CFA. See Figure 1 for other definitions.
a viable infection (Figure 2A). Moreover, mice infected
14 days prior to CFA challenge were protected, with
knee swelling being 35–40% less than that in mice
treated with CFA only (n ⫽ 4 mice per group), but this
effect waned such that mice infected 28 days prior to
CFA treatment were not protected (Figure 2B). However, a second infection of mice at the time of CFA
injection (i.e., 28 days after the primary infection) led to
a more rapid reduction in knee swelling (Figure 2B);
these data indicate an immunologic memory response.
SCID mice, which lack T cells and B cells, and
IL-4R␣–knockout mice, which cannot respond to IL-4
or IL-13, developed substantial knee swelling that was
not affected by infection with H diminuta (Figures 2C
and D). In the latter instance, the possibility was considered that any beneficial effect of infection with H
diminuta might be delayed; this proved not to be so,
because the degree of knee swelling observed 7 days
after CFA injection was virtually identical in IL-4R␣–
knockout mice treated with CFA only and in mice
treated with H diminuta plus CFA (Figure 2D). At
autopsy, H diminuta was observed in the small intestines
of all infected SCID and IL-4R␣–knockout mice but not
in the intestines of wild-type mice.
Effect of treatment with H diminuta infection on
recovery from CFA-induced arthritis. Mice infected
with H diminuta 2 days after CFA treatment displayed
enhanced recovery, with a statistically significant reduc-
HELMINTH INHIBITION OF JOINT INFLAMMATION
439
mice, which was not apparent in mice infected with
H diminuta (Figure 4). IL-10 mRNA levels in the
injected joints were not different between groups.
Cytokine production from mitogen-activated
spleen cells is shown in Figure 5. One day after the
injection of CFA, splenocytes from CFA-treated mice
produced more IL-12p40 and TNF␣ than did mice
treated with PBS or H diminuta plus CFA (Figure 5A).
In contrast, splenocytes from mice treated with H diminuta, with or without CFA, produced increased amounts
of IL-4 and IL-10 compared with control mice and mice
treated with CFA only. This pattern of cytokine responsiveness to ConA was also evident 2 days (results not
shown) and 7 days after CFA treatment (Figure 5B) and
in the draining inguinal LNs (results not shown) following the H diminuta treatment regimen (Figure 3B), and
in the memory experiment (Figure 5C).
These data illustrate a shift in the cytokine profile
away from TNF␣ and in favor of IL-10 synthesis and
hence a substantial relative increase in IL-10. For example, the mean ⫾ SEM IL-10:TNF␣ ratio 18 hours after
CFA treatment was 0.8 ⫾ 0.1 for mice treated with CFA
only compared with 5.8 ⫾ 1.4 for mice treated with
H diminuta plus CFA (P ⬍ 0.05, by Student’s t-test). For
control mice treated with PBS, the IL-10:TNF␣ ratio
was 1.4 ⫾ 0.2 (n ⫽ 3–4 mice per group).
The levels of IL-10 and IL-12p40 in supernatants
Figure 3. Infection with Hymenolepis diminuta (H.d) as a treatment
blocks the effect of Freund’s complete adjuvant (CFA) injection. A and
B, Mice infected with H diminuta 2 days after injection of CFA had a
hastened recovery as assessed by knee swelling (A), and this was
associated with reduced tumor necrosis factor ␣ (TNF␣) production
and increased interleukin-4 (IL-4) and IL-10 production by splenocytes stimulated with 2 ␮g/ml concanavalin A that were excised 9 days
after CFA injection (B). Cytokines were measured 48 hours after
treatment with concanavalin A. Values are the mean ⫾ SEM results
from 4 mice per group. ⴱ ⫽ P ⬍ 0.05 versus CFA.
tion in knee swelling at 5 days postinfection (Figure 3A)
and skewing of stimulated splenocyte cytokine production in favor of IL-4 and IL-10 and away from TNF␣
(Figure 3B).
Effect of H diminuta infection on immune responses in favor of IL-10. Quantitative PCR revealed an
increase in TNF␣ mRNA in the knees of CFA-treated
Figure 4. Increased TNF␣ mRNA expression in the CFA-injected
knees of mice. Quantitative real-time polymerase chain reaction
revealed an increase in TNF␣ mRNA expression in the knees of mice
injected with CFA (n ⫽ 3). Such an increase was not observed in mice
infected with 10 H diminuta cysticercoids 8 days before the CFA
injection (n ⫽ 4). Three mice were treated with phosphate buffered
saline (PBS) as control. Bars show the mean ⫾ SEM. See Figure 3 for
other definitions.
440
from ConA-stimulated splenocytes from mice treated
with killed H diminuta plus CFA were not different from
those in mice treated with CFA only (data not shown),
mirroring the inability of this treatment to block CFAinduced knee swelling. Similarly, splenocytes from
H diminuta–infected and CFA-challenged SCID mice or
IL-4R␣–knockout mice did not produce increased
amounts of IL-10 compared with cells from mice treated
with CFA only (data not shown).
Role of IL-10 in the antiarthritic effect of
H diminuta infection. Wild-type C57BL/6 and IL-10–
knockout mice had similar knee swelling in response to
CFA and displayed a ⬃2.5-fold increase in MPO activity. Infection with H diminuta protected the wild-type
but not the IL-10–knockout mice from CFA-induced
knee swelling (Figure 6A). The mean ⫾ SEM cytokine
production was not different when splenocytes from
infected and noninfected IL-10–knockout mice were
compared: for CFA-treated IL-10–knockout mice (n ⫽
3) versus IL-10–knockout mice treated with H diminuta
plus CFA (n ⫽ 4), 498 ⫾ 28 versus 539 ⫾ 115 pg/ml
TNF␣; for CFA-treated IL-10–knockout mice versus
IL-10–knockout mice treated with H diminuta plus
CFA, 276 ⫾ 36 versus 279 ⫾ 59 pg/ml IL-12p40. Because IL-10–knockout mice develop colitis (at ⬃12
weeks of age in the University of Calgary facility), it is
possible that intestinal inflammation affected the outcome of these experiments. However, the mice used in
this study had negligible colitis, and there were no
intestine differences between mice treated with CFA
only and those treated with H diminuta plus CFA, as
gauged by colon histology or MPO levels (data not
shown).
The abrogation of the antiarthritic effect of infection with H diminuta by neutralizing anti–IL-10 antibodies corroborated the findings in the IL-10–knockout
mice (Figure 6B).
Effect of adoptive transfer of CD4ⴙ spleen cells
from H diminuta–infected wild-type mice on the effect
of CFA. Intracellular staining of splenocytes from
H diminuta–infected mice revealed that subpopulations
of CD4⫹ T cells, CD8⫹ T cells, and B220⫹ B cells
expressed IL-10: 14.1 ⫾ 2.8% (mean ⫾ SEM) of CD4⫹
cells (n ⫽ 3 mice) were IL-10 positive, while ⱕ0.5% of
F4/80-positive macrophages displayed IL-10 immunoreactivity. Adoptive transfer of spleen-derived CD4⫹ T
cells from H diminuta–infected wild-type mice but not
IL-10–knockout mice protected recipients against the
proarthritic effects of CFA, as measured by knee swelling (Figure 6C).
SHI ET AL
Figure 5. Infection with H diminuta results in increased production of
IL-10 by immune cells. A, One day after injection of CFA, splenocytes
from CFA-treated mice produced more IL-12p40 and TNF␣ than did
splenocytes from mice treated with phosphate buffered saline (PBS) or
H diminuta plus CFA. Splenocytes from mice treated with H diminuta,
with or without CFA, produced increased amounts of IL-4 and IL-10
compared with control mice and mice treated with CFA only. B and C,
The pattern of cytokine responsiveness observed 1 day after injection
of CFA was also evident 7 days after CFA treatment, following the
8-day prophylactic regimen (B) and in the memory experiment (C).
Values beside the bars in B are the actual values. Bars show the
mean ⫾ SEM results from 3–4 mice and are representative of 1 of 2
experiments performed. ⴱ ⫽ P ⬍ 0.05 versus PBS control. ND ⫽ not
detectable (see Figure 3 for other definitions).
HELMINTH INHIBITION OF JOINT INFLAMMATION
441
DISCUSSION
Figure 6. Interleukin-10 (IL-10) and CD4⫹ cells are important in
the antiarthritic effect of infection with Hymenolepis diminuta
(H.d). A, C57BL/6 IL-10–knockout (KO) mice infected with H diminuta 8 days prior to intraarticular injection of Freund’s complete
adjuvant (CFA) were not protected against knee swelling (n ⫽ 4
mice per group). CFA-induced knee swelling in wild-type (WT)
C57BL/6 mice was reduced by infection with H diminuta (see Figure
1B). B, In vivo neutralization of IL-10 by intraperitoneal administration of anti–IL-10 antibodies (aIL-10) blocked the antiarthritic
effect of infection with H diminuta in CFA-treated wild-type
BALB/c mice (n ⫽ 4). ⴱ ⫽ P ⬍ 0.05 versus phosphate buffered
saline (PBS) (control); # ⫽ P ⬍ 0.05 versus CFA and versus
H diminuta ⫹ CFA ⫹ anti–IL-10. C, Adoptive transfer of CD4⫹ T
cells from the spleens of wild-type mice infected 8 days previously
with H diminuta protected against the knee swelling induced by
CFA injection 24 hours previously; transfer of CD4⫹ T cells from
infected IL-10–knockout mice did not confer protection (n ⫽ 3
mice per group). ⴱ ⫽ P ⬍ 0.05 versus PBS control; # ⫽ P ⬍ 0.05
versus CFA alone. Values in A–C are the mean ⫾ SEM.
There is renewed interest in the ability of the
immune response mobilized to combat infection with
helminth parasites to have a concomitant health benefit
(6,26). Data in support of this have been presented,
particularly in the context of colitis and airway inflammation (27–29). The data presented here support 3
conclusions: 1) infection with H diminuta significantly
improves the outcome of adjuvant-induced monoarthritis, 2) an intact adaptive immune response involving T
cells and IL-4R␣ signaling is required for the antiarthritic effect of H diminuta infection, and 3) IL-10 and
CD4⫹ T cells are important elements of the antiarthritic
effect. Thus, the adaptive immune response raised
against H diminuta can reduce joint inflammation that
occurs as a consequence of local innate immune reactions.
Intraarticular injection of CFA results in rapid
and sustained knee swelling that is accompanied by
increased MPO and TNF␣ levels in the affected knee
(14,15,30,31); the contralateral, noninjected knee and
other joints are not involved. Using this model of
monoarthritis, we observed that mice infected with
H diminuta were significantly protected against CFAinduced arthritis: knee swelling was reduced, the knee
more rapidly returned to normal size, the enhanced
blood flow and MPO levels were reduced, and mice
displayed less sensitivity to referred pain. When used as
a treatment regimen, infection with H diminuta resulted
in enhanced recovery following injection of CFA. Moreover, infection with H diminuta was as potent as dexamethasone and indomethacin in preventing CFAinduced knee swelling; this finding is notable because
steroids and NSAIDs are mainstay treatments for arthritis, and both classes of drug have many undesirable side
effects.
The potential for infection with helminth parasites to reduce the severity of arthritic disease is not
unprecedented. Rats infected with S oblevata were protected against CFA-induced paw inflammation (8), and
the spontaneous joint inflammation that develops in
MRL/lpr mice was slightly reduced by infection with the
nematode Nippostrongylus brasiliensis, as gauged by synovial hyperplasia only (32). The only other study in this
area showed that infection with Schistosoma mansoni
reduced the severity of collagen-induced arthritis in
mice, and this correlated with increased IL-4 and IL-10
production and decreased IL-17A, IFN␥, and TNF␣
production by spleen cells (33). However, with the
exception of a correlation between cytokine profile
skewing and the severity of arthritis, a mechanism for
442
helminth-induced modulation of joint inflammation has
not been elucidated.
Protection against arthritis by a gut-dwelling helminth must be mediated by a systemic event, as supported by normalization of the blood leukocyte composition in mice treated with H diminuta plus CFA. This
concept is supported by the finding that oral administration of probiotics suppressed atopic dermatitis and
arthritis in mouse models (34). The presence of T cells
and IL-4 signaling are prerequisites for the immunologic
expulsion of H diminuta from mice (16,35), and all of the
following point to the antiarthritic effect of H diminuta
occurring via an active host immune response involving
T cells: 1) destroyed H diminuta cysticercoids did not
have an antiarthritic effect, 2) mice lacking T cells and B
cells or competent IL-4 signaling (IL-4R␣–knockout
mice) were not protected against CFA-induced arthritis
by infection with H diminuta, and 3) a second infection
at the time of CFA challenge resulted in significantly
less knee swelling, consistent with triggering an anti–
H diminuta memory response.
There is a paucity of data on the local or systemic
cytokine response following injection of CFA into the
mouse knee, with one study showing increased expression of TNF␣ (14). Analyses of models of arthritis and
patient studies support proarthritic roles for TNF␣,
which also participates in pain perception (36–38), IL12, IL-17, and IL-23 (19,39–41), with IL-10 and FoxP3⫹
regulatory T cells exerting antiarthritic effects (34,42–
46). Immune cells from CFA-treated mice produced
more proinflammatory cytokines than were produced by
cells from control mice or mice treated with H diminuta
plus CFA. In vitro assays revealed that immune cells
from H diminuta–infected mice produce substantial
amounts of IL-4 and IL-10, corroborating studies with
this and other parasitic helminths (20,47).
Many components of the reaction to H diminuta
could contribute to an antiinflammatory response (e.g.,
liberation of IL-4 to block Th1 events). However, based
on skewing of the IL-10:TNF␣ ratio in favor of IL-10 in
mice treated with H diminuta plus CFA, mechanistic
studies focused on the putative involvement of IL-10 in
the suppression of joint inflammation. Experiments using the complementary approaches of in vivo IL-10
neutralization, CFA treatment of IL-10–knockout mice,
and adoptive transfer of CD4⫹ T cells from infected
wild-type or IL-10–knockout mice support the conclusion that IL-10 is an important factor in the inhibition of
CFA-induced inflammation. Given the role of IL-10 in
suppressing this adjuvant-induced monoarthritis and
data showing increased IL-10 production in S mansoni–
SHI ET AL
infected mice sensitized to collagen (33), additional
studies are needed to assess the effect of infection with
H diminuta in the type II collagen–induced polyarthritis
model, which is somewhat reminiscent of RA.
The notion that CD4⫹ T cells are a source of
IL-10 that mediates the antiarthritic effect is in accordance with the presence of an IL-10–positive Treg cell
population in patients responding to therapy for RA
(44). However, the presence of IL-10⫹/CD8⫹ and IL10⫹/B220⫹ cells in H diminuta–infected mice suggests
that these cells can participate in antiarthritic effects;
this possibility remains to be tested. Similarly, numerous
other putative mechanisms need to be assessed to precisely define the role of IL-10 in this model system, as
follows: Is the antiinflammatory effect of CD4⫹/IL-10⫹
cells or IL-10 exerted locally or systemically? Is the
inhibition of TNF␣ production of paramount importance, and is this accomplished by inhibition of macrophage activity by IL-10 or another signal elicited by
IL-10? Is the ability of IL-10 to block mast cell activity
important in the CFA model? What role, if any, does
IL-10 play in the modulation of blood flow and pain
perception, and is this integrated with local or central
neural events? As these questions are answered, a
precise picture of the antiarthritic mechanism of IL-10
will emerge.
As a caveat, helminth therapy or the delivery of
excess amounts of IL-10 has, in theory, the ability to
promote autoimmune disease or cause undesirable side
effects (e.g., fibrosis) (6). However, the experiments
conducted with helminths in animal models have not
demonstrated side effects (6), and, in the context of
antibody-driven autoimmunity, infection with S mansoni
reduced type II collagen–induced arthritis (33).
In summary, the immune response elicited by
mice in reaction to infection with H diminuta (a gut
lumen–dwelling tapeworm) significantly reduced (prophylactically and therapeutically) CFA-induced monoarthritis, and IL-10 was an important element of the
antiarthritic mechanism. However, recombinant IL-10
has been of little value in treating RA (47). This suggests
either that natural production of IL-10 in the host is
more effective than a bolus of recombinant IL-10 or that
IL-10 operates in concert with other factors mobilized in
response to helminth infection. Finally, the potential of
helminth therapy in patients with arthritic disease in
whom conventional treatments have failed is intriguing,
particularly if antiinflammatory immunologic memory
responses could be evoked.
HELMINTH INHIBITION OF JOINT INFLAMMATION
443
AUTHOR CONTRIBUTIONS
All authors were involved in drafting the article or revising it
critically for important intellectual content, and all authors approved
the final version to be published. Dr. McKay had full access to all of
the data in the study and takes responsibility for the integrity of the
data and the accuracy of the data analysis.
Study conception and design. McDougall, Sharkey, McKay.
Acquisition of data. Shi, Wang, Prescott, Waterhouse, Zhang.
Analysis and interpretation of data. Shi, Prescott, Waterhouse,
McDougall, Sharkey, McKay.
REFERENCES
1. Bach JF. The effect of infections on susceptibility to autoimmune
and allergic diseases. N Engl J Med 2002;347:911–20.
2. Helmick CG, Felson DT, Lawrence RC, Gabriel S, Hirsch R,
Kwoh CK, et al, for the National Arthritis Data Workgroup.
Estimates of the prevalence of arthritis and other rheumatic
conditions in the United States. Part I. Arthritis Rheum 2008;58:
15–25.
3. Lawrence RC, Felson DT, Helmick CG, Arnold LM, Choi H,
Deyo RA, et al, for the National Arthritis Data Workgroup.
Estimates of the prevalence of arthritis and other rheumatic
conditions in the United States. Part II. Arthritis Rheum 2008;58:
26–35.
4. Rook GA. Review series on helminths, immune modulation and
the hygiene hypothesis: the broader implications of the hygiene
hypothesis. Immunology 2009;126:3–11.
5. Elliott DE, Summers RW, Weinstock JV. Helminths as governors
of immune-mediated inflammation. Int J Parasitol 2007;37:
457–64.
6. McKay DM. The therapeutic helminth? Trends Parasitol 2009;25:
109–14.
7. Summers RW, Elliott DE, Urban JF Jr, Thompson R, Weinstock
JV. Trichuris suis therapy in Crohn’s disease. Gut 2005;54:87–90.
8. Pearson DJ, Taylor G. The influence of the nematode Syphacia
oblevata on adjuvant arthritis in the rat. Immunology 1975;29:
391–6.
9. Hunter MM, Wang A, Hirota CL, McKay DM. Neutralizing
anti-IL-10 antibody blocks the protective effect of tapeworm
infection in a murine model of chemically induced colitis. J Immunol 2005;174:7368–75.
10. Larsen S, Bendtzen K, Nielsen OH. Extraintestinal manifestations
of inflammatory bowel disease: epidemiology, diagnosis, and management. Ann Med 2010;42:97–114.
11. Atzeni F, Ardizzone S, Bertani L, Antivalle M, Batticciotto A,
Sarzi-Puttini P. Combined therapeutic approach: inflammatory
bowel diseases and peripheral or axial arthritis. World J Gastroenterol 2009;15:2469–71.
12. Armaka M, Apostolaki M, Jacques P, Kontoyiannis DL, Elewaut
D, Kollias G. Mesenchymal cell targeting by TNF as a common
pathogenic principle in chronic inflammatory joint and intestinal
diseases. J Exp Med 2008;205:331–7.
13. Mohrs M, Holscher C, Brombacher F. Interleukin-4 receptor
␣-deficient BALB/c mice show an unimpaired T helper 2 polarization in response to Leishmania major infection. Infect Immun
2000;68:1773–80.
14. Keeble J, Blades M, Pitzalis C, Castro da Rocha FA, Brain SD.
The role of substance P in microvascular responses in murine joint
inflammation. Br J Pharmacol 2005;144:1059–66.
15. Keeble J, Russell F, Curtis B, Starr A, Pinter E, Brain SD.
Involvement of transient receptor potential vanilloid 1 in the
vascular and hyperalgesic components of joint inflammation.
Arthritis Rheum 2005;52:3248–56.
16. McKay DM, Halton DW, McCaigue MD, Johnston CF, Fair-
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
weather I, Shaw C. Hymenolepis diminuta: intestinal goblet cell
response in male C57 mice. Exp Parasitol 1990;71:9–20.
Gauldie SD, McQueen DS, Clarke CJ, Chessell IP. A robust
model of adjuvant-induced chronic unilateral arthritis in two
mouse strains. J Neurosci Methods 2004;139:281–91.
Lesniak MS, Gabikian P, Tyler BM, Pardoll DM, Brem H.
Dexamethasone mediated inhibition of local IL-2 immunotherapy
is dose dependent in experimental brain tumors. J Neurooncol
2004;70:23–8.
Monari C, Bevilacqua S, Piccioni M, Pericolini E, Perito S, Calvitti
M, et al. A microbial polysaccharide reduces the severity of
rheumatoid arthritis by influencing Th17 differentiation and proinflammatory cytokines production. J Immunol 2009;183:191–200.
Persaud R, Wang A, Reardon C, McKay DM. Characterization of
the immuno-regulatory response to the tapeworm Hymenolepis
diminuta in the non-permissive mouse host. Int J Parasitol 2007;
37:393–403.
Reardon C, Sanchez A, Hogaboam CM, McKay DM. Tapeworm
infection reduces the ion transport abnormalities induced by
dextran sulphate sodium (DSS) colitis. Infect Immunity 2001;69:
4417–23.
McDougall JJ, Watkins L, Li Z. Vasoactive intestinal peptide
(VIP) is a modulator of joint pain in a rat model of osteoarthritis.
Pain 2006;123:98–105.
Karimian SM, McDougall JJ, Ferrell WR. Neuropeptidergic and
autonomic control of the vasculature of the rat knee joint revealed
by laser Doppler perfusion imaging. Exp Physiol 1995;80:341–8.
Shi M, Wei G, Pan W, Tabel H. Experimental African trypanosomiasis: a subset of pathogenic, IFN-␥-producing, MHC class
II-restricted CD4⫹ T cells mediates early mortality in highly
susceptible mice. J Immunol 2006;176:1724–32.
Hunter MM, Wang A, McKay DM. Helminth infection enhances
disease in a murine TH2 model of colitis. Gastroenterology
2007;132:1320–30.
Maizels RM, Yazdanbakhsh M. T-cell regulation in helminth
parasite infections: implications for inflammatory diseases. Chem
Immunol Allergy 2008;94:112–23.
Wilson MS, Taylor MD, Balic A, Finney CA, Lamb JR, Maizels
RM. Suppression of allergic airway inflammation by helminthinduced regulatory T cells. J Exp Med 2005;202:1199–212.
Elliott DE, Setiawan T, Metwali A, Blum A, Urban JF Jr,
Weinstock JV. Heligmosomoides polygyrus inhibits established
colitis in IL-10-deficient mice. Eur J Immunol 2004;34:2690–8.
Ince MN, Elliott DE, Setiawan T, Metwali A, Blum A, Chen HL,
et al. Role of T cell TGF-␤ signaling in intestinal cytokine
responses and helminthic immune modulation. Eur J Immunol
2009;39:1870–8.
Ferrell WR, Lockhart JC, Kelso EB, Dunning L, Plevin R, Meek
SE, et al. Essential role for proteinase-activated receptor-2 in
arthritis. J Clin Invest 2003;111:35–41.
Kelso EB, Dunning L, Lockhart JC, Ferrell WR. Strain dependence in murine models of monoarthritis. Inflamm Res 2007;56:
511–4.
Salinas-Carmona MC, de la Cruz-Galicia G, Perez-Rivera I,
Solis-Soto JM, Segoviano-Ramirez JC, Vazquez AV, et al. Spontaneous arthritis in MRL/lpr mice is aggravated by Staphylococcus
aureus and ameliorated by Nippostrongylus brasiliensis infections.
Autoimmunity 2009;42:25–32.
Osada Y, Shimizu S, Kumagai T, Yamada S, Kanazawa T.
Schistosoma mansoni infection reduces severity of collagen-induced arthritis via down-regulation of pro-inflammatory mediators. Int J Parasitol 2009;39:457–64.
Kwon HK, Lee CG, So JS, Chae CS, Hwang JS, Sahoo A, et al.
Generation of regulatory dendritic cells and CD4⫹Foxp3⫹ T cells
by probiotics administration suppresses immune disorders. Proc
Natl Acad Sci U S A 2010;107:2159–64.
444
35. McKay DM. The immune response to and immunomodulation by
Hymenolepis diminuta. Parasitology 2010;137:385–94.
36. Bowen CJ, Edwards CJ, Lindsey H, Dewbury K, Sampson M,
Sawyer S, et al. Improvement in symptoms and signs in the
forefoot of patients with rheumatoid arthritis treated with antiTNF therapy. J Foot Ankle Res 2010;3:10–5.
37. Geboes L, De Klerck B, Van Balen M, Kelchtermans H, Mitera T,
Boon L, et al. Freund’s complete adjuvant induces arthritis in mice
lacking a functional interferon-␥ receptor by triggering tumor
necrosis factor ␣–driven osteoclastogenesis. Arthritis Rheum
2007;56:2595–607.
38. Inglis JJ, Nissim A, Lees DM, Hunt SP, Chernajovsky Y, Kidd BL.
The differential contribution of tumour necrosis factor to thermal
and mechanical hyperalgesia during chronic inflammation. Arthritis Res Ther 2005;7:R807–16.
39. Geboes L, Dumoutier L, Kelchtermans H, Schurgers E, Mitera T,
Renauld JC, et al. Proinflammatory role of the Th17 cytokine
interleukin-22 in collagen-induced arthritis in C57BL/6 mice.
Arthritis Rheum 2009;60:390–5.
40. Hossain A, Zheng CL, Kukita A, Kohashi O. Balance of Th1/Th2
cytokines associated with the preventive effect of incomplete
Freund’s adjuvant on the development of adjuvant arthritis in
LEW rats. J Autoimmun 2001;17:289–95.
41. Murphy CA, Langrish CL, Chen Y, Blumenschein W, McClanahan T, Kastelein RA, et al. Divergent pro- and antiinflammatory
roles for IL-23 and IL-12 in joint autoimmune inflammation. J Exp
Med 2003;198:1951–7.
SHI ET AL
42. An H, Chandra V, Piraino B, Borges L, Geczy C, McNeil HP, et
al. Soluble LILRA3, a potential natural antiinflammatory protein,
is increased in patients with rheumatoid arthritis and is tightly
regulated by interleukin 10, tumor necrosis factor-␣ and interferon-␥. J Rheumatol 2010;37:1596–606.
43. Zimmerman DH, Taylor P, Bendele A, Carambula R, Duzant Y,
Lowe V, et al. CEL-2000: a therapeutic vaccine for rheumatoid
arthritis arrests disease development and alters serum cytokine/
chemokine patterns in the bovine collagen type II induced arthritis
in the DBA mouse model. Int Immunopharmacol 2010;10:412–21.
44. Kavousanaki M, Makrigiannakis A, Boumpas D, Verginis P. Novel
role of plasmacytoid dendritic cells in humans: induction of
interleukin-10–producing Treg cells by plasmacytoid dendritic
cells in patients with rheumatoid arthritis responding to therapy.
Arthritis Rheum 2010;62:53–63.
45. Wieten L, Berlo SE, ten Brink CB, van Kooten PJ, Singh M, van
der Zee R, et al. IL-10 is critically involved in mycobacterial
HSP70 induced suppression of proteoglycan-induced arthritis.
PLoS ONE 2009;4:e4186.
46. Paul WE, Zhu J. How are TH2-type immune responses initiated
and amplified? Nat Rev Immunol 2010;10:225–35.
47. Van Roon J, Wijngaarden S, Lafeber FP, Damen C, van de Winkel
J, Bijlsma JW. Interleukin 10 treatment of patients with rheumatoid arthritis enhances Fc␥ receptor expression on monocytes and
responsiveness to immune complex stimulation. J Rheumatol
2003;30:648–51.
Документ
Категория
Без категории
Просмотров
2
Размер файла
449 Кб
Теги
intestinal, complete, freund, parasites, mice, monoarthritis, infectious, helminths, reduced, adjuvantinduced
1/--страниц
Пожаловаться на содержимое документа