close

Вход

Забыли?

вход по аккаунту

?

Linkage Between Rheumatoid Arthritis Susceptibility and the Presence of HLA В ЭDR4 and DR Allelic ThIrd Hypervariable Region Sequences in Southern Chinese Persons.

код для вставкиСкачать
163
LINKAGE BETWEEN RHEUMATOID ARTHRITIS
SUSCEPTIBILITY AND THE PRESENCE OF HLA-DR4
AND DRP ALLELIC THIRD HYPERVARIABLE REGION
SEQUENCES IN SOUTHERN CHINESE PERSONS
JAKOB SEGLIAS, EDMUND K. LI, MICHAEL G. COHEN, RAYMOND W. S. WONG,
PAUL K. POTTER, and ALEX K. SO
Objective. To analyze HLA-DR and DQ associations with rheumatoid arthritis (RA) in patients from
southern China.
Methods. In 66 patients and 45 controls, restriction fragment length polymorphism studies were performed using DRB, DQA, and DQB probes, and DRB
allele-specific typing of polymerase chain reactionamplified DRB DNA.
Results. The frequency of HLA-DR4 was significantly increased among RA patients (42.4% versus
17.8%). Increased frequencies of the DQA3 allele
(77.8% versus 48.9%) and the DQB1*0302 allele
(71.0% versus 46.3%), which are in linkage disequilibrium with DR4, were also found. Oligonucleotidetyping
showed that the amino acid sequence LLEQRRAA,
spanning amino acid positions 67-74 of the DRP moleFrom the Rheumatology Unit, Department of Medicine,
Royal Postgraduate Medical School, London, United Kingdom, the
Department of Medicine, Prince of Wales Hospital, Chinese University of Hong Kong, the Queen Mary Hospital, Pokfulam, Hong
Kong, and the Princess Alexandra Hospital, Brisbane, Australia.
Supported by the Wellcome Trust. Dr. Seglias’ work was
supported by the Schweizerische Gesellschaft fur Rheumatologie
and by a grant from the European League Against Rheumatism.
Jakob Seglias, MD: Rheumatology Unit, Department of
Medicine, Royal Postgraduate Medical School (current address:
Klinik fur Rheumatologie, Kantonsspital Aarau, Switzerland); Edmund K. Li, MD: Department of Medicine, Prince of Wales
Hospital, Chinese University of Hong Kong; Michael G. Cohen,
FRACP: Princess Alexandra Hospital; Raymond W. S. Wong,
MRCP: Queen Mary Hospital; Paul K. Potter, BSc: Rheumatology
Unit, Department of Medicine, Royal Postgraduate Medical School;
Alex K. So, PhD, MRCP: Rheumatology Unit, Department of
Medicine, Royal Postgraduate Medical School.
Address reprint requests to Alex K. So, PhD, MRCP,
Rheumatology Unit, Royal Postgraduate Medical School, Du Cane
Road, London W12 ONN, UK.
Submitted for publication May 10.1991; accepted in revised
form October 8, 1991.
Arthritis and Rheumatism, Vol. 35, No. 2 (February 1992)
cule, was found in 19 of 49 patients and 5 of 32 controls.
The main DR4 allelic subtypes found in the population
were DRB1*0404 and DRB1*0405, both of which carried the sequence. There was no difference in subtype
distribution between patients and controls.
Conclusion. Chinese RA patients have an increased frequency of HLA-DR4 alleles which possess
the same DRB third allelic hypervariable sequence
shown to be associated with susceptibility in Caucasian
RA patients.
Genes located within the major histocompatibility complex determine susceptibility to rheumatoid
arthritis (RA). Studies have shown a strong association between the disease and HLA-DR antigens in
different ethnic groups: DR4 in Caucasian, American
black, and Japanese patients with RA, DRl in Asian
Indian and Ashkenazi Jewish patients, and Dw16 in
Yakima Indians (1-3). The association is not complete,
and 2630% of Caucasian patients do not carry DR4.
Recent studies have shown that a conserved
epitope spanning the third allelic hypervariable region
of the DRP molecule may form the molecular basis of
susceptibility to RA (4-6).This supported earlier findings of a common HLA-DR determinant in RA, identified using serologic and cellular techniques (7,8).The
sequences over this third allelic hypervariable region,
which spans amino acid residues 67-74 of the DRP
chain, are LLEQKRAA and LLEQRRAA in the susceptibility-associated alleles DRB 1*0401 (Dw4) and
DRB 1*0101 (DRI)/DRB1*04M (Dw14), respectively.
It is unclear, however, whether these epitopes alone
are sufficient to account for HLA-D-associated disease susceptibility. One way to study this is to determine the distribution of these 2 sequences in patients
SEGLIAS ET AL
164
Table 1. Oligonucleotide probes used in DRBl allelic typing*
Oligonucleotide
Corresponding amino acid sequence and
DRB allele
Washing
temperature
67-73, DRB 1*0401
67-73, DRB1*0101, DRB1*0404, DRBl*0403,
DRB1*0405, DRB1*1402
55-61 ,DRB1 *O405, DRB 1*0801
7&76,DRB1*0403, DRB1*0406, DRB1*0407
70°C
68°C
Nucleotide sequence
620
62 1
GGCCCGC'ITCTGCTCCAGGAG
GGCCCGCCTCTGCTCCAGGAG
622
623
CGGCCTAGCGCCGAGTACTGG
CAGAGGCGGGCCGAGGTGGAC
72°C
14°C
* Oligonucleotides 620 and 621 were synthesized in reverse orientation to the coding sequence, and oligonucleotides 622 and 623 were in the
same orientation to the coding sequence.
from different ethnic groups, which have different
distributions of HLA-DR alleles, to determine if similar associations with specific sequences can be found.
HLA-DR4 has been reported to be associated with RA
in southern Chinese individuals (9), but the role of
specific sequences has not been studied. We therefore
examined the distribution of these allelic hypervariable region sequences, using oligonucleotide hybridization and restriction fragment length polymorphism
(RFLP) studies in southern Chinese patients from
Hong Kong.
Allelic sequences were detected by oligonucleotide
hybridization, using 4 oligonucleotide probes (Table I). One
hundred nanograms of the oligonucleotide was radiolabeled
using T4 DNA kinase and 50 pCi of "P-yATP (Amersham),
separated from unincorporated ATP on a Sephadex G-50
spin column, and then used in hybridization experiments at
a specific activity of 1 x lo6 c p d m l of hybridization buffer.
Washing conditions were determined for each oligonucleotide, to discriminate a single base mismatch to the probe
sequence. The filters were washed in 2 x SSC, 0.1% SDS at
room temperature for 30 minutes, then at the appropriate
temperatures (Table 1) for 60 minutes. Autoradiography was
performed for 1-3 days, using Hypefilm (Amersham).
PATIENTS AND METHODS
RESULTS
Patients. Sixty-six southern Chinese patients with
RA were studied. All patients had RA as defined by the
American College of Rheumatology (formerly, the American
Rheumatism Association) criteria (10). Forty-five healthy
southern Chinese subjects served as the control population.
HLA-DR typing by RFLP. Seven micrograms of
genomic DNA from each subject was digested with Tuq I
and electrophoresed in 0.7% agarose gels. Southern transfer
onto Hybond-N membranes (Amersham, Buckinghamshire,
UK) was performed using standard techniques. Filters were
prehybridized and hybridized using the recommended solutions, with the addition of 2 x lo6 counts per minute of
radiolabeled probe in the hybridization solution. The filters
were washed to high stringency; the final wash was for 30
minutes at 65°C in 0 . 2 ~SSC (lx SSC = 0.15M NaCl and
0.0194 sodium citrate), 0.1% sodium dodecyl sulfate (SDS).
The DRB probe is a 530-basepair Psf I fragment of a
DR4/Dw4 complementary DNA (cDNA) clone, and the
DQA and DQB probes are full-length cDNA clones. Probes
were labeled with "P-CTP by random oligonucleotide
primer synthesis (1 1).
Allele-specific hybridization of amplied DRB genes.
Genomic DNA samples were amplified by the polymerase
chain reaction using DRB genomic primers (forward TTCTTCAATGGGACGGAGCG; reverse GCCGCTGCACTGTGAAGCTCTC), with 1 unit of Tuq polymerase (Cetus,
Emeryville, CA). Amplification was performed at 94°C for 2
minutes, 55°C for 2 minutes, and 72°C for 2 minutes.
Amplified DNA samples were Southern blotted onto nylon
membranes after electrophoresis in 1.5% agarose gels run in
TAE buffer (40 mM Tris, 1 mM EDTA, pH 7.6).
HLA-DR frequency in RA patients. HLA-DR
typing by RFLP showed that only DR4 had a significantly increased frequency among RA patients versus
controls (42.4% versus 17.8%; relative risk = 3.4)
(Table 2). The frequency of HLA-DR9 was slightly
increased (34.8% versus 31.1%), but this was not
Table 2. HLA-DR antigen frequencies in Chinese rheumatoid
arthritis @A) patients and controls
RA patients
(n = 66)
DR 1
DR2
DR3
DR4
DR5
DR6
DR7
DR8
DR9
DRlO
x3*
Blankt
Controls
(n = 45)
No.
%
No.
%
3
26
3
28
7
6
1
6
23
3
14
2
4.5
39.4
4.5
42.4
10.6
9.1
1.5
9.1
34.8
4.5
21.2
3.0
0
17
5
8
9
10
0
3
14
2
13
0
37.8
11.0
17.8
20.0
22.2
0
6.7
31.1
4.4
28.9
2.2
1
~
~
~
*The X3 pattern has been shown, by sequencing, to define a
haplotype containing a DRBl*1201 allele (Bidwell J: personal communication).
t Blank indicates inability to assign HLA-DR type.
HLA-DRB DETERMINANTS IN CHINESE RA PATIENTS
165
Table 3. DQA and DQB allelic frequencies defined by Taq I
RFLP*
RA patients
(n = 63, 62)t
DQA
la
lb
lc
2
3
DQBS
la
Ib
2a
2b
3a
3b
Blank
Controls
(n = 45, 41)t
No.
%
No.
%
12
30
4
12
49
19.0
47.6
6.3
19.0
77.8
9
24
4
20
53.3
8.9
33.3
48.9
23
1
2
8
37.1
1.6
3.2
12.9
71.0
27.4
27.4
1
44
17
17
I5
22
16
6
1
6
19
13
13
39.0
14.6
2.4
14.6
46.3
31.7
31.7
* Restriction fragment length polymorphism (RFLPMefined DQA
and DQB alleles were identified according to previously established
patterns (12). RA = rheumatoid arthritis.
t The first n value is for DQA; the second is for DQB.
$ The DQB3a pattern identifies the DQB1*0302 allele; the DQB3b
pattern identifies the DQB1*0301 allele.
statistically significant. The etiologic fraction for DR4
was 0.30. The results indicated that DR4 is the only
HLA-DR antigen associated with RA in southern
Chinese individuals.
HLA-DQA and DQB allelic frequency. HLADQA and DQB alleles detected by RFLP showed
patterns similar to those reported in studies of Caucasian subjects (12). The DQA3 allele was found in 49
RA patients (77.8%) and 22 normal subjects (48.9%).
The DQB1*0302 allele, which is detected by its characteristic RFLP pattern (DQB3a), was found in 44 RA
patients (71.O%), compared with 19 control subjects
(46.3%). Both of these differences were statistically
significant (DQA3 2 = 9.72, P < 0.005; DQB1*0302 2
= 6.30, P < 0.025) (Table 3).
Allele-specific oligonucleotide probe hybridization studies of third allelic hypervariable region sequences. Oligonucleotides 620 and 621, which are
specific for third allelic hypervariable region sequences found in HLA-DRB alleles associated with
RA in Caucasians, were used to study the prevalence
of these sequences in Chinese RA patients and controls. In only 1 subject (an RA patient), from a total of
81 subjects studied with this technique, was there
hybridization with oligonucleotide 620. Samples from
19 RA patients (38.8%) and 5 control subjects (15.6%)
hybridized with oligonucleotide 621 (Figure 1 and
Table 4).
2
3 4 5 6 7 8 9 1 0
Figure 1. Oligonucleotide hybridization of amplified DRB DNA.
Samples were hybridized with oligonucleotide 621 (upper panel),
after which the same filter was stripped and rehybridized with
oligonucleotide 620 (lower panel). Lanes 1-3, HLA-DFU4, DR1/4,
and DR4/5, respectively, from rheumatoid arthritis (RA) patients.
Lane 4, DRB1*0401 (Dw4) from a control. Lane 5 , DRB1*0404
(Dw14) from a control. Lane 6, DR114 from an RA patient. Lane 7,
DW/9 from an RA patient. Lane 8, DRu4 from a control. Lane 9,
DR3/10 from a control. Lane 10, Negative control for the polymerase chain reaction. See Table 1 for washing conditions.
Oligonucleotide subtyping of DR4-bearing haplotypes. We further subtyped for the presence of the
DRB 1*M05(Dw15) allele using allele-specific oligonucleotide probe hybridization. Three of 5 DR4+ controls (60%) and 12 of 19 DR4+ RA patients (63%)
possessed this allele. None of them possessed the
DRB1*0402 (DwlO) or DRB1*0403 (Dw13) alleles (Table 4).
DISCUSSION
Based on studies on Caucasian patients with
rheumatoid arthritis, a shared epitope on HLA-DRP
chains, spanning amino acids 67-74, has been proTable 4. DRB I allelic subtyping by allele-specific oligonucleotide
probes*
RA patients
(n = 49)
DRBI*0401
DRB 1*0402
DRB 1*0403
DRB1*0404
DRB1*0405
DRB 1*0101
DRB 1* 1402
Controls
(n = 32)
No.
%
No.
1
0
0
7
12
3
2
2.0
0
0
0
2
3
0
0
14.3
24.5
6.1
4
0
1
%
0
0
0
6.3
9.4
0
3.1
* DRBl alleles were determined using the oligonucleotide probes
listed in Table 1. See Patients and Methods for details. RA =
rheumatoid arthritis.
SEGLIAS ET AL
166
posed to form the basis of the observed HLA associations with RA. We have now studied HLA-DR
associations with RA in southern Chinese patients, a
group for which there was little previous information
on HLA associations with RA. Findings in this study
allow further examination of the role of specific DRP
sequences in disease susceptibility.
We found that HLA-DR4 is strongly associated
with RA in southern Chinese subjects, but unlike other
ethnic groups, this group did not exhibit association
with other DR alleles that also possess this shared
epitope (as DRB1*0101, DRB1*1402). The presence of
shared third allelic hypervariable region epitopes was
studied by allele-specific oligonucleotide hybridization. In contrast to observations in Caucasian patients,
no association with the DRB1*0401 (Dw4) allele,
which possesses the LLEQKRAA sequence, was
found. There was an increase in the percentage of
patients who possessed the LLEQRRAA sequence
(38.8%, versus 15.6% of controls). This was accounted
for mainly by the DRB1*0405 (Dw15) allele, with the
rest being DRB1*0404 (Dw14) alleles. Unlike in the
Caucasian population, the DRB 1*0401 allele was very
uncommon in the Chinese subjects, and nearly all DR4
haplotypes in Chinese RA patients possessed the
sequence LLEQRRAA, spanning the third allelic hypervariable region of the DRP molecule.
The distribution of DR4 subtypes in the Chinese
RA patients, while different from that found in Caucasian RA patients, was similar to that found in Chinese
DR4+ controls, though the number of control DR4
haplotypes analyzed was small. A small number of
both patients and controls had the DRB1*1402 (Dw16)
allele, which has the same third allelic hypervariable
region sequence as DRB1*0404. There was no significant difference between the groups in the percentage
positive for this allele.
The significantly increased frequencies of the
RFLP-defined DQA and DQB alleles is due to their
linkage disequilibrium with DR4. The DQA3 allele was
significantly more frequent among RA patients than
controls. Similarly, there was a significantly increased
frequency of the RFLP-defined DQB3a pattern, which
correlated with the DQB1*0302 (DQw8) allele. Both
RFLP patterns are also associated with HLA-DR9.
Although the frequency of DR9 was slightly increased
among the patients with RA, this was not statistically
significant, even after correction for the increased
frequency of DR4. There was no association with the
DQB3b pattern (DQB1*0301), as reported in some
studies of Caucasian RA patients (13). These results
therefore suggest that HLA-DR4 is the main D-region
susceptibility gene for RA, and support earlier observations that susceptibility to RA is linked to the DRB
subregion.
Our results show that in southern Chinese RA
patients, the HLA association is with DR4, and these
patients possess a shared epitope, as has been reported for Caucasian RA patients. However, only 39%
of our patients have this epitope, compared with
nearly 80% of Caucasian patients (ref. 4 and Seglias J
et al: unpublished observations). The third allelic
hypervariable region sequence found in Chinese patients is LLEQRRAA. It is found in DRB1*0404 and
DRB 1*O405 alleles predominantly, and together they
constitute the vast majority (95%) of DR4 alleles found
in patients. The lack of association with other DRB
alleles that possess this sequence (i.e., DRB1*0101
and DRB1*1402) is likely to be due to the low frequencies of these alleles in the population. Analyzed individually, the DRB 1*0404 and DRBl *a05 alleles were
both more frequent in patients than controls, with
DRB1*0405 being more prominent (DRB1*0404 14.3%
versus 6.3%, DRB1*0405 24.5% versus 9.4%), but the
differences between patients and controls did not
reach statistical significance. These findings do not
resolve the question of whether genetic susceptibility
is due to an individual allele bearing the allelic hypervariable region sequence, but taken in conjunction
with similar results from studies in other ethnic
groups, they suggest that a common third allelic hypervariable region sequence, found usually on DR4
alleles, underlies susceptibility to RA.
REFERENCES
1. Stastny P: Joint report: rheumatoid arthritis, Histocompatibility Testing 1980. Edited by PI Terasaki. Los
Angeles, UCLA Tissue Typing Laboratory, 1980
2. Woodrow JC, Nichol FE, Zaphiropoulos G: DR antigens and rheumatoid arthritis: a study of two populations. Br Med J 283:1287-1288, 1981
3. Willkens RF, Nepom GT, Marks CR, Nettles JW,
Nepom BS: Association of HLA-Dwl6 with rheumatoid
arthritis in Yakima Indians: further evidence for the
“shared epitope” hypothesis. Arthritis Rheum 34:4347, 1991
4. Wordsworth BP, Lanchbury JSS, Sakkas LI, Welsh KI,
Panayi GS, Bell JI: HLA-DR4 subtype frequencies in
rheumatoid arthritis indicate that DRBl is the major
susceptibility locus within the HLA class I1 region. Proc
Natl Acad Sci USA 86:10049-10053, 1989
HLA-DRB DETERMINANTS IN CHINESE RA PATIENTS
5. Watanabe Y, Tokunaga K, Matsuki K, Takeuchi F,
Matsuta K, Maeda H, Omoto K, Juji T: Putative amino
acid sequence of HLA-DRp chain contribution to rheumatoid arthritis susceptibility. J Exp Med 1690:22632268, 1989
6. Nepom GT, Byers P, Seyfried CE, Healey LA, Wilske
KR, Stage D, Nepom BS: HLA genes associated with
rheumatoid arthritis: identification of susceptibility alleles using specific oligonucleotide probes. Arthritis
Rheum 32:15-21, 1989
7. Duquesnoy RJ, Marrari M, Hackbarth S, Zeevi A:
Serological and cellular definition of a new HLA-DR
associated determinant, MC1, and its association with
rheumatoid arthritis. Hum Immunol 10:165-167, 1984
8. Goronzy J, Weyand CM, Fathman CG: Shared T cell
recognition sites on human histocompatibility leucocyte
antigen class I1 molecules of patients with seropositive
rheumatoid arthritis. J Clin Invest 77:1042-1049, 1986
9. Hawkins BR: HLA and autoimmune disease, Human
10.
11.
12.
13.
167
Leucocyte Antigens in Chinese. Edited by BR Hawkins.
Hong Kong, Hong Kong University Press, 1987
Arnett FC, Edworthy SM, Bloch DA, McShane DJ,
Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang
MH, Luthra HS, Medsger TA Jr, Mitchell DM, Neustadt DH, Pinals RS, Schaller JG, Sharp JT, Wilder RL,
Hunder GG: The American Rheumatism Association
1987 revised criteria for the classification of rheumatoid
arthritis. Arthritis Rheum 31:315-324, 1988
Feinberg AP, Vogelstein B: A technique of radiolabelling DNA restriction endonuclease fragments to high
specific activity. Anal Biochem 137:26&267, 1984
Bidwell JL, Bidwell EA, Bradley BA: HLA class I1
genes: typing by DNA analysis. Baillieres Clin Haemato1 3:355-384, 1990
Singal DP, Reid B, Kassam YB, D’Souza M, Bensen
WG, Adachi JD: HLA-DQ beta-chain polymorphism in
HLA-DR4 haplotypes associated with rheumatoid arthritis. Lancet 11:1118-1 120, 1987
Документ
Категория
Без категории
Просмотров
1
Размер файла
430 Кб
Теги
presence, linkage, chinese, hla, regions, susceptibility, third, эdr4, hypervariable, sequence, allelic, arthritis, southern, person, rheumatoid
1/--страниц
Пожаловаться на содержимое документа