close

Вход

Забыли?

вход по аккаунту

?

Intracellular Trafficking of Histone Deacetylase 4 Regulates Long-Term Memory Formation.

код для вставкиСкачать
THE ANATOMICAL RECORD 294:1025–1034 (2011)
Intracellular Trafficking of Histone
Deacetylase 4 Regulates Long-Term
Memory Formation
WEN-HAN WANG,1 LI-CHENG CHENG,1 FEI-YAN PAN,1,2,3 BIN XUE,1
DA-YONG WANG,4 ZHONG CHEN,5* AND CHAO-JUN LI1,2,3*
1
The Jiangsu Key Laboratory for Molecular and Medical Biotechnology, College of Life
Sciences, Nanjing Normal University, Nanjing, China
2
Model Animal Research Center (MARC), Nanjing University, Nanjing, China
3
The School of Medicine, Nanjing University, Nanjing, China
4
The School of Medicine, South-East University, Nanjing, China
5
College of Life Sciences, Hainan Normal University, Haikou, China
ABSTRACT
Histone acetylation is important for gene transcription, which is controlled by the balance between two kinds of opposing enzymes: histone acetyltransferases and histone deacetylases (HDACs). HDACs repress gene
transcription by decreasing histone acetylation levels. Our hypothesis was
that shuttling of Class II HDACs, such as HDAC4, between the nucleus
and cytoplasm is critical for its function. We constructed mutants of mammalian HDAC4 that had different cellular locations and checked their function during memory formation using Caenorhabditis elegans as a model.
The deletion of hda4, a homolog of HDAC4, was able to enhance learning
and long-term memory (LTM) in a thermotaxis model. Transgenic experiments showed that mammalian wild-type HDAC4 rescued the phenotype of
hda4-deleted worms but impaired LTM formation in wild-type worms. The
cytosol-localized HDAC4 mutant was not able to alter the phenotype of
knock-out worms but led to enhanced LTM formation in wild-type worms
similar to hda4-deletion mutants. Constitutive nuclear localization of
HDAC4 rescued the phenotype of deletion worms similar to wild-type
HDAC4 but had no effect on wild-type worms. These results support our
hypothesis that HDAC4’s biological function is regulated by its intracelluC 2011 Wiley-Liss, Inc.
lar distribution. Anat Rec, 294:1025–1034, 2011. V
Key words: HDAC4; long-term memory; Caenorhabditis elegans
Chromatin remodeling, especially through histone-tail
acetylation, which alters the compact chromatin structure and changes the accessibility of DNA to regulatory
proteins, is emerging as a fundamental mechanism for
regulating gene expression (Kurdistani and Grunstein,
2003). Increased acetylation of individual histones at
specific residues is often associated with transcriptional
activation, whereas decreased histone acetylation is often associated with transcriptional silencing (Turner,
2002; Kurdistani and Grunstein, 2003). It has been
shown that the balance between acetylation and deacetylation of eukaryotic chromatin is very important for
many biological processes, including synaptic plasticity
and learning behavior (Alarcón et al., 2004; Levenson
et al., 2004; Guan et al., 2009). Thus, sodium butyrate, a
C 2011 WILEY-LISS, INC.
V
nonselective histone deacetylase (HDAC) inhibitor,
which has been used for cancer therapy, may provide a
therapeutic avenue for memory impairment caused by
neuron degeneration and other diseases (Stefanko et al.,
*Correspondence to: Zhong Chen, Ph.D., College of Life Sciences, Hainan Normal University, Haikou 571158, China. Fax:
0898-68083831. E-mail: zh.chen@hainnu.edu.cn or Chao-Jun Li,
Ph.D., Professor, The School of Medical, Nanjing University,
Nanjing 210093, China. Fax: 86-25-83596289. E-mail: licj@nju.
edu.cn
Received 24 August 2010; Accepted 31 January 2011
DOI 10.1002/ar.21389
Published online 3 May 2011 in Wiley Online Library
(wileyonlinelibrary.com).
1026
WANG ET AL.
2009). However, this broadly acting nonselective HDAC
has shown a range of side effects, which may limit their
utility in memory impairment therapeutics.
Chromatin acetylation is controlled by histone acetyltransferases (HATs), which transfer acetyl groups to the lysine residues of histone, thereby disrupting the interaction
between histone and DNA chromatin. Deacetylation is controlled by HDACs, which are able to catalyze the removal
of acetyl groups from lysine residues (Varga-Weisz and
Becker, 1998). It has been shown that HDACs can regulate
memory formation (Oliveira et al., 2007). Memory can be
classified into short-term memory (STM) and long-term
memory (LTM). LTM requires new protein synthesis,
which involves transcription and gene expression (Levenson and Sweatt, 2005). Thus, disruptions in the balance of
acetylation and deacetylation in eukaryotic chromatin
would result in the changes in the gene expression pattern
that relates to learning and memory formation.
To deacetylate histones and repress transcription,
HDACs must be present in the nucleus. Thus, HDAC nuclear localization will promote an increase in HDAC activity (Chawla et al., 2003). HDACs have been classified into
four different subfamilies based on their sequence homology and cofactor requirements. Of these, Class I and Class
II HDACs have been widely examined. Class I HDACs are
ubiquitously expressed, whereas Class II HDAC expression
may be more restricted (de Ruijter et al., 2003). Class I
HDACs are found almost exclusively in the nucleus,
whereas a significant characteristic of Class II HDACs is
that they are able to shuttle in and out of the nucleus in
response to certain cellular signals (Zhao et al., 2001). In
some studies, the administration of an HDAC inhibitor has
been shown to restore normal LTM formation, which indicates that nuclear HDAC activity can cause memory deficits in mice. Nonetheless, the function of HDAC4
localization has not been clarified. Based on the above
research reports, we hypothesize that the function of Class
II HDAC is related to its subcellular localization during
LTM formation. The little worm’s system has only 302 neurons, and a complete diagram of its neuronal chemical and
electrical connections is available. As such, Caenorhabditis
elegans (C. elegans) is an excellent model for studying the
mechanism of memory formation. In this study, thermotaxis of C. elegans provides an ideal index to analyze the
molecular mechanisms that drive learning and memory
(Gomez et al., 2001; Kodama et al., 2006; Kuhara and
Mori, 2006; Ye et al., 2008). We used C. elegans to examine
whether constitutive targeting of HDAC4 to various subcellular locations affects LTM formation.
MATERIALS AND METHODS
Plasmids Construction and Confirmation
Human HDAC4, HDAC4 (3S) (resides in cytoplasm),
and HDAC4 (D118) (resides in nucleus) mutants were provided by Dr. Yang (Duke University, Durham, NC; Bolger
and Yao, 2005) and were inserted into the pEGFP-N1 vector (GeneBank accession number #U55762). The Neuro-2A
cells were maintained in minimum essential medium containing 10% fetal calf serum, 100 U/mL penicillin G, and
100 lg/mL streptomycin at 37 C in 5% CO2. The cells were
transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
Immunofluorescent Staining
The cells were stained for immunofluorescence essentially as described previously (Zhao et al., 2001). When
samples were harvested, the cells were rinsed with phosphate buffer solution (PBS) and fixed with 4% paraformaldehyde for 1 hr at room temperature. Then the samples
were rinsed three times with PBS and were blocked with
5% bovine serum albumin (BSA) for 1 hr. After blocking,
the samples were incubated with HDAC4 (L-19) antibody
(dilution, 1:200; sc-5246, Santa Cruz Biotechnology, Santa
Cruz, CA) overnight at 4 C followed by incubation with
antigoat immunoglobin G (IgG)-fluoresceine isothiocyanate
antibody (dilution, 1:100; sc-2048, Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hr at 37 C after thorough washing. After rinsing three times with PBS, the samples were
exposed to 4,6-diamino-2-phenyl indole (5 lg/mL; #8226,
Sigma–Aldrich) for 10 min at room temperature for nuclear staining. The fluorescence images of the cells were
photographed using a cooled charge-coupled device camera
(Diagnostic Instruments, MI) and processed using SPOT
software (Diagnostic Instruments, MI).
Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis and Western Blot Analysis
The Neuro-2A was obtained from Cell Resources
Research Centre of Shanghai Institute for Biological Sciences, Chinese Academy of Sciences. The cells were
washed with ice-cold PBS. The cells were lysed with
modified radio-immunoprecipitation assay buffer. Protein
lysates were centrifuged at 12,000g for 15 min, and then
the supernatant was collected for protein quantification
by Bradford protein assay (Bio-Rad). An aliquot of 10 lg
of total protein was boiled and separated electrophoretically on an sodium dodecyl sulfate-polyacrylamide gel
electrophoresis gel and transferred onto a Hybond-N
nitrocellulose membrane (GE Healthcare) by electroblotting. After blocking in Tris-buffered saline buffer
containing 5% BSA for 1 hr, the nitrocellulose membrane
sheets were incubated overnight at 4 C with green fluorescent protein (GFP) (1A5) antibody (dilution, sc101536; Santa Cruz, CA). After washing with Tris-buffered saline and Tween 20 for three times, the membrane sheets were incubated with horseradish
peroxidase (HRP)-conjugated goat antirat IgG-HRP secondary antibody (dilution, 1:5,000, sc-2006, Santa Cruz,
CA) at 37 C for 1 hr. The immunoreactive bands were
visualized using GE Healthcare’s ECL detection kit
according to the manufacturer’s instructions (GE
Healthcare).
C. elegans Strain Maintenance
Worm breeding and handling were conducted as described
by Bredy et al. (2007). Wild-type Bristol strain N2 and mutant strains were obtained from the Caenorhabditis Genetics Center at the University of Minnesota. Mutant strains
used are as follows: RB2357 [hda1 (ok1595)]; VC983 [hda2
(ok1479)]; RB1618 [hda3 (ok1991)]; RB758 [hda4 (ok518)];
VC220 [cmk-1 (ok287)]; and VC1052 [unc-43 (gk452)].
Behavioral Analysis
The method of head thrash frequency, body bend frequency, and basic movements were performed as
1027
HDAC4 REGULATES LTM FORMATION
previously described (Tsalik and Hobert, 2003; Murakami
et al., 2005). To assay the head thrashes, young adult
nematodes were washed with double-distilled water, followed by washing with M9 medium. Every nematode was
transferred into a microtiter well containing 60 lL of M9
medium on top of agar. After a 1-min recovery period, the
head thrashes were counted for 1 min. A thrash was
defined as a change in the direction of bending at the midbody. Fifteen nematodes were examined per treatment.
To assay the frequency of body bends, young adult
nematodes were first fed on OP50 food in covered plates
and then placed on a fresh and foodless nematode
growth medium (NGM) plate. The worms were scored
for the number of body bends in an interval of 20 sec. A
body bend was counted as a change in the direction of
the part of the nematode corresponding to the posterior
bulb of the pharynx along the Y-axis, assuming that the
nematode was traveling along the X-axis. Fifteen nematodes were examined per treatment.
To assay the three basic movements, young adult nematodes were first fed on OP50 food in covered plates and
then placed on a fresh and foodless NGM plate. Three
basic body movements, including forward sinusoidal
movement (forward turns), reversal movement (backward turns), and turns in which nematodes change
direction (Omega/U turns), were measured over a 30-sec
interval. In Omega turns, a young adult nematode’s
head touches the tail and its shape looks similar to the
shape of Greek letter Omega, whereas the angle of the
body bend is typically >90 degree in U turns. Fifteen
nematodes were examined per treatment.
applied, and so, solution flows freely and smoothly in
both directions throughout the gonad until the gonad
noticeably swells up. For DNA transformation, the best
results seem to occur, when the gonad was filled seemingly to the point of damage. The flow was stopped at
this point and pulled the worm off the needle. The coverslip was returned to the dissecting scope, and a drop
(20 lL) of recovery buffer was added on the worms. It
was made sure that buffer surrounds the worms, so that
they were released off of the pad.
Thermotaxis Tracking Behavior Assay for
Learning
The learning assay was performed basically as previously described by Mohri et al. (2005). The synchronized
young adult animals were incubated on NGM plates
with fresh food at 20 C overnight. The young adult
worms were then incubated with fresh food at 25 C for
different incubation intervals (1, 2, 4, 8, 12, and 18 hr).
The young adult animals (25 worms) were picked onto a
9-cm dish that contained agar. A frozen acetic acid containing vial was placed on the center of the plate, and
then, the plate was incubated at 25 C for 30 min in the
presence of a constant humidity of 60% to create a radial
gradient of temperature ranging from 17 C to 25 C. The
index of thermotaxis was determined as the percentage
of worms left on the region of the plate at 25 C. All of
the assays were replicated more than three times.
The index of thermotaxis
Microinjection
Constructs (unc-64::HDAC4, unc-64::HDAC4(3s), and
unc-64::HDAC4(D118)) were generated by amplifying the
promoter of unc-64 sequences and HDAC4 or mutant
genes and cloning them into the pBluescript SKII(þ)
expression vector (Stratagene, La Jolla). The constructs
were injected into N2 wild-type or into hda4 (ok518) mutant worms (Fire, 1986; Mello et al., 1991). For injection
into these unmarked strains (N2 and hda4 (ok518)), the
unc-122::dsRed or dop-1::gfp (gifts from Dr. Piali Sengupta of the University of California, CA) was used as
coinjection markers.
A needle-loading pipette was filled with 1 lL DNA
injection mix by capillary action. The pipette tip was
inserted into the back of the needle, and injection mix
was expelled onto the needle’s internal filament. When
the injection solution was drawn into the needle tip, the
step was finished. This prepared needle was placed into
the needle holder and mounted on the manipulator
(Micromanipulator 5171, Eppendorf). The position of the
needle tip was in the center of the microscope’s field of
view using the 5 objective. Once positioned, the needle
was moved up using the Z-axis control, so that it was
slightly out of focus. A drop of oil was placed on an injection pad and under a dissecting microscope (Olympus,
MVX10) on the top of a small Petri plate cover. Several
worms were moved from a bacteria-free region of an
NGM plate with a naked pick and transferred to the oil
drop. The worms were oriented in rows with their ventral sides facing the same direction (opposite the needle
direction). Using the fine X-axis control, the tip was
placed into center of the cytoplasmic core. Pressure was
¼
The number of wormsleft on the 25 C region
The number of total worms
Thermotaxis Tracking Behavior Assay for
Memory
The memory assay was performed basically as previously described by Mohri et al. (2005). The synchronized
young adult animals were incubated on NGM plates with
fresh food at 20 C overnight. The young adult worms
were washed twice with M9 buffer and then incubated in
fresh food at 25 C for additional 12 hr. These young adult
worms were moved on to NGM plates without food and
incubated at 25 C for different incubation intervals (6, 12,
18, 24, 36, and 48 hr). The animals (30 worms) were
picked onto a 9-cm dish that contained agar with a radial
gradient of temperature ranging from 17 C to 25 C. The
index of thermotaxis was determined as described above.
hda4 RNAi in C. elegans
Ninety-nine base pair fragments of hda4 genes were
amplified by polymerase chain reaction (PCR) from C. elegans cDNA and cloned into the L4440 vector that was a gift
from Dr. Wang (South-East University, Nanjing, China) (A.
Fire laboratory database, available at ftp://ftp.wormbase.org/pub/elegans vector). The following primers were
used: hda4 (forward, GCTCTAGAACAGGCAATCCAACAAC; reverse, CTAGCTAGCTGTGACTTCATATCCGCCAA). RNAi feeding was performed essentially as described
in Conte and Mello (2003). The L4440 feeding vector was
transformed into HT115 bacteria, a gift from Dr. Wang
1028
WANG ET AL.
Fig. 1. Effects of hda4 deletion on the learning and the memory formation for thermosensation. All four hda deletions were used to check
their learning and memory ability. These deletions had no difference
from wild-type worms on their head thrash frequency (A), body bend
frequency (B), and forward, backward, and Omega turn (C), which
mean that any learning and memory changes of worms are not
because of their activity differences. (D) Learning ability evaluation
showed that only hda4 deletion was able to significantly increase the
learning ability (P < 0.05 at 1 and 18 hr). (E) Long-term (from 18 to 48
hr) memory evaluation showed that hda4 deletion was able to significantly enhance LTM (P < 0.05). Data are expressed as mean SD.
*P < 0.05; **P < 0.01.
(South-East University, Nanjing, China) and then cultured
on luria bertani (LB) plates with 50 lg/mL ampicillin and
15 lg/mL tetracycline (Santa Cruz Biotechnology, Santa
Cruz, CA). One single colony was inoculated into 20 mL bacterial cultures in LB containing ampicillin overnight; these
cultures were used for seeding standard solid NGM including adenosine monophosphate and isopropyl b-D-1-thiogalactopyranoside (Santa Cruz Biotechnology, Santa Cruz,
CA) plates. The wild-type or hda4 worms were put on individual plates and allowed to eat HT115 bacteria containing
the hda4 RNAi plasmid. RNAi efficiency was detected with
semiquantitative RT-PCR. Primers specific for hda4
(C10E2.3) sequences are as follows: forward, ACAGGAGTAAAGGGGAG; reverse, AAGTGTGGCGAGGAGAC. Pri-
mers specific for act1 (T04C12.6) sequences were used as
internal standards and are as follows: forward,
CCAAAGGCTAACCGTGAAAA; reverse, GGAAGC GTAGA
GGGAGAGGA.
Statistical Analysis
Results were calculated from three or more independent experiments. Data are presented as Mean SD. An
overall analysis of variance between groups was used to
compare the control group and the treated or mutant
group, followed by post hoc Tamhane’s or least significant difference multiple comparisons test, as appropriate
(*P < 0.05; **P < 0.01).
HDAC4 REGULATES LTM FORMATION
1029
Fig. 2. Effects of cmk1 or unc43 mutation and inhibition of hda4
mRNA expression on the long-term memory formation for thermosensation. (A) The IT phenotypes of cmk1 or unc43 mutant worms in 36
or 48 hr. (B) RT-PCR of 99 bp hda4 fragment in wild-type worms
silenced by hda4 RNAi. RNAi worm is significantly lower than wildtype worm. (C) The IT phenotypes of unc43 mutant worms on a radial
thermal gradient ranging from 17 to 252 after feeding hda4 RNAi plasmid. Behavioral analysis of five mutant and N2 worms, including head
thrash frequency (D), body bend frequency (E), and forward, backward, and Omega turn (F), suggested that there were no differences
among these worms. Data are expressed as mean SD. *P < 0.05;
**P < 0.01.
RESULTS
The Genetic Deletion of hda4 Enhances
Learning and LTM Formation in Worms
assess the formation of learning and memory for thermosensation (Gomez et al., 2001). The basic principle is
that on a radical temperature gradient, worms will avoid
migrating toward their starvation temperature. We
found that the ability of hda1, hda2, and hda3 mutants
to learn was not significantly different from wild type (P
> 0.05), whereas hda4-deletion mutants exhibited significantly increased learning potential at 1 and 18 hr (P <
0.05) (Fig. 1D). For the memory detection, we found that
hda deletions had no significant effect on STM formation
for 6 and 12 hr. In contrast, hda4 deletion could enhance
LTM formation at 18, 24, 36, and 48 hr, although other
hdas did not exhibit this effect (Fig. 1E). From this
result, we concluded that the hda4 deletion could promote both learning ability and LTM formation in worms.
The HDAs of C. elegans are divided into two classes: I
and II. HDA1, HDA2, and HDA3 belong to HDA Class I,
whereas the HDA4 is included in HDA Class II. To
ensure that the effect of hda deletion on altered memory
function was not due to defects in locomotion, we first
examined head thrash, body bends, and movement in
four hda mutants (hda1, hda2, hda3, and hda4) and N2
worms. The results showed that there were no significant changes (P > 0.05) between mutant and wild-type
worms (Fig. 1A–C). The learning or memory detection
model was described by Mohri et al. and was used to
1030
WANG ET AL.
Fig. 3. Mammalian HDAC4 is able to rescue the phenotype of hda4
deletion in worm. (A) The green fluorescent dots in C. elegans’ nerve
ring and dorsal cord nervous system indicate the F1 worms that
expressed exogenous GFP-HDAC4 in C. elegans’ neurons. (B) Western
blotting showed that exogenous GFP-HDAC4 was really expression in
Neuro-2A. Behavioral analysis of three mutant and N2 worms, including
head thrash frequency (C), body bend frequency (D) and forward, back-
ward, and Omega turn (E), suggested that there were no differences
between HDAC4 and control worms. (F) When mammalian HDAC4 was
expressed in wild-type worms, the long-term memory formation was
largely impaired (P < 0.05 in 36 hr and P < 0.01 at 48 hr). (G) When
mammalian HDAC4 was expressed in hda4 deleted worms, long-term
memory formation was recovered to the normal level of wild-type
worms. Data are expressed as mean SD. *P < 0.05; **P < 0.01.
HDA4 Mediates CaMKII-Related Memory
Function
(3s) and HDAC4 (D118) plasmids expressed under the
control of the unc64 promoter that drives unc-64 expression in C. elegans neurons of the nerve ring and dorsal
cord nervous system. We microinjected these constructs
into the ovary of N2 and hda4 mutant worms to obtain
F1 transgenic C. elegans (Fig. 3A). As shown in Fig. 3B,
the expression of exogenous HDAC4 was detected by
western blot analysis with GFP antibody. F1 transgenic
C. elegans were used to detect LTM formation using the
thermotaxis tracking model. The effects of exogenous
HDAC4 expression on locomotion behavior of N2 or
hda4 mutant worms were measured, and the results
indicated HDAC4 expression had no effect on the locomotion behavior of worms (Fig. 3C–E). As shown in Fig.
3F, exogenous HDAC4 expression in wild-type worms
significantly impaired LTM formation as compared with
control worms. When HDAC4 was expressed in
hda4-deletion worms, the amelioration of LTM formation
was recovered to the normal level (Fig. 3G). Therefore,
expression of exogenous mammalian HDAC4 can effectively abrogate the amelioration of LTM formation
induced by hda4 deletion.
The nuclear-cytosol shuffling of HDAC4 is controlled by
Ca2þ/calmodulin-dependent protein kinase (CaMK) promoted phosphorylation at its C-terminal (Backs et al.,
2006). The cmk-1 and unc-43 encode worm Ca2þ/calmodulin-dependent protein kinase I (CaMKI) and II (CaMKII),
respectively. CaMKII deletion (unc-43) significantly
impairs LTM formation (Fig. 2A), possibly by impacting
HDA4 nuclear localization. When HDA4 was knocked
down by siRNA, the impaired LTM formation resulting
from CaMKII deletion was largely recovered (Fig. 2B,C).
The results of behavior analysis indicate that cmk-1 and
unc-43 deletion have no effect on locomotion similar to
hda4 RNAi (Fig. 2D–F). These results suggest that HDA4
regulates CaMKII-dependent LTM formation.
Mammalian HDAC4 is Able to Rescue the
Phenotype of hda4 Deletion in Worms
To study the function of mammalian HDAC, we constructed GFP-tagged HDAC4 and two mutant (HDAC4
1031
HDAC4 REGULATES LTM FORMATION
Fig. 4. Nuclear-localized HDAC4 (3S) is able to rescue the phenotype of hda4 deletion in worms, similar to wild-type HDAC4. (A) The
expression of HDAC4 (3S)-GFP (left) or HDAC4-GFP (right) fusion proteins in Neuro-2A. HDAC4 (3S) mutant protein was located in the nucleus of neurons, whereas most HDAC4 protein was located in the
cytosol of neurons. Behavioral analysis of three mutant and N2
worms, including head thrash frequency (B), body bend frequency (C),
and forward, backward, and Omega turns (D), suggested that there
were no differences between HDAC4 (3S) and control worms. (E)
When HDAC4 (3S) was expressed in wild-type worms, long-term
memory formation was not significantly impaired, although there was
slight decrease at 36 and 48 hr. (F) When mammalian HDAC4 (3S)
was expressed in hda4 deleted worms, long-term memory formation
was recovered to the normal level of wild-type worms. Data are
expressed as mean SD. *P < 0.05; **P < 0.01.
Nuclear Localization of HDAC4(3S) is Able to
Rescue the Phenotype of hda4-Deleted Worms
The Cytoplasmic HDAC4 is Favor of LTM
Formation
The three serines (246/467/632) in the HDAC4 are important for HDAC4 nuclear export (Zhao et al., 2001).
When the three serines were mutated to alanine
(HDAC4 (3S)), abolishing serine-specific phosphorylation
sites, HDAC4 nuclear export was inhibited by preventing 14-3-3 binding (Zhao et al., 2001). Thus, the serinemutated HDAC4 is only found in the nucleus, as shown
in Neuro-2A cells (Fig. 4A). The results of behavior analysis showed that HDAC4 (3S) expression in N2 or hda4
mutant worms had no effect on locomotion behavior,
similar to HDAC4 expression (Fig. 4B–D).
Figure 4E shows that exogenous expression of HDAC4
(3S) in wild-type worms did not cause any defect in LTM
formation (P > 0.05). Exogenous expression of nuclear
HDAC4 (3S) in hda4-deletion worms was able to significantly rescue the hda4-deletion phenotype at 36 hr (P <
0.01) and 48 hr (P < 0.05), similar to HDAC4 (Fig. 4F).
These results indicate that the nuclear localization of
HDAC4 is important for LTM formation.
HDAC4 (D118) is mutated such that the resulting
HDAC4 protein can only locate in cytoplasm, as shown
in Neuro-2A cells (Fig. 5A). The results of behavior analysis showed that HDAC4 (D118) expression in N2 or
hda4 mutant worms had no effect on locomotion behavior, similar to wild-type HDAC4 expression (Fig. 5B–D).
Exogenous expression of HDAC4 (D118) in wild-type
worms significantly accelerated LTM formation at 48 hr
(P < 0.05), similar to hda4 deletion (Fig. 5E). When
expressed in hda4-deletion worms, HDAC4 (D118) had
no effect on the hda4-deletion phenotype (Fig. 5F). These
results further suggest that nuclear-cytosol shuffling is a
key factor affecting LTM formation.
DISCUSSION
Learning and memory have been successfully investigated in some animal models including Aplysia, Drosophila, and mice using various learning and memory
1032
WANG ET AL.
Fig. 5. Cytosol-localized HDAC4 (D118) is able to ameliorate longterm memory formation, similar to the hda4-deletion mutant. (A) The
expression of HDAC4 (D118)-GFP or HDAC4-GFP (right) fusion proteins in Neuro-2A. The HDAC4 (D118) mutant protein was located in
the cytosol of neurons, similar to the subcellular localization of wildtype HDAC4 protein. Behavioral analysis of three mutant and N2
worms, including head thrash frequency (B), body bend frequency (C),
and forward, backward, and Omega turns (D), suggested that there
were no differences between HDAC4 (D118) and control worms. (E)
When HDAC4 (D118) was expressed in wild-type worms, long-term
memory formation was significantly accelerated, as in hda4-deletion
mutants. (F) When mammalian HDAC4 (D118) was expressed in hda4deleted worms, the phenotype was not recovered. Data are expressed
as mean SD. *P < 0.05; **P < 0.01.
paradigms (Mayford and Kandel, 1999; Mohri et al.,
2005). C. elegans contains Class I and Class II HDACs
that include HDA4 (Grozinger et al., 1999; Knoepfler
and Eisenman, 1999). HDA4 protein is highly abundant
in the neurons of C. elegans, suggesting that it has a
function in the nerve system (van der Linden et al.,
2007). A result of hda4 research shows that this gene
shares a high homology with human Class II HDACs,
and that the C. elegans HDA4 protein contains an myocyte enhancer factor-2 (MEF-2)-binding domain and a
nuclear localization signal domain in the N-terminus, as
well as a single catalytic domain in the C-terminus similar to mammalian HDAC4 (Choi et al., 2002). In addition to the high homology with human Class II HDACs,
the expression pattern of HDA4 is similar to that of
mammalian Class II HDACs. For instance, phosphorylation of S198 in HDA4, which is similar to S246, S467,
and S632 in HDAC4, is catalyzed by KIN-29 or UNC-43
and can regulate gene expression through the MEF-2/
HDA4 pathway similar to the mammalian system (van
der Linden et al., 2007). Thus, HDAC4 would likely
behave in C. elegans the same as in the mammalian sys-
tem. Using C. elegans as a genetic model, we suggest
that HDA4 has an inhibitory effect in regulating memory formation. Moreover, the intracellular distribution of
HDA4 is important for its function. Exogenously introduced mammalian HDAC4 is able to rescue the phenotype of a hda4 deletion in C. elegans. Further, nuclear
HDAC4 could function to inhibit gene transcription and
thereby impair memory formation.
Recently, histone acetylation has been implicated in
synaptic plasticity and learning behavior (Levenson
et al., 2004; Vecsey et al., 2007). HDAC inhibitors are
able to recover learning potential and promote the retrieval of LTM in mice even after massive neuronal loss
(Fischle et al., 1999). Cohen et al. (2009) found that nuclear accumulation of HDAC4 and transcriptional reduction of MEF-2-regulated gene expression can lead to a
loss of neural input. In Aplysia, Guan et al. (2002)
reported that HDAC5 plays an important role in the
blocking of long-term facilitation and synapse-specific
long-term depression induced by 5-hydroxytryptamine
and phe-met-arg-phe-amide. This LTM-related synaptic
plasticity was blocked, because cAMP response element-
HDAC4 REGULATES LTM FORMATION
binding (CREB)2 and HDAC5 can displace CREB1CREB-binding protein leading to histone deacetylation
(Guan et al., 2002).
Although chromatin remodeling seems to be a general
modification to gene transcription, it is likely the equilibrium of histone acetylation and deacetylation regulated
by HDACs and HATs that is important in the expression
of memory-related genes (Alarcón et al., 2004; Vecsey
et al., 2007). HDAC2 preferentially binds to the promoters of genes implicated in synaptic remodeling/plasticity or those regulated by neuronal activity (Guan
et al., 2009). Thus, the protein levels of these genes are
markedly increased in the brain of HDAC2KO mice and
decreased in HDAC2OE mice, providing a mechanism by
which HDAC2 is able to negatively regulate memory
formation.
Here, we propose additional layers of HDAC regulation. HDAC4, a Class II HDAC, has the ability to shuttle
between the nucleus and cytoplasm. These cellular locations regulate its deacetylation function inside and outside the nucleus. We found that the nuclear restriction
of HDAC4 is very important for its ability to regulate
memory formation. Nuclear-restricted, but not cytoplasm-restricted, HDAC4 could rescue the enhancement
in memory formation observed in hda4-deletion
mutants. HDAC4 export from the nucleus is dependent
on CaMK (Zhao et al., 2001). CaMK is able to directly
phosphorylate HDAC4 at three serine residues (246/467/
632), whereupon 14-3-3 binds to HDAC4 and facilitates
its export out of the nucleus. CaMK is a critical modulator of neuronal development and plasticity (Wayman
et al., 2008). Thus, CaMK-dependent HDAC4 shuffling
between the nucleus and the cytoplasm provides more
precise regulation of memory formation.
ACKNOWLEDGEMENTS
Human HDAC4, HDAC4 (3S) (resides in the cytoplasm), and HDAC4 (D118) (resides in the nucleus) were
kindly provided by Yang Xiangjiao (McGill University
Health Centre, Montreal, Canada).
LITERATURE CITED
Alarcón JM, Malleret G, Touzani K, Vronskaya S, Ishii S, Kandel
ER, Barco A. 2004. Chromatin acetylation, memory, and LTP are
impaired in CBPþ/ mice a model for the cognitive deficit in
Rubinstein-Taybi syndrome and its amelioration. Neuron 42:947–
959.
Backs J, Song K, Bezprozvannaya S, Chang S, Olson EN. 2006.
CaM kinase II selectively signals to histone deacetylase 4 during
cardiomyocyte hypertrophy. J Clin Invest 116:1853–1864.
Bolger TA, Yao TP. 2005. Intracellular trafficking of histone deacetylase 4 regulates neuronal cell death. J Neurosci 25:9544–9553.
Bredy TW, Wu H, Crego C, Zellhoefer J, Sun YE, Barad M. 2007.
Histone modifications around individual BDNF gene promoters in
prefrontal cortex are associated with extinction of conditioned
fear. Learn Mem 14:268–276.
Chawla S, Vanhoutte P, Arnold FJ, Huang CL, Bading H. 2003.
Neuronal activity-dependent nucleocytoplasmic shuttling of
HDAC4 and HDAC5. J Neurochem 85:151–159.
Choi KY, Ji YJ, Jee C, Kim DH, Ahnn J. 2002. Characterization of
CeHDA-7, a class II histone deacetylase interacting with MEF-2
in Caenorhabditis elegans. Biochem Biophys Res Commun
293:1295–1300.
Cohen TJ, Barrientos T, Hartman ZC, Garvey SM, Cox GA, Yao TP.
2009. The deacetylase HDAC4 controls myocyte enhancing factor-
1033
2-dependent structural gene expression in response to neural activity. FASEB J 23:99–106.
Conte DJ, Mello CC. 2003. RNA interference in Caenorhabditis elegans. Curr Protoc Mol Biol Chapter 26:Unit 26.23.
de Ruijter AJM, van Gennip AH, Caron HN, Kemp S, van Kuilenburg AB. 2003. Histone deacetylases (HDACs): characterization of
the classical HDAC family. Biochem J 370:737–749.
Fire A. 1986. Integrative transformation of Caenorhabditis elegans.
EMBO J 5:2673–2680.
Fischle W, Emiliani S, Hendzel MJ, Nagase T, Nomura N, Voelter
W, Verdin E. 1999. A new family of human histone deacetylases
related to Saccharomyces cerevisiae HDA1p. J Biol Chem
274:11713–11720.
Gomez M, De Castro E, Guarin E, Sasakura H, Kuhara A, Mori I,
Bartfai T, Bargmann CI, Nef P. 2001. Ca2þ signaling via the neuronal calcium sensor-1 regulates associative learning and memory
in C. elegans. Neuron 30:241–248.
Grozinger CM, Hassig CA, Schreiber SL. 1999. Three proteins
define a class of human histone deacetylases related to yeast
Hda1p. Proc Natl Acad Sci USA 96:4868–4873.
Guan JS, Haggarty SJ, Giacometti E, Dannenberg JH, Joseph N, Gao
J, Nieland TJ, Zhou Y, Wang X, Mazitschek R, Bradner JE,
DePinho RA, Jaenisch R, Tsai LH. 2009. HDAC2 negatively regulates memory formation and synaptic plasticity. Nature 459:55–63.
Guan Z, Giustetto M, Lomvardas S, Kim JH, Miniaci MC, Schwartz
JH, Thanos D, Kandel ER. 2002. Integration of long-term-memory-related synaptic plasticity involves bidirectional regulation of
gene expression and chromatin structure. Cell 111:483–493.
Knoepfler PS, Eisenman RN. 1999. Sin meets NuRD and other minireview tails of repression. Cell 99:447–450.
Kodama E, Kuhara A, Mohri-Shiomi A, Kimura KD, Okumura M,
Tomioka M, Iino Y, Mori I. 2006. Insulin-like signaling and the
neural circuit for integrative behavior in C. elegans. Genes Dev
20:2955–2960.
Kuhara A, Mori I. 2006. Molecular physiology of the neural circuit
for calcineurin-dependent associative learning in Caenorhabditis
elegans. J Neurosci 26:9355–9364.
Kurdistani SK, Grunstein M. 2003. Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Biol 4:276–284.
Levenson JM, O’Riordan KJ, Brown KD, Trinh MA, Molfese DL,
Sweatt JD. 2004. Regulation of histone acetylation during memory
formation in the hippocampus. J Biol Chem 279:40545–40559.
Levenson JM, Sweatt JD. 2005. Epigenetic mechanisms in memory
formation. Nat Rev Neurosci 6:108–118.
Mayford M, Kandel ER. 1999. Genetic approaches to memory storage. CNS Spectr 15:463–470.
Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient
gene transfer in C. elegans: extrachromosomal maintenance and
integration of transforming sequences. EMBO J 10:3959–3970.
Mohri A, Kodama E, Kimura KD, Koike M, Mizuno T, Mori I. 2005.
Genetic control of temperature preference in the nematode Caenorhabditis elegans. Genetics 169:1437–1450.
Murakami H, Bessinger K, Hellmann J, Murakami S. 2005. Agingdependent and -independent modulation of associative learning
behavior by insulin/insulin-like growth factor-1 signal in Caenorhabditis elegans. J Neurosci 25:10894–10904.
Oliveira AM, Wood MA, McDonough CB, Abel T. 2007. Transgenic
mice expressing an inhibitory truncated form of p300 exhibit
long-term memory deficits. Learn Mem 14:564–572.
Stefanko DP, Barrett RM, Ly AR, Reolon GK, Wood MA. 2009. Modulation of long-term memory for object recognition via HDAC inhibition. Proc Natl Acad Sci USA 106:9447–9452.
Tsalik EL, Hobert O. 2003. Functional mapping of neurons that
control locomotory behavior in Caenorhabditis elegans. J Neurobiol 56:178–197.
Turner BM. 2002. Cellular memory and the histone code. Cell
111:285–291.
van der Linden AM, Nolan KM, Sengupta P. 2007. KIN-29 SIK regulates chemoreceptor gene expression via an MEF2 transcription
factor and a class II HDAC. EMBO J 26:358–370.
Varga-Weisz PD, Becker PB. 1998. Chromatin-remodeling factors:
machines that regulate? Curr Opin Cell Biol 10:346–353.
1034
WANG ET AL.
Vecsey CG, Hawk JD, Lattal KM, Stein JM, Fabian SA, Attner MA,
Cabrera SM, McDonough CB, Brindle PK, Abel T, Wood MA.
2007. Histone deacetylase inhibitors enhance memory and synaptic plasticity via CREB: CBP-dependent transcriptional activation.
J Neurosci 27:6128–6140.
Wayman GA, Lee YS, Tokumitsu H, Silva AJ, Soderling TR. 2008.
Calmodulin-kinases: modulators of neuronal development and
plasticity. Neuron 59:914–931.
Ye H, Ye B, Wang D. 2008. Trace administration of vitamin E can
retrieve and prevent UV-irradiation- and metal exposure-induced
memory deficits in nematode Caenorhabditis elegans. Neurobiol
Learn Mem 90:10–18.
Zhao X, Ito A, Kane CD, Liao TS, Bolger TA, Lemrow SM, Means
AR, Yao TP. 2001. The modular nature of histone deacetylase
HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem 276:35042–35048.
Документ
Категория
Без категории
Просмотров
14
Размер файла
632 Кб
Теги
terms, memory, formation, long, trafficking, intracellular, histone, regulated, deacetylase
1/--страниц
Пожаловаться на содержимое документа