Quantitative Analysis and Localization of mRNA Transcripts of Type I Collagen Osteocalcin MMP 2 MMP 8 and MMP 13 During Bone Healing in a Rat Calvarial Experimental Defect Model.

THE ANATOMICAL RECORD 291:1038–1046 (2008)
Quantitative Analysis and Localization
of mRNA Transcripts of Type I Collagen,
Osteocalcin, MMP 2, MMP 8, and MMP 13
During Bone Healing in a Rat Calvarial
Experimental Defect Model
TOMOKO ITAGAKI,1,2 TAKAHIRO HONMA,1,2 ICHIRO TAKAHASHI,3
SEISHI ECHIGO,1 AND YASUYUKI SASANO2*
1
Division of Oral Surgery, Tohoku University Graduate School of Dentistry,
Sendai, Japan
2
Division of Craniofacial Development and Regeneration, Tohoku University Graduate
School of Dentistry, Sendai, Japan
3
Division of Orthodontics and Dentofacial Orthopedics, Tohoku University Graduate
School of Dentistry, Sendai, Japan
ABSTRACT
The study examined the expression of matrix metalloproteinases
(MMPs), type I collagen and osteocalcin during bone healing in a rat calvarial experimental defect model. Twelve-week-old male Wistar rats were
used. A full-thickness standardized trephine defect was made in the parietal bone, with the rat under anesthesia. RNA was extracted from tissue
that filled the original bone defect on days 1 and 3 and in weeks 1, 2, 3,
5, 8, 10, 12, 18, and 24 and processed for quantitative analysis of expression of type I collagen, osteocalcin and matrix metalloproteinases (MMPs)
2, 8, and 13 by using real-time polymerase chain reaction. Alternatively,
the rats were fixed by perfusion through the aorta and resected calvaria
were processed for in situ hybridization for these molecules. The expression of type I collagen, osteocalcin and MMPs 2 and 13 increased toward
week 2 and decreased thereafter, whereas the expression of MMP 8 was
the highest on day 1. The mRNA transcripts of type I collagen and osteocalcin were localized in osteoblasts and osteocytes, some of which
expressed MMPs 2, 8, and 13. Osteoblasts and osteocytes may play a role
in the remodeling of extracellular matrices with MMPs during healing of
a defect in bone. Anat Rec, 291:1038–1046, 2008. Ó 2008 Wiley-Liss, Inc.
Key words: bone healing; rat calvarium; MMP; type I collagen;
osteocalcin
There have been few reports on healing of bone
defects, whereas numerous studies have investigated
that of bone fractures (Precious and Hall, 1994; Dimitriou et al., 2005; Einhorn, 2005). It has been suggested
that a bone defect larger than a critical size cannot be
healed with bone, and the remaining defect is filled with
fibrous connective tissue, resulting in a nonunion repair
(Schmitz and Hollinger, 1986; Schmitz et al., 1990). Our
recent study using in situ hybridization reported that
osteoblasts and osteocytes cease production of bone matrix proteins, that is, type I collagen and osteocalcin,
within a limited period during repair of the critical-size
Ó 2008 WILEY-LISS, INC.
Grant sponsor: the Ministry of Education, Science, Sports,
and Culture of Japan; Grant numbers: 15390550, 17659573 and
18390532.
*Correspondence to: Yasuyuki Sasano, Division of Craniofacial Development and Regeneration, Tohoku University Graduate School of Dentistry, 4-1 Seiryo-machi, Aoba-ku, Sendai 9808575, Japan. Fax: 81-22-717-8288.
E-mail: sasano@anat.dent.tohoku.ac.jp
Received 20 January 2008; Accepted 18 March 2008
DOI 10.1002/ar.20717
Published online in Wiley InterScience (www.interscience.wiley.
com).
1039
MMP EXPRESSION DURING RAT BONE DEFECT HEALING
TABLE 1. Real-time PCR primer sequences (50 ?30 )
Type I collagen
Osteocalcin
MMP-2
MMP-8
MMP-13
GAPDH
Forward primer
Reverse primer
GTCGATTCACCTACAGCACG
AAGCCTTCATGTCCAAGCAG
CCTACACCAAGAACTTCCG
CTATGGATTCCCAAGGAGT
GTGTGGAGTTATGATGATGC
TGAACGGGAAGCTCACTGG
GTCGATTCACCTACAGCACG
TCGTCACATTGGGGTTGAG
GAGTGACAGGTCCCAAT
GGATCTTCTTTGATTGTCG
CAATGCGATTACTCCAGAT
TCCACCACCCTGTTGCAGTA
Fig. 1. a,b: Radiographs of the defect in weeks 2 (a) and 12 (b).
Bone healing proceeds gradually and almost ceases in week 12, leaving
approximately 60% of the defect unrepaired. Scale bars 5 2.2 mm.
Fig. 2. Expression of type I collagen examined with real-time polymerase chain reaction. The expression of type I collagen increases toward week 2 and decreases thereafter. The expression in week 2 is
significantly higher than any time before or after (P < 0.01). The
expression levels are normalized to the mean value found on day 1.
calvarial bone defect (Honma et al., 2008). However,
when and how these cells increase and decrease production of these proteins in the course of the healing process is not known.
Bone formation during development involves extensive
remodeling of extracellular matrices (ECM), which is
achieved by both production and degradation of ECM
proteins (Werb and Chin, 1998; Sasano et al., 2002;
Ortega et al., 2003; Nakamura et al., 2005). The matrix
metalloproteinases (MMPs) play a central role in the
breakdown of ECM, which is essential for embryonic development, morphogenesis and tissue remodeling (Birkedal-Hansen et al., 1993; Nagase and Woessner, 1999).
Product size
155
145
126
112
175
307
bp
bp
bp
bp
bp
bp
Accession no.
Z78279
X04141
X71466
AJ0072KK
M6G616
NM_017008
Fig. 3. Expression of osteocalcin examined with real-time PCR.
The expression of osteocalcin increases toward week 2 and
decreases thereafter. The expression in week 2 is significantly higher
than any time before or after (P < 0.01). The expression levels are normalized to the mean value found on day 1.
MMPs 2, 8, and 13 have been implicated in the degradation of ECM during bone development (Gack et al.,
1995; Mattot et al., 1995; Chin and Werb, 1997; Johansson et al., 1997; Sasano et al., 2002; Maruya et al.,
2003). MMPs 2, 8, 9, 13, and 14 have been shown to participate in the healing of bone fracture (Yamagiwa et al.,
1999; Gerstenfeld et al., 2003; Henle et al., 2005; Wang
et al., 2006). In contrast, information about involvement
of MMPs in healing of bone defects is not available.
We hypothesized that osteoblasts and osteocytes
increase and then decrease production of bone matrix
proteins, such as type I collagen and osteocalcin, within
a limited period during healing of critical-size bone
defects and produce MMPs to remodel bone ECM. To
test the hypothesis, this study was designed, first, to
examine expression of type I collagen, osteocalcin, MMP
2, MMP 8, and MMP 13 in bone healing of a critical calvarial defect in the rat, by using real-time polymerase
chain reaction (PCR) quantitatively and, second, to localize their mRNA transcripts using in situ hybridization
qualitatively.
MATERIALS AND METHODS
Animals
Twelve-week-old male Wistar rats weighing 260–280 g
were used. They were obtained from SLC corporation
(Hamamatsu, Shizuoka, Japan) and kept under a standard light–dark schedule and standard relative humidity.
Stock diet and tap water were available ad libitum. All
1040
ITAGAKI ET AL.
Fig. 4. Expression of MMP 2 examined with real-time PCR. The
expression of MMP 2 increases toward week 2 and decreases gradually. The expression in week 2 is significantly higher than any time
before or after (P < 0.05). The expression levels are normalized to the
mean value found on day 1.
Fig. 6. Expression of MMP 8 examined with real-time PCR. The
expression of MMP 8 is the highest on day 1 (P < 0.05) and
decreases. The expression levels are normalized to the mean value
found on day 1.
RNA Extraction
The rats were killed by ether inhalation on days 1 and
3 and in weeks 1, 2, 3, 5, 8, 10, 12, 18, and 24. The tissue including newly formed bone that filled the 8.8-mm
diameter of the original bone defect was homogenized
mechanically and the total RNA was extracted with
RNeasy Lipid Tissue Kits (QIAGEN, Hilden, Germany).
The RNA samples were collected from five to seven rats
at each time point. cDNA was synthesized by using 1.0 mg
of the extracted total RNA primed with 1.5 mg of random
primers (Invitrogen; Carlsbad, CA) in the presence of
reverse transcriptase at 100 U/mg RNA in the reverse
transcription buffer supplied by Invitrogen (Nakamura
et al., 2005).
Fig. 5. Expression of MMP 13 examined with real-time PCR. The
expression of MMP 13 increases toward week 2 and decreases gradually. The expression in week 2 is significantly higher than any time
before or after (P < 0.05). The expression levels are normalized to the
mean value found on day 1.
procedures were approved by the Animal Research Committee of Tohoku University.
Experimental Procedure
Eighty-five rats were used. The experimental rats
were anesthetized with intraperitoneal sodium pentobarbital (50 mg/kg) supplemented by ether inhalation. A
skin incision was made aseptically along the temporal
line bilaterally and the middle of the forehead, an incision was made on the periosteum, and the flap was
gently turned over to expose the calvarial bone. A fullthickness standardized trephine defect, 8.8 mm in diameter, was made in the parietal bone under continuous saline buffer irrigation. Extreme care was exercised to
avoid injury to the midsagittal blood sinus and dura
mater. The periosteum and skin flaps were returned and
sutured (Honma et al., 2008).
Real-time Quantitative PCR
Real-time quantitative PCR analysis was performed
by using LightCycler 1.5 (Roche; Mannheim, Germany)
associated with LightCycler Software Version 3.5 for
type I collagen, osteocalcin, MMP2, MMP8, and MMP13,
according to the manufacturer’s instructions, with LightCycler-FastStart DNA Master SYBR Green I (Roche).
Relative standard curves were constructed for type I collagen, osteocalcin, MMP2, MMP8, MMP13, and an endogenous reference (GAPDH), using serial dilutions of
cDNA, and these standards were included in each run.
Samples of unknown concentration were quantified relative to these standard curves. Type I collagen, osteocalcin, MMP2, MMP8, and MMP13 mRNA levels were normalized to the reference gene (GAPDH) to account for
cDNA loading differences. Samples were run three
times. Average values were used for subsequent statistical analysis. The PCR conditions used a 10-min initial
enzyme activation step followed by 40 cycles of 10 sec at
958C, 10 sec at 628C, and 7 sec at 728C for type I collagen, MMP2 and MMP8, 10 sec at 958C, 10 sec at 628C,
and 6 sec at 728C for osteocalcin, 10 sec at 958C, 10 sec
at 628C, and 8 sec at 728C for MMP13, and 40 cycles of
10 sec at 958C, 10 sec at 628C, and 9 sec at 728C for
GAPDH (Pfaffl, 2001; Zaman et al., 2006). Primer
sequences, the size of the expected real-time PCR prod-
MMP EXPRESSION DURING RAT BONE DEFECT HEALING
1041
Fig. 7. Day 1. Hematoxylin-eosin staining (a,d) and in situ hybridization for MMP 8 (b,c,e). Periosteal cells (arrowheads) on the parietal
bone surface near the defect expressed MMP8 (b). No hybridization
signal is identified in the adjacent section processed with sense
probes (c). Endothelial cells (arrowheads) in connective tissue that fill
the defect express MMP8 (d,e). Scale bars 5 50 mm in a–c; 75 mm in
d; 25 mm in e.
ucts and the accession number for each molecule are
summarized in Table 1.
through the aorta. Calvaria were resected and kept in
the same fixative overnight at 48C. Selected specimens
were radiographed by means of a microradiography unit
(Softex CMR Unit; Softex, Tokyo, Japan) with X-ray film
(FR; Fuji photo film, Tokyo, Japan) under standardized
conditions (20 kV, 5 mA, 1 min). The fixed specimens
were decalcified in autoclaved 10% EDTA in 0.01 M
phosphate buffer, pH 7.4, for 4–6 weeks at 48C. After
dehydration through a graded series of ethanol solutions, the tissues were embedded in paraffin. Serial sections 5 mm thick were cut, and selected sections were
processed for hematoxylin-eosin staining or in situ
hybridization.
Statistical Analysis
All data are expressed as the mean 6 SD for each
group. Statistical differences were analyzed using
Scheffe’s test. Values of P < 0.05 were considered statistically significant.
Tissue Preparation
On days 1 and 3 and weeks 1, 2, 3, 5, 8, 10, 12, 18,
and 24 after the defects were made, the rats were anesthetized intraperitoneally with sodium pentobarbital
and were perfusion fixed. For this, a fixative containing
4% paraformaldehyde and 0.5% glutaraldehyde in 0.1 M
phosphate-buffered saline (PBS), pH 7.4, was perfused
In Situ Hybridization
The protocol used has been reported elsewhere (Nakamura et al., 2005) and is only briefly described as follows.
1042
ITAGAKI ET AL.
Fig. 8. a–e: Weeks 1 (b,c) and 2 (a,d,e); hematoxylin-eosin staining
(a) and in situ hybridization for type I collagen (b,d) and osteocalcin
(c,e). The mRNA transcripts of collagen and osteocalcin are localized
in osteoblasts and osteocytes (arrowheads). O, outer, and I, inner, surfaces of the parietal bone; E, the edge of the original defect in the parietal bone. Scale bars 5 50 mm.
MMP EXPRESSION DURING RAT BONE DEFECT HEALING
1043
Fig. 9. a–d: Weeks 1 (a,c) and 2 (b,d); in situ hybridization for MMP 2 (a,b), MMP 8 (c), and MMP 13
(d). Some of osteoblasts and osteocytes (arrowheads) express MMPs 2, 8, and 13. Scale bars 5 25 mm
in a,c; 50 mm in b,d).
The sections were deparaffinized and washed in PBS, pH
7.4, and then immersed in 0.2 N HCl for 20 min. After
washing, the sections were incubated in proteinase K
(20 mg/mL; Roche) in PBS for 30 min at 378C. The sections were then dipped in 100% ethanol and dried in air
and incubated with the antisense probe or the sense control probe (1.0–4.0 mg/mL) in a hybridization mixture for
16 hr at 458C. The sections were washed and treated
with RNase (Type 1A, 20 mg/ml; Sigma, St Louis, MO,
USA) for 30 min at 378C. After washing, the hybridized
probes were detected immunologically with the Nucleic
Acid Detection Kit (Roche), counterstained with methyl
green, and mounted with a mounting medium. At least
two sections from each of three specimens at each stage
were examined using the same probe. The intensity of
hybridization signals was evaluated by observing at least
three fields of every section.
Real-time PCR
Expression of type I collagen and osteocalcin.
The expression of type I collagen increased toward week
2 and decreased thereafter (Fig. 2). The expression of
osteocalcin increased, with a peak in week 2, and then
decreased sharply (Fig. 3). The expression in week 2
was significantly higher than any time before or after,
for both collagen and osteocalcin.
Expression of MMPs.
Expression of MMP 2
increased toward week 2 and decreased gradually (Fig.
4). The expression in week 2 was significantly higher
than any time before or after. Similarly, expression of
MMP 13 increased toward week 2 and declined thereafter (Fig. 5), but expression of MMP8 was the highest
on day 1 and then decreased (Fig. 6).
Histology and In Situ Hybridization
RESULTS
Radiographs
Bone healing proceeded gradually and almost ceased
in week 12, leaving approximately 60% of the defect
unrepaired (Fig. 1).
Day 1. The defect was filled with blood clots, connective tissue, and blood vessels. In situ hybridization
showed that periosteal cells on the inner surface of the
parietal bone facing the dura mater and the outer bone
surface toward the skin of the parietal bone near the
defect expressed MMP8 (Fig. 7a–c). Endothelial cells in
1044
ITAGAKI ET AL.
Fig. 10. a–f: Week 12; hematoxylin-eosin staining (a) and in situ
hybridization for type I collagen (b), osteocalcin (c), MMP 2 (d), MMP
8 (e), and MMP 13 (f). The bone is covered with bone lining cells
(arrowheads). Only weak expression of type I collagen is seen on the
bone surface, whereas expression of osteocalcin and MMPs is hardly
identified in healed bone in the defect. H, healed bone; O, outer and I,
inner surfaces of the healed bone in the defect. Scale bars 5 50 mm
in a, 100 mm in b–f.
connective tissue that filled the defect expressed MMP8
(Fig. 7d,e).
Week 12. Bone healing proceeded, but the defect
was not filled with bone completely. The remaining
defect was filled with fibrous connective tissues. The
healed bone was covered with bone lining cells (Fig.
10a). Weak expression of type I collagen was seen on the
bone surface (Fig. 10b), whereas expression of osteocalcin (Fig. 10c) and MMPs (Fig. 10d–f) was hardly seen in
week 12.
Weeks 1 and 2. The defect was filled with connective tissue, and a few inflammatory cells were seen. New
bone formation was formed into the defect from the
inner and outer surfaces of the parietal bone. Cuboidal
osteoblasts lined the new bone, and osteocytes were embedded in the bone matrix (Fig. 8a). The mRNA transcripts of type I collagen (Fig. 8b,d) and osteocalcin (Fig.
8c,e) were localized in osteoblasts and osteocytes. Some
of those cells expressed MMPs 2 (Fig. 9a,b), 8 (Fig. 9c),
and 13 (Fig. 9d).
Controls
No hybridization signal was identified in the sections
processed with the sense RNA probes.
MMP EXPRESSION DURING RAT BONE DEFECT HEALING
DISCUSSION
Our previous study using in situ hybridization demonstrated that osteoblasts and osteocytes no longer express
bone matrix proteins in the repairing process of rat calvarial bone defects, and then bone healing ceases within
a limited period, regardless of completion of the defect
repair (Honma et al., 2008). However, how long osteoblasts and osteocytes keep producing bone matrix proteins, such as type I collagen and osteocalcin during the
healing process, was not known. The present study has
shown that the expression of type I collagen and osteocalcin increases significantly toward week 2, and then
decreases sharply toward week 24. The activity of osteoblasts and osteocytes for producing bone matrix proteins
during the defect repair may be highest around week 2
and then decline sharply. This transient increase in the
production of type I collagen and osteocalcin is likely
associated with the stimulation of osteoblast differentiation by the surgical procedure.
Our previous study showed that the rate of bone matrix apposition per week during healing of the bone
defect was highest in week 4 and decreased thereafter
(Honma et al., 2008). A period of time that it takes for
translation from mRNA to proteins and calcification of
the bone matrix to be identified on radiographs may be
involved in the differences in timing between the highest
mRNA expression of the bone matrix proteins in week 2
and the highest rate of bone matrix apposition in week 4.
This study demonstrated for the first time that MMPs
2, 8, and 13 are expressed in the process of bone healing
in the defect. Expression of MMP 2 increases toward
week 2 and decreases gradually. Similarly, expression of
MMP 13 increases toward week 2 and declines thereafter. The expressions of MMPs 2 and 13 are highest
around week 2. These MMPs are expressed by ostoblasts
and osteocytes, which also express type I collagen and
osteocalcin. This study suggests that osteoblasts and
osteocytes degrade ECM proteins during bone healing
by using enzymes such as MMPs 2 and 13. Osteoblasts
and osteocytes may play a role in remodeling of the
ECM during bone healing by coordinating the production and degradation of ECM proteins. Similar observations have been reported during bone development
(Sasano et al., 2002; Tsubota et al., 2002; Maruya et al.,
2003; Nakamura et al., 2005; Sone et al., 2005) and during appositional bone formation (Hatori et al., 2004).
In contrast to the results obtained for MMPs 2 and 8,
the expression of MMP 8 was highest on day 1, and
then decreased. Previous studies reported that MMP 8
is expressed by mononuclear phagocytes, smooth muscle
cells, and endothelial cells (Herman et al., 2001).
Involvement of MMP 8 in skin wound healing has been
demonstrated in mice deficient in MMP 8 (GutiérrezFernández et al., 2007). Our study has shown, by in situ
hybridization, that endothelial cells, osteoblasts, and
osteocytes express MMP 8 during bone healing. MMP 8
may participate in two distinct phases of bone healing.
The early phase, around day 1, may be characterized by
recruitment of connective tissue to the defect site, a process that is required for wound healing. The later phase,
around week 1, may involve MMP 8 expressed by osteoblasts and osteocytes, which degrade ECM proteins, perhaps in conjunction with MMPs 2 and 13 as discussed
above.
1045
It has been suggested that inflammation promotes
osteoblast differentiation directly or indirectly (Rifas
et al., 2003; Gortz et al., 2004; Shen et al., 2005). Inflammation caused by the surgical procedure may have initiated differentiation of osteoblasts and enhanced their production and degradation of ECM proteins. Meanwhile,
the functional activity of osteoblasts may decline as the
inflammation calms down. Further studies are required
for understanding how inflammation may regulate differentiation and the functional activity of osteoblasts.
There was little, if any, expression of MMPs and bone
matrix proteins, measured by in situ hybridization, at
week 12. Osteoblasts and osteocytes may cease degradation of ECM within a limited period, regardless of completion of the defect repair in the rat model, as we previously reported for production of ECM (Honma et al.,
2008). Further investigation with this experimental
model may help provide a greater understanding of the
cellular and molecular events associated with the remodeling of the ECM during bone healing.
ACKNOWLEDGMENTS
The authors thank Dr. Megumi Nakamura, Mr.
Masami Eguchi, and Mr. Yasuto Mikami, Division of
Craniofacial Development and Regeneration, Tohoku
University Graduate School of Dentistry, for their excellent advice and assistance in this study.
LITERATURE CITED
Birkedal-Hansen H, Moore WG, Bodden MK, Windsor LJ, BirkedalHansen B, Decarlo A, Engler JA. 1993. Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 4:197–250.
Chin JR, Werb Z. 1997. Matrix metalloproteinases regulate morphogenesis, migration and remodeling of epithelium, tongue skeletal
muscle and cartilage in the mandibular arch. Development
124:1519–1530.
Dimitriou R, Tsiridis E, Giannoudis PV. 2005. Current concepts of
molecular aspects of bone healing. Injury 36:1392–1404.
Einhorn TA. 2005. The science of fracture healing. J Orthop
Trauma 19(suppl):S4–S6.
Gack S, vallon R, Schmidt J, Grigoriadis A, Tuckermann J, Schenkel J, Weiher H, Wagner EF, Angel P. 1995. Expression of interstitial collagenase during skeletal development of the mouse is restricted to osteoblast-like cells and hypertrophic chondrocytes.
Cell Growth Differ 6:759–767.
Gerstenfeld LC, Cullinane DM, Barnes GL, Graves DT, Einhorn
TA. 2003. Fracture healing as a post-natal developmental process:
molecular, spatial, and temporal aspects of its regulation. J Cell
Biochem 88:873–884.
Gortz B, Hayer S, Redlich K, Zwerina J, Tohidast-Akrad M, Tuerk
B, Hartmann C, Kollias G, Steiner G, Smolen JS, Schett G. 2004.
Arthritis induces lymphocytic bone marrow inflammation and
endosteal bone formation. J Bone Miner Res 19:990–998.
Gutiérrez-Fernández A, Inada M, Balbin M, Fueyo A, Pitiot AS,
Astudillo A, Hirose K, Hirata M, Shapiro SD, Noel A, Werb Z,
Krane SM, Lopez-Otin C, Puente XS. 2007. Increased inflammation delays wound healing in mice deficient in collagenase-2
(MMP-8). FASEB J 21:2580–2591.
Hatori K, Sasano Y, Takahashi I, Kamakura S, Kagayama M,
Sasaki K. 2004. Osteoblasts and osteocytes express MMP2 and -8
and TIMP1, -2, and -3 along with extracellular matrix molecules
during appositional bone formation. Anat Rec A Discov Mol Cell
Evol Biol 277:262–271.
Henle P, Zimmermann G, Weiss S. 2005. Matrix metalloproteinases
and failed fracture healing. Bone 37:791–798.
Herman MP, Sukhova GK, Libby P, Gerdes N, Tang N, Horton DB,
Kilbride M, Breitbart RE, Chun M, Schönbeck U. 2001. Expression of neutrophil collagenase (matrix metalloproteinase-8) in
1046
ITAGAKI ET AL.
human atheroma: a novel collagenolytic pathway suggested by
transcriptional profiling. Circulation 104:1899–1904.
Honma T, Itagaki T, Nakamura M, Kamakura S, Takahashi I,
Echigo S, Sasano Y. 2008. Bone formation in rat calvaria ceases
within a limited period regardless of completion of defect repair.
Oral Dis (in press).
Johansson N, Saarialho-Kere U, Airola K, Herva R, Nissinen L,
Westermarck J, Vuorio E, Heino J, Kähäri VM. 1997. Collagenase-3 (MMP-13) is expressed by hypertrophic chondrocytes, periosteal cells, and osteoblasts during human fetal bone development. Dev Dyn 208:387–397.
Maruya Y, Sasano Y, Takahashi I, Kagayama M, Mayanagi H.
2003. Expression of extracellular matrix molecules, MMPs and
TIMPs in alveolar bone, cementum and periodontal ligaments
during rat tooth eruption. J Electron Microsc 52:593–604.
Mattot V, Raes MB, Henriet P, Eeckhout Y, Stehelin D, Vandenbunder B, Desbiens X. 1995. Expression of interstitial collagenase is
restricted to skeletal tissue during mouse embryogenesis. J Cell
Sci 108(pt 2):529–535.
Nagase H, Woessner JF Jr. 1999. Matrix metalloproteinases. J Biol
Chem 274:21491–21494.
Nakamura M, Sone S, Takahashi I, Mizoguchi I, Echigo S, Sasano
Y. 2005. Expression of versican and ADAMTS 1, 4, and 5 during
bone development in the rat mandible and hind limb. J Histochem Cytochem 53:1553–1562.
Ortega N, Behonick D, Stickens D, Werb Z. 2003. How proteases
regulate bone morphogenesis. Ann N Y Acad Sci 995:109–116.
Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45.
Precious DS, Hall BK. 1994. Repair of fractured membrane bones.
In: Hall BK, editor. Bone. Vol. 9. Differentiation and morphogenesis of bone. Boca Raton: CRC Press. p 145–163.
Rifas L, Arackal S, Weitzmann MN. 2003. Inflammatory T cells rapidly induce differentiation of human bone marrow stromal cells
into mature osteoblasts. J Cell Biochem 88:650–659.
Sasano Y, Zhu JX, Tsubota M, Takahashi I, Onodera K, Mizoguchi
I, Kagayama M. 2002. Gene expression of MMP8 and MMP13
during embryonic development of bone and cartilage in the rat
mandible and hind limb. J Histochem Cytochem 50:325–
332.
Schmitz JP, Hollinger JO. 1986. The critical size defect as an experimental model for craniomandibulofacial nonunions. Clin Orthop
Relat Res 205:299–308.
Schmitz JP, Schwartz Z, Hollinger JO, Boyan BD. 1990. Characterization of rat calvarial nonunion defects. Acta Anat 138:185–
192.
Shen F, Ruddy MJ, Plamondon P, Gaffen SL. 2005. Cytokines link
osteoblasts and inflammation: microarray analysis of interleukin17-and TNF-alpha-induced genes in bone cells. J Leukoc Biol
77:388–399.
Sone S, Nakamura M, Maruya Y, Takahashi I, Mizoguchi I, Myanagi H, Sasano Y. 2005. Expression of versican and ADAMTS
during rat tooth eruption. J Mol Histol 36:281–288.
Tsubota M, Sasano Y, Takahashi I, Kagayama M, Shimauchi H.
2002. Expression of MMP-8 and MMP-13 mRNAs in rat periodontium during tooth eruption. J Dent Res 81:673–678.
Wang K, Vishwanath P, Eichler GS, Al-Sebaei MO, Edgar CM, Einhorn TA, Smith TF, Gerstenfeld LC. 2006. Analysis of fracture
healing by large-scale transcriptional profile identified temporal
relationships between metalloproteinase and ADAMTS mRNA
expression. Matrix Biol 25:271–281.
Werb Z, Chin JR. 1998. Extracellular matrix remodeling during
morphogenesis. Ann N Y Acad Sci 857:110–118.
Yamagiwa H, Tokunaga K, Hayami T, Hatano H, Uchida M, Endo
N, Takahashi HE. 1999. Expression of metalloproteinase-13 (collagenase-3) is induced during fracture healing in mice. Bone
25:197–203.
Zaman G, Jessop HL, Muzylak M, De Souza RL, Pitsillides AA,
Price JS, Lanyon LL. 2006. Osteocytes use estrogen receptor a to
respond to strain but their ER a content is regulated by estrogen.
J Bone Miner Res 21:1297–1306.