close

Вход

Забыли?

вход по аккаунту

?

Emergence of oligoclonal t cell populations following therapeutic t cell depletion in rheumatoid arthritis.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 38, No. 9, September 1995, pp 1242-1251
0 1995, American College of Rheumatology
1242
EMERGENCE OF OLIGOCLONAL T CELL POPULATIONS
FOLLOWING THERAPEUTIC T CELL DEPLETION IN
RHEUMATOID ARTHRITIS
MICHAEL C. JENDRO, TOM GANTEN, ERIC L. MATTESON,
CORNELIA M. WEYAND, and JORG J. GORONZY
Objective. To examine the compartment of CD4+
T cells in patients with rheumatoid arthritis (RA) who
have developed persistent lymphopenia following
antibody-mediated T cell depletion and to investigate
why T cell depletion is of limited therapeutic efficacy.
Methods. Circulating T lymphocytes from 10
patients with seropositive RA treated with the monoclonal antibody (MAb) CAMPATH-1H were longitudinally
monitored by fluorescence-activated cell sorter analysis
with MAb. To assess the molecular diversity of repop
ulating T cells, random samples of T cell clones from the
peripheral blood of 3 patients were analyzed by sequencing the T cell receptor (TCR) p chains. At the time of
recurring disease, the synovial tissue was examined by
immunohistochemistry, and the repertoires of peripheral and synovial tissue T cells were compared by TCR
P-chain sequencing and by semiquantitative hybridization with oligonucleotidesspecific for the V-D-JB junctional region of selected clones.
Results. The reconstitution of the peripheral T
cell compartment was very slow. A mean CD4+ T cell
count of 105/pI was reached 34 weeks following MAb
treatment. After treatment, the percentage of CD4+ T
cells with the CD45RO+ phenotype was significantly
increased (P = 0.001), indicating the expansion of
antigen-primed memory T cells. TCR &chain sequences
revealed a marked restriction in the diversity of repopSupported in part by grants from the National Institutes of
Health (R01-AR-42527 and ROl-AR-41974), the Minnesota Chapter
of the Arthritis Foundation (MAF #85), and the Mayo Foundation.
Dr. Jendro's work was supported by DAAD.
Michael C. Jendro, MD, Tom Ganten, Eric L. Matteson,
MD, Cornelia M. Weyand, MD, PhD, Jorg J. Goronzy, MD, PhD:
Mayo Clinic and Foundation, Rochester, Minnesota.
Address reprint requests to Jorg J. Goronzy, MD, PhD,
Mayo Clinic, 401 Guggenheim Building, 200 First Street SW,
Rochester, MN 55905.
Submitted for publication December 23, 1994; accepted in
revised form March 21, 1995.
ulating T cells with the emergence of dominant clonotypes. Despite the low counts of peripheral CD4+ T
cells, the synovial tissue was infiltrated by CD4+ T cells
to a similar extent as that in RA patients not treated with
MAb. Selected clonotypes that had emerged in the
peripheral blood compartment dominated the repertoire
of tissue-infiltrating T cells in the synovium.
Conclusion. In patients with RA, T cell depletion
induces a long-term imbalance in T cell homeostasis.
Clonal proliferation of CD4+ T cells severely restricts
the diversity of available T cell specificities and results in
the emergence of dominant clonotypes, which accumulate in the synovial tissue despite peripheral lymphopenia.
Rheumatoid arthritis (RA) is characterized by
dense lymphoid aggregates in the synovial membrane
(1,2). The current pathogenic model attributes a critical role to CD4+ T cells, which are thought to recognize a disease-relevant antigen in the joint (3,4). In this
model, activation of T cells is pivotal for the development and maintenance of chronic inflammation. Most
of the attempts at selective immunointervention in RA
have therefore targeted T cells, in particular, CD4+ T
cells and activated T cells. Elimination of T cells
through monoclonal antibodies (MAb) has been successfully used to control disease activity in several
animal models of autoimmunity and in clinical allograft
rejection (5-8). In some of the animal models, longterm remissions of the disease could be induced,
which suggests that the depletion of T cells provided a
window to reestablish tolerance (9-1 1).
Antibodies specific for the lymphocyte surface
antigens CD4, CD5, CD7, CD25, and CDw52 have
been used in the treatment of RA (12-16). Studies with
T cell-depleting antibodies to CD4 or CDw52 molecules have demonstrated not only the efficacy, but also
T CELL RECEPTORS AND RA
1243
Table 1. Demographics of the study population*
Patient
Sex
Age
RF
Erosive
disease
Disease duration
(years)
RA-I
RA-2
RA-3
RA-4
RA-5
RA-6
RA-7
RA-8
RA-9
RA-I0
F
F
F
29
52
29
57
55
42
70
31
72
37
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No
Yes
No
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
3.5
6.5
2.0
7.5
4.0
10.0
12.0
4.0
33.0
9.5
M
F
F
M
F
F
F
CAMPATH- IH
(mdday)
1 .o
1 .o
3.0
3.0 and 30
3.0 and 10
10
30
30
10
10
* Patients RA-4 and RA-5 were re-treated. All were given subcutaneous injections, except for patients
RA-9 and RA-10. who received intravenous treatments. RF = rheumatoid factor: RA = rheumatoid
arthritis.
the limitation, of the antibody treatment in this disease. In most of the patients, the treatment response
was not sustained. Antibody-treated patients developed long-term T cell lymphopenia, which suggests a
reduced capacity to regenerate the pool of CD4+ T
cells (17). Low lymphocyte counts severely restricted
the option of retreatment with antibodies, as well as
the safe use of other immunosuppressive agents.
Moreover, the finding of recurring disease activity
during severe lymphopenia imposes the question of
the role of T cells in synovial inflammation.
In the present study, we analyzed the peripheral T cell repertoire in 10 patients with RA who had
been treated with a MAb specific for the CDw52
antigen in an open-label phase I/II dosage-escalation
study. Repopulating CD4+ T cells were analyzed for
their expression of the CD45RO marker, which indicates previous activation and proliferation of T cells
and which is not expressed on unstimulated naive T
cells (18). In 3 patients, the diversity of the T cell
repertoire was assessed by sequencing the T cell
receptor (TCR) of a random sample of T cell clones.
Our results led us to propose that the repopulation of
the lymphocyte pool occurs mainly by clonal proliferation of surviving T cells. Comparative studies of the
peripheral blood and synovial tissue compartments
suggest that the severe lymphopenia favors the emergence and clonal expansion of T cell specificities
which selectively expand in, or home to, the synovium
and may be responsible for the recurring synovial
inflammation.
PATIENTS AND METHODS
Patients and treatment. We studied 10 patients with
RA who were enrolled in a multicenter, open-label, phase
1/11 dose-escalation study of subcutaneous and intravenous
CAMPATH-1H treatment at one of the centers. Patients had
a diagnosis of RA, as defined by the American College of
Rheumatology (formerly, American Rheumatism Association) 1987 criteria (19) and had failed treatments with at least
1 disease-modifying antirheumatic drug (DMARD). All patients had active disease and had discontinued DMARDs for
1 month prior to enrollment.
CAMPATH-1H was administered by subcutaneous
injection into the patients’ thighs and abdomen on days 1-5
and 8-12, for a total of 10 injections, at the following
dosages: 0.3, 1.0, 3.0, 10, and 30 mg/day. Patients who were
given 0.3 mg/day inconsistently developed 1ymphopenia
after treatment and were therefore excluded from this study.
Two patients received 10 mg/day of intravenous
CAMPATH-1H on days 1-5 and 8-12. Patients RA-4 and
RA-5, who had received 3 mg/day of subcutaneous
CAMPATH-lH, were again treated with 10 mg/day and 30
mg/day, respectively. The demographic data of the patients
are given in Table 1. The clinical characteristics and clinical
responses of the entire study cohort of the multicenter trial
are published elsewhere in this issue of Arthritis and Rheumatism (20).
CAMPATH-1H is derived from a rat MAb to the
CDw52 antigen by transplantation of the hypervariable regions of the rat antibody into human immunoglobulingenes.
The CDw52 antigen is present on virtually all lymphoid cells
and at a lower cell-surface density on monocytes and macrophages (21). The antibody has been shown to effectively
deplete tissue-infiltrating lymphoid cells in patients with
non-Hodgkin’s lymphoma (22).
Flow cytometry studies. Flow cytometry for CD4+
and CD8+ T cell subsets was performed on unseparated
heparinized blood, with fluorescein isothiocyanate (F1TC)conjugated anti-CD3, anti-CD4, and antLCD8 antibodies
(Becton Dickinson, Mountain View, CA) on a FACScan,
before treatment and 2, 6, 14, and 34 weeks after treatment.
Two patients were re-treated with CAMPATH-1H. In these
2 patients, flow cytometry was done 14 and 34 weeks after
re-treatment.
Complete blood cell counts (including white blood
cell and differential counts) were obtained, and counts of
JENDRO ET AL
1244
lymphocyte subset were calculated. To determine the percentage of CD45RO+, CD4+ T cells, peripheral blood
mononuclear cells (PBMC) were purified by density-gradient
centrifugation. Cells were stained with FITC-conjugated
antLCD3 antibody, biotinylated anti-CD4 antibody, phycoerythrin (PE)-conjugated anti-CD45RO antibody, and
streptavidin red 613. A 3-COlOr analysis was performed with
a FACStar flow cytometer (Becton Dickinson), and the data
were analyzed using a Microvax I1 computer (Digital, Maynard, MA, with Becton Dickinson DEC-based software).
T cell cloning and TCR analysis. PBMC were stained
with FITC-conjugated anti-Vp8 and anti-Vp5.1 MAb (T Cell
Diagnostics, Cambridge, MA) and PE-conjugated antiCD4+ antibody (Becton Dickinson). The CD4+ Vp5.1 and
Vp8 subsets were collected by sorting on a FACSVantage.
We confined the TCR analysis to Vp5. 1+ and Vp8+ T cells
because the peripheral lymphopenia prohibited the cell sorting of more Vp families, and these two Vp families represent
relatively large T cell compartments. Cells were stimulated
with immobilized anti-CD3 for 10 hours and then cloned at a
density of 0.5 cells/well in 96-well round-bottomed plates in
the presence of 3 x lo4 irradiated filler cells and 20 unitshl
of recombinant interleukin-2 (IL-2).
To establish T cell clones from synovial tissue, small
segments of synovial tissue were placed into IL-2-containing
medium for 12 hours. T cells in suspension were cloned at a
concentration of 0.5 cells/well without additional in vitro
activation. Total RNA was purified from established T cell
clones by guanidinium thiocyanate and phenol-chloroform
extraction (RNAzol; Tel Test, Friendswood, TX). Complementary DNA (cDNA) was synthesized and amplified by
polymerase chain reaction (PCR) using Vp-Cpspecific
primer sets (23). The Vp primer was attached to a T7
promotor. The amplified material was transcribed in vitro by
using a T7 RNA polymerase, and then sequenced by reverse
transcriptase-mediated dideoxy sequencing using an internal
Cp probe as a reverse transcriptase primer, as recently
described (24,25).
Quantification of single T cell specificities. The representation of single T cell specificities was semiquantified by
using a dot-blot hybridization assay with oligonucleotides
specific for clonotype-specific TCR sequences. Complementary DNA from CD4+ T cells derived from peripheral blood
before and after treatment and derived from synovial tissue
after treatment were amplified by PCR with the appropriate
Vp-specific primer set (Vp5.l or Vp8, depending on the
clonal specificity). The amplified template was dot-blotted
onto supported nitrocellulose membranes, immobilized, and
prehybridized as described (26). The membranes were then
hybridized with a biotinylated Cp probe (ACACAGCGACCTCGGGTGGGGA) and probes specific for the junctional
polymorphisms of the VpS. 1+ clonotype 525 (CCCGGAGGTGGTCCCGGGTTC) and the Vp8+ clonotype 822
(CCCGGTGCTGCCTGCCCGAAA), both of which were
derived from patient RA-7.
The blots were washed at different stringencies as
described (26), incubated with streptavidin-alkaline phosphatase (Dako, Carpinteria, CAI, and then developed with a
color reaction. The signals were scanned using an AMBIS
optical imaging system (AMBIS, San Diego, CA). Serial dilutions of cDNA from clones 525 and 822 were hybridized with
Table 2. Levels and phenotype of circulating CD4+ T cells in
rheumatoid arthritis patients after treatment with anti-CDw52
antibodies
Before treatment
After CAMPATH-1H treatment
14 weeks
34 weeks
CD4+ T cells
(mean f SD
cells/mm3)
CD45RO+ cells
(mean f SD
% CD4+ cells)
930 2 698
19.6 2 13.3
51
105
2
f
73
57
51.7 2 24.6
62.9 5 17.9
the Cpspecific and the clonotype-specific probes to allow
the determination of the frequencies of clonotypes 525 and
822 within Vp5+ and Vp8+ CD4+ T cells, respectively (26).
Immunohistochemistry. Frozen synovial tissue samples were embedded into OCT medium (Miles, Elkhart, IN)
and cut into 4-pm sections using a cryostat. Sections were
air-dried, fixed, and stained with monoclonal anti-CD3,
anti-CD4, anti-CD8, anti-CD20 (Becton Dickinson), and
anti-CD68 (Dako). Slides were developed by subsequent
incubations with biotinylated rabbit anti-mouse IgG (Dako),
peroxidase-labeled streptavidin, and diaminobenzidine substrate solution. The images were captured with a SIT camera
(Hamamatsu, Hamamatsu City, Japan) and analyzed with an
IBAS Image Analysis System (Kontron Elektronik, Munich,
Germany).
RESULTS
Sustained depletion of CD4+ T cells after treatment. All 10 patients developed lymphopenia with
peripheral CD4+ T cell clones lower than 30 cells/pl.
As shown in Table 2, the reduction in CD4+ T cells
persisted for several months. Fourteen weeks after
treatment, the peripheral CD4+ T cell counts reached
an average of 51 cells/pl, and they increased slightly,
to 105 celldpl, by week 34. The T cell population after
treatment was different from the pretreatment population, in that CD4+ T cells predominantly expressed
the CD45RO marker. The CD45RO molecule is expressed on T cells after they have undergone stimulation and proliferation, and is not found on naive T cells
(18).
Before treatment, the mean percentage of
CD4+ T cells expressing the CD45RO marker was
19.6%, which is not different from the percentage of
CD45RO+ cells in age-matched normal controls.
Fourteen weeks after T cell depletion, about half of the
CD4+ T cells expressed the CD45RO marker (Table
2). The trend toward increases in the CD4+ CD45RO
subset continued between weeks 14 and 34. These
results suggest that the patients had very little capacity, if any, to generate new T cells and were rebuilding
1245
T CELL RECEPTORS AND RA
Table 3. Clonally expanded CD4+ T cells in rheumatoid arthritis (RA) patients after CAMPATH-1H
treatment
N-D-N
JB
No. of clonotypes with
identical sequences
CASS
CASS
CASS
CASS
CASS
CAS..
CASS
CASS
LLGQGDWL
FGGRGT
LGEV
GGLS
LTP
GKTY
FRRSL
LGFVY
TF (Jpl.2)
QETQYF (Jp2.5)
YEQYF (Jp2.7)
NEKLFF (Jpl.4)
YEQYF (Jp2.7)
TEAFF (Jpl .1)
TEAFF (Jpl. 1)
TGELFF (Jp2.2)
5121
3/21
3131
3131
213 1
213 1
2131
213 1
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CAS ...
EPGTTG
LGNGG
PSGLAV
PRTGAT
FRAGS
TRTS
FLAGWE
RKTSGRPP
TQYF (Jp2.5)
STDTQYF (Jp2.3)
SYEQYF (Jp2.7)
NTEAFF (Jpl. 1)
TGELFF (Jp2.2)
STDTQYF (Jp2.3)
ETQYF (Jp2.S)
YEQYF 882.7)
7/36
3/36
3/36
2/36
13/56
2/56
2/56
2/56
CASS
CASS
CAS ...
DTAGGAS
LGDSNL
LGGTST
DYQYF (JB2.3)
SYNEQFF (Jp2.1)
ETQYF (Jp2.5)
11/32
10132
3/32
the repopulating T cell compartment by proliferation
of surviving T cells. Alternatively, it is possible that
CD45RO+ T cells are more resistant to antibodymediated lysis or that newly generated cells are immediately activated and become CD45RO+.
To address the question of whether this effect
was age dependent, we analyzed the data separately
for the 5 patients who were younger than age 40.
Thirty-four weeks after antibody treatment, 47.2 &
2.8% (mean ? SD) of peripheral CD4+ T cells expressed the CD45RO phenotype in individuals
younger than age 40. Conversely, patients older than
40 carried 75.6 f 13.4% CD4+ CD45RO+ cells,
indicating that younger patients may have some capacity to generate new T cells, while proliferation of
surviving cells was a dominant mechanism in older
individuals.
Diversity of the TCR repertoire following T cell
elimination. The enormous diversity of the TCR repertoire is a hallmark and a prerequisite for functional
competence in the T cell compartment. If the T cell
pool is regenerated by proliferation of surviving cells
rather than the influx of new cells, the diversity of
receptor molecules could be significantly limited, particularly so if clonal proliferation of selected T cells
occurs. The diversity in the posttreatment T cell
population was therefore studied in the peripheral blood compartments of CD4+ Vp5. l + T cells
and CD4+ Vp8+ T cells in 3 randomly chosen
CAMPATH-1H-treated patients (RA-5, RA-7, and
RA-9). A total of 89 Vp5.1+ and 87 Vp8+ T cell clones
were established and the TCR p chains were sequenced. Fifty-two Vp8+ T cell clones isolated from 2
normal subjects and 52 Vp17+ clones from 2 additional normal subjects all expressed different TCR
p-chain sequences, indicating a high degree of diversity in the CD4+ compartment (ref. 26 and unpublished data).
The results of the sequence analysis of the TCR
p chains from the patients’ T cell clones are given in
Table 3. Several T cell clones with identical TCR p
chains were isolated from all 3 RA patients, indicating
that selected T cell specificities were clonally expanded, and that the posttreatment TCR repertoire
was restricted. Clonally expanded populations represented a significant part of the total T cell compartment. Patient RA-9 had the most restricted TCR
repertoire. Within the sample of 32 CD4+ Vp5.1+ T
cells, only 11 different TCRs were encountered. Two
clonotypes dominated the repertoire, each of them
present with >30% of the Vp5.1+ population.
Oligonucleotides for clonotype-specific sequence polymorphisms (clonotypes 525 and 822) were
utilized to estimate the frequencies of the expanded
clonotypes in patient RA-7 before treatment and at
different time points after treatment. These experi-
1246
JENDRO ET AL
A
B
Figure 1. Immunohistology of rheumatoid arthritis (RA)synovial tissue stained for A, the CD3 T cell
marker and B, the CD4 T cell marker. Left, Patient RA-7 45 weeks after CAMPATH-1H treatment.
Right, Patient with active seropositive RA,matched for disease duration, who was not treated with
CAMPATH-1H.
T CELL RECEPTORS AND RA
1247
A
t
.
B
Figure 2. Immunohistology of rheumatoid arthritis (RA)synovial tissue stained for A, the CD8 T cell
marker and B, the CD20 B cell marker. Left, Patient RA-7; right, control patient.
T
ments demonstrated that the expanded clonotypes
were not detectable before the administration of the
CAMPATH- 1H antibody, but increased in frequency
after T cell depletion (data not shown).
The T cell repertoire in the inflamed synovium
during peripheral T cell lymphopenia. Synovial tissue
was obtained from patient RA-7, who was undergoing
total hip replacement surgery, 45 weeks after treatment. Treatment with CAMPATH-1H had induced a
sustained T cell lymphopenia; however, there was
only transient suppression of joint inflammation. At
the time of surgery, the patient had active joint disease, with a peripheral CD4+ T cell count of 130
cells/pl. Results of immunohistochemical analysis
with MAb specific for the T cell markers CD3, CD4,
and CD8, and the B cell marker CD20 are shown in
Figures 1 and 2. In parallel, we examined synovial
tissue from a patient with active seropositive RA who
was matched for disease duration but had not received
CAMPATH-1H. T h e synovial tissue of t h e
CAMPATH-1H-treated patient had clusters of infiltrating CD3+ and CD4+ T cells, but very few CD8+
T and B cells. Cells expressing CD68, which is a
marker for tissue-infiltrating monocyte/macrophages,
were predominantly found in the sublining layers (data
not shown). Lymphoid aggregates of CD4+ T cells
were present to a similar degree in tissues from the
treated and untreated patients, suggesting that, despite
the low numbers of peripheral T cells, CD4+ T cells
accumulated in the joint.
To analyze the T cell repertoire of tissueinfiltrating CD4+ T cells, T cell clones were established from different tissue fragments obtained from
the same patient. Seventy CD4+ T cell clones were
established from one fragment and 18 from a second
fragment. T cell clones were analyzed for their Vp
gene segment usage. Data for a limited spectrum of Vp
elements, for which the Vp gene segment frequencies
in peripheral blood lymphocytes were determined by
flow cytometry, are given in Table 4. Compared with
peripheral blood, Vp5.1+ T cell clones, but not
Vp5.2+, Vp8+, or Vp12+ T cell clones, were overrepresented in the synovial tissue. In addition to
Vp5.1, the Vp2 element was frequently used in the
synovial tissue (data not shown). Sequence analysis of
Vp5.1+ TCR p chains demonstrated that the Vp5. 1Jp2.2 clonotype (clonotype 525), which had also been
isolated from the peripheral blood of patient RA-7
after treatment with CAMPATH-1H (Table 3), accumulated in the joint (2 of 14 Vp5.l clones sequenced).
In contrast, the Vp8-Jm.2 clonotype (clonotype 822),
which was also overrepresented and clonally expanded in the peripheral blood (Table 3), could not be
identified in the synovial tissue.
To semiquantify the representation of these 2
clonotypes in the peripheral blood and synovial tissue
compartments, a dot-blot assay with oligonucleotide
probes specific for the TCR sequences was used. The
results are shown in Figure 3. Clonotype 525 was
selectively enriched in the synovial tissue compartment compared with the peripheral CD4+ T cell
compartment (23% versus 3% of Vp5. 1+ transcripts).
The clonotype was found in the IL-2 receptor (IL-2R)positive, as well as the IL-2R-negative, synovial T cell
fraction. The expression of IL-2R suggests that these
cells have been recently activated. Considering that
the Vp5.1 element was overrepresented in the synovial
T cell clones, this clonotype accounted for a major
fraction of the T cell infiltrate in the synovial
membrane.
In summary, dense synovial infiltrates of CD4+
T cells were found 45 weeks after T cell depletion,
despite a low peripheral T cell count. Selected T cell
clones which emerged and expanded in the peripheral
blood following T cell-depleting therapy were selectively enriched in the inflamed synoviurn and constituted a major fraction of the inflammatory T cell
infiltrate.
DISCUSSION
This study provides evidence that therapeutic
depletion of T cells results in a long-term imbalance of
T cell homeostasis. Our data demonstrated that the
capacity to repopulate the T cell compartment after
therapy with CAMPATH- 1H is severely restricted.
The circulating CD4+ T cells were composed of
oligoclonal populations. Immunohistologic studies
demonstrated that the synovial tissue contained lymphoid aggregates of CD4+ T cells even at the time
when peripheral CD4+ T cell counts were severely
depressed. Circulating and tissue-infiltrating T cells
shared the emergence of clonal T cells. Differences in
the composition of both compartments indicated that
selective mechanisms control the recruitment to, or
the local proliferation of, CD4+ T cells in the joint.
These data reemphasize the pathogenetic model that
selected T cell specificities contribute to the inflammatory response in RA. Finally, it remains a possibility
that the substantial depletion of CD4-t T cells, as
achieved by CAMPATH-LH injections, favored the
emergence and expansion of dominant clonotypes,
1249
T CELL RECEPTORS AND RA
Table 4. Comparison of Vp gene segment usage of peripheral
blood and synovial tissue CD4+ T cells in a patient with recurring
active disease after treatment with anti-CDw52 antibodies
Synovial tissue
vps. 1
Vp5.2
VPg
vp12
(% CD4+ T cell clones)?
Peripheral blood
(% CD4+ T cells)*
Fragment 1
Fragment 2
8.7
3.6
6.8
5.5
19
4
3
0
28
5
0
0
* Determined by fluorescence-activated cell sorter analysis with
Vp-specific monoclonal antibodies.
t Vp gene expression of established T cell clones was determined by
polymerase chain reaction with Vpspecific primer sets.
some of which could be critical in sustaining the
synovial inflammation.
Although our conclusions are based on a patient
population that, by the nature of phase UII trials, was
small, our observations have important implications
for future T cell-targeted therapeutic approaches in
RA. Initial studies on T cell depletion in RA have
shown that this treatment might be efficacious; however, long-term remissions were the exception
(12,13,17). It was thought to be unlikely that this
treatment mode would restore the immunohomeostasis and reinduce tolerance in this chronic inflammatory
disease. Studies in animal models of autoimmune
diseases have shown that continuous treatment is
often necessary to suppress disease activity (27). Since
the repeated administration of a xenogeneic antibody
tends to result in the neutralization of the antibodies
by an antiglobulin response, efforts have concentrated
on rendering the monoclonal agents less immunogenic.
Strategies have been designed to develop a humanized
version of MAb by transplanting the hypervariable
region of the murine MAb into the framework of
human immunoglobulin genes (28). Our data, however, suggest that the lack of T cell-regenerative
ability, rather than the irnrnunogenicity of the antibody, might limit the option of retreatment. Not only
is pronounced T cell lymphopenia evident for several
months after treatment, but the TCR diversity of the
reemerging T cell population is markedly reduced
as well.
It is not known how much T cell diversity is
needed to maintain immunocompetence and to be able
to render immunoresponses to the variety of exogenous antigens. The TCR repertoire is potentially very
large, with more than 1015different specificities (29). A
complex series of events, including deletion of poten-
tially autoreactive T cells and selection of functional
TCRs during thymic selection and antigenic experience, shape the peripheral T cell repertoire (30,31).
These selection events certainly impose restrictions on
the available TCR repertoire. However, normal individuals still express an enormous spectrum of TCR
molecules. The repertoire of CD4+ T cells in CAMPATH-1H-treated patients lacked diversity. The size
of the oligoclonal T cell populations and the ease of
detecting them suggest that the diversity of the regenerated T cell pool after CAMPATH-1H treatment is
several magnitudes lower than in a normal population.
It is not known whether an immune-deficient state is
associated with this profound decrease in TCR diversity. Reports of the long-term followup on the incidence of infections in the CAMPATH-1H-treated patients have not yet been published. It is possible that
while the patients maintain immunocompetence to the
majority of exogenous antigens, in particular, those
antigens they had developed memory responses to,
they may not be able to generate a primary immune
response to antigenic determinants of selected antigens.
It remains a possibility that the disease itself
contributes to the repertoire abnormalities seen in
CAMPATH-1H-treated patients, in particular, the
emergence of dominant clonotypes. Clonal abnormalities of circulating T cells have been described in RA
patients. Clonal expansions have been found predominantly in CD8+ T cells (32-34). In general, clonal
expansion among CD8+ T cells has been associated
with Felty's syndrome (32,33). However, more recent
Template Dilution
1:l
1:2
1.4
1:l
1.2
1.4
CD4+ PEMC
CD4+ Synovial T cells
IL-2R' Synovial T cells
IL-2R- Synovial T cells
Clonotype 525
Clonotype 822
Figure 3. Frequencies of clonally expanded CD4+ T cells in
peripheral blood mononuclear cells (PBMC) and synovial T cells
obtained from patient RA-7 45 weeks after CAMPATH-IH treatment. Complementary DNA from purified peripheral CD4+ T cells,
synovial CD4+ T cells, and interleukin-2 receptor (IL-2R)-positive
and IL-2R-negative synovial T cells was amplified with the appropriate Vp primer set, and serial dilutions of the amplified material
were probed with clonotype-specific oligonucleotides.
1250
studies have shown that clonal expansion can be found
in at least 10% of the RA population studied (34). We
have also observed clonal expansion of CD4+ T cells
in patients with RA (26). These clonal expansions
involved only a limited number of clonotypes, and
were smaller and less widespread than the clonal
expansion we have observed after CAMPATH-1H
treatment. In 15 RA patients, we identified 3 clones
per patient in 6 Vp families studied. In contrast, clonal
expansion was an infrequent event in patients with
active psoriatic arthritis (35). These observations suggest that patients with RA may be particularly susceptible to developing an unbalanced T cell repertoire.
The lack of capability for generating new CD4+ T cells
may be associated with the disease. The age of the
patient population and the disease itself may represent 2
risk factors that significantly restrict the use of T celldepleting strategies.
Our data support the model that T cells are
important in disease flares in patients who have undergone T cell depletion and who have persistent T cell
lymphopenia. The role of T cells in the synovial
inflammation of RA has been a subject of controversy
(36,37). The presence of CD4+ T cells in the inflamed
synovium and the association of HLA-DRB 1 with the
disease have been taken as evidence that T cells are
regulating the inflammatory response. However, the
relative paucity of T cellderived cytokines in the
tissue and the lack of consensus regarding the T cell
specificities of tissue-infiltrating T cells have raised
doubt about the unique role of CD4+ T cells in the
pathogenesis of RA (36,37). The data presented here
give support for the hypothesis that the inflammatory
response is T cell dependent. Despite the peripheral
T cell lymphopenia, the immunohistochemistry of
the synovial tissue demonstrated clusters of tissueinfiltrating CD4+ T cells. More importantly, the repertoire studies of the synovial infiltrate showed that
selected T cell specificities were enriched in the synovial infiltrate while other specificities, which were also
expanded in the peripheral blood compartment, did
not home to or expand in the joint.
These findings emphasize the model that the
inflammatory response in the synovium is related to
the antigen specificity of the tissue-infiltrating T cells.
The data also support the concept that a T celldirected therapy in RA should be targeted to selected
T cell specificities. Global T cell depletion, as achieved
in this study, may impair the regulatory mechanism
controlling clonal T cell expansion and may favor the
emergence of potentially arthritogenic clonotypes.
JENDRO ET AL
ACKNOWLEDGMENTS
We are indebted to Dr. Paul J. Kurtin for his help in
performing the immunohistochemistry analyses, to
James W. Fulbright for technical assistance, and to Toni L.
Higgins for assistance in the preparation of the manuscript.
REFERENCES
1. Van Boxel JA, Paget SA: Predominantly T cell infiltrate in
rheumatoid synovial membranes. N Engl J Med 293517-520,
1975
2. Kurosaka M, Ziff M: Immunoelectron microscopic study of the
distribution of T cell subsets in rheumatoid synovium. J Exp
Med 158:1191-1210, 1983
3. Hanis ED Jr: Rheumatoid arthritis: pathophysiology and implications for therapy. N Engl J Med 322:1277-1289, 1990
4. Todd JA, Acha-Orbea H, Bell JI, Chao N, Fronek Z, Jacob CO,
McDermott M, Sinha AA, Timmerman L, Steinman L, McDevitt HO: A molecular basis for MHC class 11-associated autoimmunity. Science 2401003-1009, 1988
5. Zamvil SS, Steinman L: The T lymphocyte in experimental
allergic encephalomyelitis. Annu Rev Immunol 8579-623, 1990
6. Waldmann H: Manipulation of T-cell responses with monoclonal antibodies. Annu Rev Immunol 7:407-444, 1989
7. Wofsy D, Seaman WE: Successful treatment of autoimmunity
in NZB/NZW F1 mice with monoclonal antibody to L3T4. J
Exp Med 161:378-391, 1985
8. Ortho Multicenter Transplant Study Group: A randomized
clinical trial of OKT3 monoclonal antibody for acute rejection of
cadaveric renal transplants. N Engl J Med 313:337-342, 1985
9. Hutchings P, O’Reilly L, Parish NM, Waldmann H, Cooke A:
The use of a non- depleting anti-CD4 monoclonal antibody to
re-establish tolerance to beta cells in NOD mice. Eur J Immunol
22~1913-1918, 1992
10. Van den Broek MF, van de Langerijt LG, van Bruggen MC,
Billingham ME, van den Berg WB: Treatment of rats with
monoclonal anti-CD4 induces long-term resistance to streptococcal cell wall-induced arthritis. Eur J Immunol22:57-61, 1992
11. Chatenoud L, Thervet E, Primo J, Bach JF: Anti-CD3 antibody
induces long-term remission of overt autoimmunity in nonobese diabetic mice. R o c Natl Acad Sci U S A 91: 123-127,1994
12. Horneff G, Burmester GR, Emmrich F, Kalden JR: Treatment
of rheumatoid arthritis with an anti-CD4 monoclonal antibody.
Arthritis Rheum 34: 129-140, 1991
13. Moreland LW, Bucy RP, Tilden A, Pratt PW, LoBuglio AF,
Khazaeli M, Everson MP, Daddona P, Ghrayeb J, K i l g d C ,
Sanders ME, Koopman WJ: Use of a chimeric monoclonal
anti-CD4 antibody in patients with refractory rheumatoid arthritis. Arthritis Rheum 36:307-318, 1993
14. Strand V, Lipsky PE, Cannon GW, Calabrese LH, Wiesenhutter C, Cohen SB, Olsen NJ, Lee ML, Lorenz TJ, Nelson B, and
The CD5 Plus Rheumatoid Arthritis Investigators Group: Effects of administration of an anti-CD5 plus immunoconjugate in
rheumatoid arthritis: results of two phase 11 studies. Arthritis
Rheum 36:62@430, 1993
15. Kirkham BW, Thien F, Pelton BK, Pitzalis C, Amlot P,
Denman AM, Panayi GS: Chimeric CD7 monoclonal antibody
therapy in rheumatoid arthritis. J Rheumatol 19: 1348-1352, 1992
16. Isaacs JD, Watts RA, Hazleman BL, Hale G, Keogan MT,
Cobbold SP, Waldmann H: Humanized monoclonal antibody
therapy for rheumatoid arthritis. Lancet 340:748-752, 1992
17. Moreland LW, Pratt PW, Bucy RP, Jackson BS, Feldman JW,
Koopman WJ: Treatment of refractory rheumatoid arthritis with
a chimeric anti-CM monoclonal antibody: long-term followup
of C M + T cell counts. Arthritis Rheum 37:834-838, 1994
T CELL RECEPTORS AND RA
18. Akbar AN, Terry L, Timms A, Beverley PC, Janossy GJ: Loss
of CD45R and gain of UCHLl reactivity is a feature of primed
T cells. J Immunol 140:2171-2178, 1988
19. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS,
Medsger TA Jr, Mitchell DM, Neustadt DH, Pinals RS, Schaller
JG, Sharp JT, Wilder RL, Hunder GG: The American Rheumatism Association 1987 revised criteria for the classification of
rheumatoid arthritis. Arthritis Rheum 31:315-324, 1988
20. Matteson EL, Yocum DE, St. Clair EW, Achkar AA, Thakor
MS, Jacobs MR, Hays AE, Heitman CK, Johnston JM: Treatment of active refractory rheumatoid arthritis with humanized
monoclonal antibody CAMPATH-1H administered by daily
subcutaneous injection. Arthritis Rheum 38: 1187-1 193, 1995
21. Hale G , Xia MQ, Tighe HP, Dyer MJ, Waldmann H: The
Campath-I antigen (CDw52). Tissue Antigen 35:118-127, 1990
22. Hale G, Dyer MJ, Clark MR, Phillips JM, Marcus R, Riechmann L, Winter G, Waldmann H: Remission induction in
non-Hodgkin lymphoma with reshaped human monoclonal
antibody Campath-1H. Lancet 2: 13941399, 1988
23. Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler
J: Interaction of Staphylococcus aureus toxin “superantigens”
with human T cells. R o c Natl Acad Sci U S A 862394143945,
1989
24. Goronzy JJ, Xie C, Hu W, Lundy S, Weyand C: Restrictions in
the repertoire of allospecific T cells. J Immunol 151:825-836,
1993
25. Stoflet ES, Koeberl DD, Sarkar G, Sommer SS: Genomic
amplification with transcript sequencing. Science 239:491-494,
1988
26. Goronzy JJ, Bartz-Bazzanella P, Hu W, Jendro MC, WalserKuntz DR, Weyand CM: Dominant clonotypes in the repertoire
of peripheral CD4+ T cells in rheumatoid arthritis. J Clin Invest
94:206&2076, 1994
1251
27. Connolly K, Roubinian JR, Wofsy D: Development of murine
lupus in CM-depleted NZB/NZW mice: sustained inhibition of
residual C M + T cells is required to suppress autoimmunity. J
Immunol 149:3083-3088, 1992
28. Riechmann L, Clark M, Waldmann H, Winter G: Reshaping
human antibodies for therapy. Nature 332:323-327, 1988
29. Davis MM: Molecular genetics of the T cell receptor p chain.
Annu Rev Immunol 3537-560, 1985
30. Nossal GJ: Negative selection of lymphocytes. Cell 76229-239,
1994
31. Von Boehmer H: Positive selection of lymphocytes. Cell 76:
219-228, 1994
32. Barton JC, Vasthofer EF, Egan ML, Heck Jr LW, Koopman
WJ, Grossi CE: Rheumatoid arthritis associated with expanded
populations of granular lymphocytes. Ann Intern Med 104:31&
323, 1986
33. Gonzales-Chambers R, Przepiorka D, Winkelstein A, Agarwal
A, Starz TW, Kline WE, Hawk H: Lymphocyte subsets associated with T cell receptor p-chain gene rearrangement in
patients with rheumatoid arthritis and neutropenia. Arthritis
Rheum 35516-520, 1992
34. DerSimonian H, Sugita M, Glass DN, Maier AL, Weinblatt
ME, Reme T, Brenner MB: Clonal V12.1+ T cell expansions in
the peripheral blood of rheumatoid arthritis patients. J Exp Med
177:1623-1631, 1993
35. Waase I, Kayser C, Schmeling PJ, Turner KD, Goronzy JJ,
Weyand CM: Disease specific alterations in the peripheral T cell
repertoire of rheumatoid arthritis patients (abstract). Arthritis
Rheum 37 (suppl9):S279, 1994
36. Firestein GS, Zvaifler NJ: How important are T cells in chronic
rheumatoid synovitis? Arthritis Rheum 33:76&773, 1990
37. Goronzy JJ, Weyand CM: Interplay of T lymphocytes and
HLA-DR molecules in rheumatoid arthritis. Curr Opin Rheumatol 5:16%177, 1993
Документ
Категория
Без категории
Просмотров
0
Размер файла
977 Кб
Теги
oligoclonal, population, emergency, following, therapeutic, arthritis, depletion, rheumatoid, cells
1/--страниц
Пожаловаться на содержимое документа