close

Вход

Забыли?

вход по аккаунту

?

Identification and molecular analysis of storage proteins from Heliothis virescens.

код для вставкиСкачать
Archives of lnsect Biochemistry and Physiology 14:131-150 (1990)
Identification and Molecular Analysis of
Storage Proteins from Heliothis virescens
Robert E Leclerc and Stephen G . Miller
lnsect Attractants, Behavior, and Basic Biology Research Laboratory, Agricultural Research
Service, U.S. Department of Agriculture, Gainesville, Florida
Three abundant storage proteins have been detected in larval and pupal
hemolymph and pupal fat body of the tobacco budworm, Heliothis virescens.
These polypeptides have subunit molecular weights of 74,000, 76,000, and
82,000, as determined by SDS-PAGE and exist as 450,000-M, hexamers i n their
native state. A purified 82,000-M, storage protein fraction has been obtained
along with a preparation containing equivalent amounts of the 74,000-M, and
76,000-M, subunits, and antisera raised to each of these components have
been used to document the developmental profiles of protein accumulation
and synthesis by fat body. cDNA clones corresponding to each of three abundant classes of fat body mRNAs have been recovered, and at least one of these
has been unambiguously demonstrated to encode the 82,000-M, storage protein subunit. Northern blot studies with these cDNA clones revealed that the
developmental accumulation of transcripts in fat body for each was consistent with the general pattern of storage protein biosynthesis, and more interestingly, that transcripts hybridizing to two of these cDNA sequences are also
found in testes. These two cDNAs have also been sequenced revealing that
one encodes a polypeptide similar to arylphorins, a class of storage proteins
widely distributed i n Insecta. The derived amino sequence of the second
cDNA, corresponding to the 82,000-M, protein, had no unusual compositional features and determination of its structural relationship to other hemolymph polypeptides awaits molecular analysis of related genes from other
insects.
Key words: hemolymph, plasma proteins, cDNA clones, DNA sequencing
INTRODUCTION
Insect hemolymph contains a diverse array of peptides and proteins reflecting the numerous roles served by this specialized tissue in mediating intercelReceived December 18,1989; accepted April 17,1990.
Address reprint requests to Dr. Stephen G . Miller, USDNARS, P.0.Box 14565, Gainesville, FL
32604.
Mention of a trademark, warranty, proprietary product, or vendor does not constitute a guarantee by the U.S. Department of Agriculture and does not imply its approval to the exclusion
of other products or vendors that may also be suitable.
0 1990 Wiley-Liss, Inc.
132
Leclerc and Miller
lular communication, transporting metabolites, and imposing a defensive
barrier against microorganisms. Quantitative and qualitative changes in the
spectrum of macromolecules exported into this compartment from other
tissues impose additional complexity on this system, and have often been
associated with either the developmental stage or physiological status of
the animal [l-31.
One of the more dramatic examples of developmental regulation is provided
by an abundant set of hemolymph proteins collectively called storage proteins
[3,4]. The concentration of these polypeptides increases markedly in the blood
of final instar larvae of holometabolous insects where they comprise upwards
of 80% of the total hemolymph protein by weight [5-81. The subsequent resorption of these polypeptides by pharate pupal fat body cells and their deposition as proteinaceous granules have suggested that they represent a stored
amino acid reserve t9-111. The fat body is the primary site of synthesis of storage proteins, secreting them as glycosylated hexa- or octameric aggregates composed of 70,000- to 90,000-M, subunits [3,5,7,12].
Despite the existence of an extensive literature on storage proteins from both
Lepidoptera and Diptera there are significant gaps in our understanding of
their synthesis and processing, assembly, transport, and physiologic function.
This situation can in part be attributed to the diversity of insect species that
have served as experimental subjects, presenting an inconsistent, and at times
contradictory, overview of storage protein expression and metabolism. The
function of these proteins, for example, remains obscure, since in addition to
being stored as granules in pupal fat body cells, they have been detected in
the cuticle [13] and may also bind potentially toxic xenobiotics [14]. Likewise,
the recent recognition of several other cell types as secondary sites of storage
protein synthesis [15-181 raises the possibility that several distinct regulatory
controls are imposed on these genes. One important step toward resolving
many of these issues is obtaining cloned DNA molecules encoding the storage proteins from which primary amino acid sequences and sites of posttranslational modification can be deduced. These clones would also be useful
as probes for determining steady-state levels of transcript as a function of developmental status or experimental treatment. Furthermore, expression vectorbased systems containing storage protein genes may prove invaluable in
dissecting biochemical pathways leading to their metabolism and transport.
We report here some results of molecular analyses of storage proteins and
their genes from the tobacco budworm, Heliothis virescens. Three abundant
larval hemolymph and pupal fat body polypeptides having subunit molecular weights of 74,000, 76,000, and 82,000 (designated p74, p76, and p82, respectively) were identified, and three unique cDNA clones recovered from a
fat body library were characterized further. A p82 cDNA clone was unambiguously identified by immunoblot analysis of recombinant fusion protein, but
the identities of the other two remained unconfirmed. Both the p82 cDNA
and a putative p76 cDNA clone were sequenced, revealing an arylphorin-like
amino acid composition for the latter. Northern blot studies also demonstrated
that the p82 and putative p76-M, genes are transcribed in testes, indicating
that metabolically distinct storage protein pools occur in the hemolymph and
testicular fluid.
Analyses of Storage Proteins in Heliothis
133
MATERIALS AND METHODS
Insects
The Heliothis virescem colony used in these studies was established in 1975
at the Bioenvironmental Control Laboratory (Stoneville, MS); insects were
reared on a standard diet [19] at 26°C and 80% RH. Under these conditions,
the fourth larval instar lasted for 3 days, fifth-instar larvae fed for 4 days,
burrowed and ceased feeding on the 5th day, and completed pharate pupal
development by the end of the 6th day. Pupal development lasted for an additional 9 days, and adults began to emerge on the 10th day.
Protein Preparations
Hemolymph exuding from a clipped proleg was rapidly diluted 100-fold in
chilled fat body homogenization buffer (FBHBS:50mM Tris-HC1, pH8 containing 1mM phenylmethylsulfonyl fluoride, 1mM dithiothreitol, 1mM EDTA, and
0.01% [w/v] phenylthiourea), and the mixture was centrifuged for 10 min at
12,000g to pellet hemocytes. Dissected fat bodies were rinsed in Grace’s insect
tissue culture medium, sonicated in 5 vol FBHB, and centrifuged for 10 min at
12,OOOg. The supernatants of both preparations were used for routine analysis of proteins by SDS-PAGE and in immunoprecipitation studies.
Purified storage protein fractions were obtained using undiluted hemolymph
(freed of hemocytes by centrifugation) obtained from late fifth-instar larvae.
The first step in their preparation used centrifugation on NaBr density gradients by a method modified from Shapiro et al. [20]. Hemolymph (0.5 ml) was
mixed with 1.5 ml of a solution containing 17.6%NaBr and introduced into
an 80Ti centrifuge tube (Beckman, Palo Alto, CA) beneath a step gradient
consisting of 3.6 ml aliquots of 7.8%, 4.3% and 0.5% NaBr solutions. Following
centrifugation of the gradients for 2.5 h at 70,000 rpm using an 80Ti rotor
(Beckman),a bluish subnate fraction containing only the storage proteins plus
a contaminating chromoprotein was recovered with a pipet. This fraction was
dialyzed against several changes of anion-exchange buffer (50 mM Tris-HCl,
pH 7.8 containing 1 mM EDTA) and then fractionated by HPLC on a DEAE5PW column (BioRad, Kchmond, CA) equilibrated with the same buffer. Column fractions containing pure p82 (as judged by Coomassie blue staining of
SDS gels) were recovered from the initial buffer wash and a second broad
AZ8,,-absorbing peak containing equal amounts of p74 and p76 eluted at the
midpoint of a 0-0.5M NaCl gradient. The blue chromoprotein was recovered
as a third peak eluting at the end of the salt gradient. Antisera were raised to
the p82 and p74-p76-containing peaks in rabbits, and their specificities were
evaluated in immunoblot and immunoprecipitation analyses (see below).
Protein Analyses
Separations of proteins by SDS-PAGE were performed on polyacrylamide
gels prepared as described elsewhere [12]. For immunoblot studies, replicas
a
*Abbreviations used: FBHB = fat body homo enization buffer; HPLC = high-performance
liquid chromatography; p74, p76, and p82 = t e storage proteins having subunit molecular
weights of 74,000, 76,000, and 82,000, respectively; PMSF = phenylmethylsulfonyl fluoride;
SDS-PAGE = sodium dodecyl sulfate-polyacrylamide gel electrophoresis; SSC = sodium chloride and sodium citrate; SSPE = sodium chloride and phosphate and EDTA.
134
Leclerc and Miller
of SDS gels were made by electroblotting onto nitrocellulose filters (Schleicher
and Schuell, Keene, NH) using standard procedures [21] and immobilized
antigens were detected with primary antibody followed by treatment with goat
antirabbit IgG-conjugated horseradish peroxidase (BioRad).
For the determination of storage protein native molecular weights, hemolymph collected as described above was passed over an 0.9 x 54 cm Biogel A-5
column (BioRad) equilibrated with 20 mM Tris-HC1, pH 8 containing 0.1 mM
PMSF, 50 mM NaCl, 0.5 mM EDTA, and 0.02% NaN3. The column had been
calibrated by independently determining the elution volumes of protein
molecular weight standards (Pharmacia, Piscataway, NJ), which included
thyroglobulin (660,000 MJ, ferritin (440,000 M J , catalase (235,000 MJ, and
aldolase (155,000 MJ.
Fat body proteins from staged tissues were pulse-labeled for 2-4 h in Grace’s
medium (lacking L-methionine) containing 250 p,Ci/ml [35S]methionine(1,060
Cilmmol; New England Nuclear, Boston). In experiments designed to inhibit
protein glycosylation, tunicamycin (Eli Lily, Indianapolis, IN) was added to
cultured fat body 12 h prior to pulse-labeling. The culture medium containing
exported proteins and a post-l2,OOOg supernatant of tissue sonicates were
saved for further study. For immunoprecipitation of radiolabeled proteins from
extracts, samples were made 1%with respect to Triton X-100, 1/20 vol storage
protein antiserum was added, and the mixtures were held for 14 h at 4°C.
Immune complexes were collected by centrifugation of the reactions through
a FBHB cushion containing 1% Triton X-100 and 1 M sucrose for 30 min at
12,OOOg. The supernatants were carefully removed, the pellets rinsed with
FBHB, and then dissolved by boiling in SDS-PAGE sample buffer.
cDNA Library Construction and Screening
A cDNA library was constructed using poly (A)+ RNA isolated from fat body
dissected from 2-day-old final instar larvae. Double-stranded cDNA was synthesized according to Watson and Jackson [22] and ligated into hgtl0 arms
following the addition of EcoRl linkers [23].Approximately 1 x lo4phage plaque
replicas on nitrocellulose filters [24] were screened with a uniformly labeled
single-stranded cDNA probe synthesized from the same fat body poly(A)+
RNA sample used to construct the library. Hybridizing plaques yielding strong
autoradiographic signals were taken through two additional rounds of plaque
purification using the same probe. Purified phage DNA preparations [25] from
20 independent isolates were digested with EcoRl and the purified inserts were
subcloned into pUC plasmid vectors. This collection of subclones was ultimately shown to be composed of three discrete classes of sequences based on
insert-insert cross-hybridization and congruence of physical maps.
Nucleic Acid Preparations and Analyses
Poly (A)+ RNA was prepared from various tissues by guanidinium extractiodCsC1 centrifugation [26] followed by selection on oligo(dT)-cellulose. Total RNA was prepared from tissue extracts using the one-step method of
Chomczynski and Sacchi [27]. Denatured RNA molecules were fractionated
on 1.2% agarose gels containing formaldehyde and transferred to nitrocellulose filters for Northern blot analysis [24]. Hybridizations of Northern blots
Analyses of Storage Proteins in Heliofhis
135
were performed at 42°C in a solution containing 50% formamide, 5X SSPE
[24], 10 mM EDTA, 20 p,g/ml salmon sperm DNA, 10 pg/ml poly(A), and 0.1%
SDS. Filters hybridized to radiolabeled cDNA probes were washed down to a
level of stringency corresponding to 0.25X SSC [24]plus 0.1% SDS at 65°C.
Sau3A restriction fragments from the storage protein cDNAs were cloned
into the BamHl site of the pEX expression vector plasmids for the analysis of
fusion proteins 1281. Eschevichiu coli pop2136 cells transfomed with these constructs grown on LB plates were induced by 2 h of growth at 42"C, and fusion
protein-positive clones were detected in immunoblots of nitrocellulose replicas. Liquid cultures of putative positive clones were grown at 37°C shifted to
42°C for an additional 2 h of growth, and extracts were prepared for Western
blot analysis [21,28].
The nucleotide sequence of cDNA clones was determined using the dideoxy
chain-terminatingreaction devised by Sanger et al. [29].Double-stranded plasmid templates were prepared and denatured according to Chen and Seeburg
[30], and primed reactions were run using Sequenase enzyme (USB, Cleveland, OH) in the presence of ["SI-a-(thiotriphosphate) deoxyadenosine (New
England Nuclear). Both strands were sequenced from either intact cDNA
clones or plasmids containing nested deletions created by treatment with exonuclease I11 and S1 nuclease [31].
RESULTS
Identification of Storage Proteins
Total hemolymph and fat body proteins were screened by SDS-PAGE in
order to identify storage proteins distinguished by their chemical abundance
and subunit molecular weights [3,5,7,10,12]. This analysis revealed the presence of four abundant polypeptides in larval and pupal hemolymph with apparent subunit molecular weights of 74,000, 76,000, 82,000, and 160,000 (Fig.
1A). On the basis of Coomassie blue staining, these polypeptides increased
in relative abundance in blood throughout the final larval instar, and conversely, appeared in fat body upon cessation of feeding in burrowing stage
larvae (Fig. 1B). p82 accumulated in pupal fat body to a lesser extent than did
p74 and p76 and was found predominantly in the hemolymph over the developmental times analyzed. The pattern of accumulation of the 160,000-M, protein also differed in that it appeared to be quantitatively resorbed from the
blood by fat body at pharate pupal development. By analogy with other insects studied, these characteristic distributive properties of the p74, p76, and
p82 proteins between hemolymph and fat body and their subunit molecular
weights indicate that they represent H. vivescens storage proteins [1,31.
Purification and Analysis of Storage Proteins
Hemolymph from late fifth-instarlarvae served as the starting material for
the purification of the storage proteins (Fig. lA), and an indispensable first
step was found to be its fractionation on NaBr step gradients (see under Materials and Methods for details). This procedure separated the three storage
proteins and the 160,000-M, subunit protein (subsequently found to be analogous to the H. tea chromoprotein in its physical properties [32]; unpublished
136
Leclerc and Miller
Fig. 1. Four abundant polypeptides occur in Heliothis hemolymph and fat body. A sample of
25 Fg of total hemolymph protein (A) or 30 pg of fat body protein (B) from each of the developmental stages shown was separated by SDS-PACE on 7.5% polyacrylarnide gels and stained
with Coomassie blue. Samples from late fourth instar larvae (4th), early, mid, and late fifthinstar larvae (E5th, M5th, LSth), burrowing stage larvae (B),pharate pupae (Pp) and pupae on
days 1, 3, 5 and 9 of development (dl, d3, d5 and d9) were included in this analysis. The positions and subunit molecular weights of the four proteins discussed in the text are shown at
the right of each panel, and the migration of standard proteins i s indicated to the left of A.
observations) from most of the lower-molecular-weight polypeptides (Fig. 2A)
and the lipophorin subunits (not seen in Fig. 2). Separation of this subnate
fraction by DEAE ion exchange chromatography resulted in the recovery of
two fractions which contained either p82 alone or approximately equivalent
amounts of p74 and p76 (Fig. 2A).
Polyclonal antisera were raised to the p82 and p74-p76 DEAE fractions
(Fig. 2A) for further studies. The specificity of these antibody preparations
was evaluated in immunoprecipitation experiments using radiolabeled proteins recovered from the medium of pulse-labeled fat body cultures, demonstrating a pattern of protein precipitation consistent with the composition of
the antigen preparations (Fig. 2B).
The pattern of proteins synthesized by larval fat body in the presence of
tunicamycin, a drug that inhibits the transfer of nucleotide-bound carbohydrate to dolichol phosphate [33],was evaluated to determine whether the storage proteins are glycosylated. Comparison of the total proteins synthesized
by treated and untreated tissue showed an increase in the electrophoretic mobility of p82 in the latter sample to a position corresponding to an apparent
molecular mass of 78,000 (Fig. 2C). Tunicamycin treatment also severely curtailed the export of newly synthesized fat body proteins into the medium,
with the exception of the incompletely processed p82 whose extracellular accumulation was reduced by approximately one-half. Reaction of fat body extracts and medium from tissues pulse-labeled in the presence of tunicamycin
with the p82-specific antiserum confirmed the identity of this faster migrating polypeptide (Fig. 2C, final two lanes; note the detection of a small amount
of putatively glycosylated p82 in the exported sample). By contrast, a concomitant reduction in the apparent molecular mass of p74 and p76 (which
Analyses of Storage Proteins in Heliofhis
137
Fig. 2. A : Various fractions obtained in the course of purifying the storage proteins. Unfractionated hemolymph ("blood") protein (40 pg), and equivalent amounts from the sodium bromide gradient subnate (NaBr) and the two storage protein-containing DEAE fractions (DEAE-1
and DEAE-2) were separated by SDS-PAGE o n a 7.5% polyacrylamide gel and stained with
Coomassie blue (the positions of molecular weight markers appear to the left of the panel). B :
Autoradiogram of a 7.5% polyacrylamide SDS gel showing the specificity of the p82 and p74-p76
antisera raised to the Heiiothis storage proteins. Fat body proteins were pulse-labeled in vitro
with ["Slmethionine, and -5 x 104dpmof total protein secreted into the mediumwas fractionated on the lane labeled "export." The proteins immunoprecipitated from equivalent aliquots
of medium with p82 antiserum (82) and p74-p76 antiserum (74/76) are shown in adjacent lanes.
C: Results of in vitro metabolic radiolabeling studies of untreated fat body and tissue exposed
to tunicamycin. Newly synthesized proteins from fat body extracts (fat body lanes) and from
incubation media (export lanes) of untreated ( - ) and treated ( + ) cultures were separated by
SDS-PAGE on a 12.5% polyacrylamide gel (-8 x 104dpmof total protein per lanewas applied to
the gel). The final two lanes show the reaction products of equivalent aliquots of fat body
extract (Fb [82]) and medium (Ex [82]) treated with p82 antiserum. Using these conditions for
electrophoretic separation, p74 and p76 (denoted by open circles adjacent to the first two lanes)
were not resolved from each other. The positions of molecular weight standards are indicated
to the right of the panel. Fat body dissected from 3-day-old final instar larvae served as the
source of proteins in Band C.
were not resolved from each other in this 10% polyacrylamide gel; Fig. 2C) by
tunicamycin treatment was not observed; the secretion of both polypeptides
was completely blocked in treated tissues, a result verified in immunoprecipitation studies using the p74-p76 antiserum (data not shown).
Whole blood proteins were also fractionated by gel permeation chromatography on a calibrated Bio-gel A-5 column, demonstrating that all three storage
proteins coeluted at a volume corresponding to a molecular weight of 450,000
(Fig. 3 ) . While this analysis indicates that the Hehthis storage proteins are
composed of six subunits as is the case in other insects [3], the distribution of
subunits among native complexes is not known; their elution properties on
the DEAE column do, however, suggest that P82 assembles into a homomultimer while the p74 and p76 subunits form hybrid complexes.
138
Leclerc and Miller
-
Ve-Vo/ Vi Vo
Fig. 3. The storage proteins have native molecular weights of -450,000, as determined by gel
permeation chromatography. Four milligrams of crude larval hemolymph protein were passed
through a Bio-gel A-5 column at a flow rate of 5 ml/h. The inset shows aliquots of the sample
loaded onto the column (L) and the storage protein-containing A2BDpeak (P)separated by
SDS-PAGE. All three storage proteins eluted at a position in the effluent just ahead of the ferritin standard (vertical arrow); other calibration standards included thyroglobulin, catalase, and
aldolase (see under Materials and Methods for details).
Developmental Patterns of Storage Protein Accumulation and Synthesis
Immunoblot analyses of hemolymph proteins using the two antisera were
performed in order to define more precisely the developmental stage-specific
profile of storage protein accumulation. The pattern seen (Fig. 4A) was generally confirmatory of the developmental profiles deduced by Coomassie blue
staining (see Fig. lA), indicating that comigration of unrelated subunits on
these SDS gels is not a confounding variable. The greater sensitivity provided
by immunological detection did reveal the presence of p82 in hemolymph
from fourth-instar and early fifth-instar larvae. The results of these studies
also highlight the greater temporal variability in the level of accumulation of
p74 and p76 as compared with p82 during the late final larval instar and into
pupal development. This observation is likely attributable to the preferential
resorption of p74 and p76 by fat body tissue, which begins at pharate pupal
development (see Fig. 1).
The developmental stage-specificity of fat body protein synthesis was also
determined in order to provide baseline data on storage protein gene expression. For these studies, staged fat bodies were incubated in vitro with [35S]methionine and pulse-labeled proteins from tissue homogenates and culture
media were separated by SDS-PAGE and detected autoradiographically. Fat
body from wandering fourth and feeding fifth instar larvae synthesized a large
number of proteins (Fig. 4B; estimated to be several hundred based on this
analysis and related two-dimensional SDS gel electrophoretic studies; data not
Analyses of Storage Proteinsin Heliathis
139
shown), a subset of which were secreted into the medium; the three storage
protein subunits can be seen to predominate in the exported fraction of the
feeding fifth larval instar samples (Fig. 4B, right). Beginning at pharate
pupal development, the relative levels of both protein synthesis and export
by fat body decline as the tissue assumes a more dominant storage function
(lanes 4-6).
Equal volumes of fat body extracts and media containing metabolically radiolabeled proteins were treated simultaneously with the p82 and p74-p76
antisera, and the reaction products were again analyzed by SDS-PAGE/autoradiography (Fig. 48, lower panel). This analysis showed that synthesis of p82
began early in the fifth larval instar and continued through the first day of
pupal development, after which both its synthesis and export abruptly declined
to undetectable levels. Given the existence of p82 in hemolymph of fourthinstar larvae (Fig. 4A), failure to detect its synthesis here may be attributable
to the use of very late penultimate larval instar fat body (a technical restriction
imposed by the inability to dissect and weigh tissue from younger larvae); in
this connection, the synthesis of storage proteins in Munducu has previously
been documented to cease at the intermolt period preceding the final larval
instar [34]. An alternative unexplored explanation is that p82 storage protein
is secreted into the hemolymph during earlier larval instars by tissues other
than fat body. Synthesis of p74 and p76 by fourth-instar larval fat body was
detected in these experiments, at least in the secreted fraction. Both proteins
continued to be synthesized until pharate pupal development (Fig. 4B lower,
lane 4), but their secretion ceased at some earlier point during the 2-day interval separating feeding stage larvae and pharate pupae (compare lanes 3’ and
4’). Neither of these two storage proteins was found to be synthesized by pupal fat body in the course of at least three replicate experiments, a consistent
result that contrasted with the more developmentally protracted synthesis and
secretion of p82.
Isolation and Analysis of cDNA Clones Corresponding to the Storage Proteins
A cDNA library in XgtlO [23] was constructed with poly(A)+ RNA isolated
from mid-fifth larval instar fat body. Ten thousand recombinant phages were
screened with a radiolabeled cDNA probe synthesized from the same RNA
preparation in order to recover clones corresponding to abundant messages.
Preliminary analyses of this mRNA by in vitro translation showed that the
three storage proteins comprised greater than 75% of the total reaction products. Several hundred plaques yielded intense autoradiographic signals, and
20 of these were chosen at random for further study. Cross-hybridizations of
selected inserts to other members of this collection in a dot-blot format revealed the presence of three discrete categories of sequences, and physical
maps constructed for representatives of each class are shown in Figure 5. These
three phage inserts were subcloned into pUC plasmids and designated pHV-1,
pHV-2, and pHV-3.
In order to confirm the identity of these clones, each insert was digested
with either Sau3A or AluI (generating <400 bp fragments for each; Sau 3A
sites are not shown for pHV-1 and pHV-2 in Fig. 5); the fragments produced
were ligated into a series of pEX expression vectors [28], which potentially
140
Leclerc and Miller
Analyses of Storage Proteins in Heliothis
141
restore all three possible translational reading frames. These recombinant plasmids express in-frame ligations as a P-galactosidase fusion protein, which can
be screened immunologically in a colony-transfer format on nitrocellulose filters, facilitated by the transient induction of fusion protein by short-term
growth of cells at 42°C [28]. A screen of these pHV-1 and -2, and -3 subclones
in pEX vectors with the p82 antibody resulted in the identification of positive
clones from only pHV-1 fragment-containing cells. One of these colonies was
chosen at random and compared with a nonrecombinant pEX-containing colony by SDS-PAGE, demonstrating the induction of a larger fusion protein in
the recombinant (Fig. 6A). Immunoblot analysis of replicate lanes using the
p82 antibody showed that the fusion protein alone was detected (Fig. 6B);
conversely, only a 75,000-M, E. coli polypeptide (present in uninduced as
well as induced cultures) was recognized with the p74-p76 antibody, confirming the relationship between pHV-1 and the p82 storage protein. We
have been unable to recover p74-p76 antibody-positive clones derived from
pHV-2 and pHV-3, even though bona fide recombinants have been recovered
from pEX vectors representing all three reading frames. These may simply
have escaped detection in the original immunoscreen of induced recombinants
in which an overall high background of staining was seen, probably arising
from the endogenous 75,000-M, polypeptide detected by the p74-p76 antibody (Fig. 68). We note that we have also been unable to define the pHV-2
and pHV-3 subclones via hybrid-selected translation, owing to the small
amount of insert-hybridizingRNA recovered (data not shown); this result may
reflect some common property of otherwise abundant storage protein transcripts, since this analytical difficulty has also been encountered previously
in Gafferia [35].
The identities of pHV-2 and pHV-3 were clarified somewhat in Northern
blotting experiments, which also revealed other salient features of storage protein gene expression. Hybridization of the pHV-1 insert to total RNA prepared
from differenttissues revealed the accumulation of a 3,200-nt transcript in both
fat body and whole testes (Fig. 7A). This was an unexpected observation but
subsequently found to be consistent with the de novo synthesis of p82 only
Fig. 4. Developmental patterns in the accumulation and relative level of synthesis of the storage proteins. A: lmmunoblot analysis of 3O-kg total hernolymph protein obtained from staged
animals separated by SDS-PAGE on a 7.5% polyacrylamide gel, blotted onto nitrocellulose,
and replicate filters probed with either the p82 (left) or p74-p76 (right) antisera. The lanes shown
contain protein from late fourth-instar larvae (I),early (2) and mid-fifth-instar larvae (3), pharate
pupae (4), l-day-old (5) and 2-day-old (6) pupae. B: Total and specific protein synthesis by fat
body from staged larvae (numerical lane designations as in A). Fat body tissue (50 mg) dissected from the indicated stages was incubated in vitro in the presence of L35Slmethioninefor
3 h, each homogenized in equal volumes of buffer, and equivalent portions of fat body extract
(lanes 1-6) or medium containing secreted proteins (lanes 1 ’ 4 ’ ) separated by SDS-PACE on a
10% polyacrylamide gel; the migration of protein standards i s shown at the left and the positions of the storage proteins are indicated to the right of this panel (upper). The lower panel is
a portion of an autoradiogram of a 7.5% polyacrylamideSDS gel on which was fractionated the
reaction products of aliquots of fat body extract (lanes 1-61 Or medium (lanes 1’-6’) treated
simultaneously with the p82 and p74-p76 antisera; the positions of the immunoprecipitated
storage proteins are shown at the right of the panel.
142
Leclerc and Miller
-=
8
pHV-3
a---s=-
I
-
=
I
500 bp
W
Fig. 5. Physical maps of the pHV-1, pHV-2, and pHV-3 cDNA clones corresponding to abundant larval fat body transcripts. Representatives from each of the three recovered classes are
shown and contained inserts of -2,250 bp (pHV-I), 740 bp (pHV-2), and 1,050 bp (pHV-3).
A
B
Fig. 6. Identification of pHV-1 as a pi32 storage protein cDNA clone. A: SDS-PAGE analysis of
total cellular proteins extracted from fscherichia coii cells harboring a nonrecombinant pEX-1
plasmid (grown at 37"C,lane 1 or at 42"C, lane 2) or a plasmid containing a Sau3A restriction
fragment from pHV-1 (grown at 37T, lane3 or at 42"C, lane4). The induction of p-galactosidase
in nonrecombinants at 42°C is evidenced by the prominent 116,000-M, band, and that of the
fusion protein in the recombinant by the synthesis of a larger 135,000-M, polypeptide. B:
lmmunoblot study of induced, nonrecombinant pEX cell lysates (lanes 1 and 4), uninduced
(lanes 2 and 5), or induced recombinant pEX lysates (lanes 3 and 6) separated by SDS-PAGE
and probed with either the p82 antibody (lanes 1-3) or p74-p76 antibody ilanes4-6). The positions of the recombinant P-galactosidase-p82 fusion protein (at 135,000 M,) and an endogenous cross-reacting E. coli antigen (at 75,000 M,) are shown at the right.
Analyses of Storage Proteins in Heliothis
143
Fig. 7. Detection of storage protein transcripts in different Heliothis tissues by Northern blot
analysis using the three cDNAs. Equivalent 5-pg aliquots of total RNA isolated for embryos (e),
ovarioles (o), day 1 pupal testes (t), larval fat body (f), and from cultured Heliothis cells (c)
were separated by electrophoresis on 7.5% agarose-formaldehyde gels and blotted onto nitrocellulose. Replicate filter sets were hybridized to nick-translated inserts from the plasmids pHV-1
(A), pHV-2 (B), or pHV-3 (C). The positions of E. coli 16s and 23s rRNA markers are shown at
the left of the panels and the sizes of transcripts hybridized by pHV-1 (3,200 nt), pHV-2 (2,700
nt), and pHV-3 (2,900 nt) cDNAs are shown at the right.
by these two tissue types (data not shown). The pHV-2 and pHV-3 cDNAs
hybridized to 2,700 nt and 2,900 nt fat body transcripts, respectively (Fig. 7E5,C).
The detection of a less abundant 2,700-nt testes transcript by pHV-2 (Fig. 7B)
makes it likely that this clone corresponds to the p76 storage protein, since
relatively small amounts of this protein are also synthesized by testes (unreported observations). Similarly, the pHV-3 cDNA may be equivalent to the p74
protein, since it failed to hybridize a testis transcript (Fig. 7C), and this protein was not detected in testes (unreported observations).
Hybridizations of the pHV-1 and pHV-2 cDNAs to total fat body RNAs isolated from staged insects (Fig. 8) revealed a pattern of transcript accumulation
that generally mirrored the developmental profiles of protein synthesis (Fig.
48). A consistent discrepancy in this trend was the reduced level of both hybridizing transcripts midway through the fifth larval instar, a stage at which
protein synthesis is at maximal levels. Similarly, the apparent absence of pHV-2hybridizing message in postfeeding stage fifth-instar larvae was inconsistent
with the continued synthesis of at least small amounts of p76 at this developmental stage. These discrepancies were not the result of sample loading artifacts
(see inset in Fig. 8, showing a rehybridization of stripped filters to a rRNA probe)
and may or may not prove biologically relevant. The most salient feature of these
patterns was the difference in duration of accumulationof each transcript, which
again, was concordant with p82 and p76 synthesis. The developmental profile
of pHV-3-hybridizing transcript in fat body was indistinguishable from pHV-2
(data not shown). Although full-length cDNAs corresponding to these transcripts have not yet been obtained, data for the nucleotide and deduced amino
acid sequences of pHV-1 and pHV-2 are presented here.
144
Leclerc and Miller
Fig. 8 . Developmental regulation of the accumulation of pHV-I- and pHV-2-hybridizing transcripts revealed by Northern blot analysis. Equivalent5-*g aliquots of total RNA prepared from
staged fat bodies were separated on 1.2% agarose-formaldehyde gels and blotted onto nitrocellulose; developmental stages shown included: fourth-instar larvae (4),early (el, middle (m),
and wandering-stage (w)fifth-instar larvae, burrowing stage larvae (b), pharate pupae (p), and
pupae at days 1-9 of development. Replicate filter sets were hybridized to nick-translatedinserts
from pHV-I or pHV-2 (panels noted), and one of the filters was stripped of probe and rehybridized with a pumpkin rRNA probe demonstrating approximately equal loading of each lane
(inset below panels). The positions of E. coli 165 and 23S, and Heliothis 19s RNAs (seen by
ethidium bromide staining) are indicated to the left of the panels.
Sequence analysis of pHV-2 revealed a 768 bp open reading frame devoid of
stop codons or poly(A) tail, indicating that it initiated 5' to these landmarks
during cDNA synthesis (Fig. 9). The 256 amino acids encoded by this open
reading frame correspond to a 30,500-M, peptide, which is less than one-half
the size of mature p76. Its relatively high content of aromatic amino acid residues (tyrosine phenylalanine = 18%)and overall amino acid composition
suggested that it is homologous to the arylphorins from Manduca sexta [7]and
H.zea [35]. Confirmation of the identity of pHV-2 as an arylphorin was obtained in comparisons with relevant parts of the amino acid sequence recently
obtained for an arylphorin from Bombyx mori [37] and Manduca sexta [38]. The
H . virescens pHV-2 sequence overlapped the other two completely deduced
proteins in their C-terminal regions, and all three could be aligned with the
introduction of only two gaps per sequence (Fig. 10). Amino acid identities
between pHV-2 and the Bombyx and Manduca proteins were, respectively,
47% and 51%.The other two moth proteins were slightly more homologous
to each other (64%)in this same region of overlap.
Approximately 1,580 nucleotides of the pHV-1 cDNA clone are shown in
Figure 11. This sequence contained an open reading frame of 353 amino acids,
a lengthy 3' untranslated region, and a poly(A) tail. The deduced amino acid
sequence corresponded to a 40,700-M, peptide, which bore no strong resemblance to either storage proteins or other polypeptides in the NIH Gene Bank.
The sequence of p82 encoded by pHV-1 could, however, be aligned with the
+
145
Analyses of Storage Proteins in Heliothis
60
CAA CTG ACT GGA M C T T C CTG CCT TAC CCG C M AGG AGT M C M T TAC M T ATC CAT TCT
G l n Leu Thr G l y A E n Phe Leu Pro Tyr A l a G i n A r g Ser A m A a n T y r A s n I l e His Ser
120
GAG AAC M C TAC G M T I C ATT CGT TTC CTG GAC ACC TAT GAG M G ACA TTC T I C CAG TTC
Glu Lys A s n Tyr G l u Tyr Ile A r g Phe Lau A l p Thr Tyr G 1 u LYE Thr Phe Phe C l n Pha
180
T I G CAG M G GGA GAT T T C AAG ACl' CCT GAG M G O M ATC M C TAC GTC GGC AAC TAC TGG
Leu G l n LYE G l y Aep Phe Lyn T h r Pro G1u Lys G l u net A m Tyr V a l G l y Asn Tyr ~ r p
240
CAC ATG M C C M GAC C K TAC TCC GAG CAT AGC M C M G G M TTC CAC CAG TAC TCT TAT
His M e t A s n G l n Amp Lau Tyr Ser C l u H i u 58r Asn Lye G l u Leu His C l n Tyr Sar Tyr
300
GAG ATC ATC GCC CGT CAC GTG CTC CGC GGC ACT CCC M G CCT TTC GAC AM TAC CCA TTC
G l u Ile I l e A l a A r g H ~ SV a l Leu C l y G l y Ser Pro Lye Pro Phe Asp Lys Tyr A l a P h s
360
ATG CCC ACC GCT CTC CAC TTC TAC CAG ACT TCA CTC CGT GAC CCT GCA TTC TAC CAG CTC
Met Pro T h r A l a Leu Amp Phe Tyr G l n Thr Ser Lou A r g Asp P r o A l a Phe T y r G l n Leu
420
TAC CAG AGA ATC GTC CAC TAC CTC ATC GCC TAC AM GAG T I C GTC AAA CCT TAC TCT CAC
Tyr G l n Arg 11. V a l Asp Tyr Lau I l e A l a T y r LYE C l u Tyr V a l Lym P r o T y r Ser His
4ao
M C GAT CTT CAC TTC GTC GGT GTT M G ATC M T CAC GTG A M GTC AGC GAA TTG CTT ACT
A617 A a p Ltu His Ph8 V a l G l y V a l Lys I1c A a n Asp V a l Lya V a l Ser G l u Leu Val Thr
540
TAC T I C GAT TAC T T C GAC m M T CCC ACC AGC ACT GTG TTC TAC AGC CAG G M GAG CTT
Tyr P h e Asp Tyr Phe Asp Pha A s Ala T h r Ser Ser V a l P h e Tyr Ser C l n G l u G l u Lou
600
ACA T C P T I C CCA ACT DCh T T C C l T GTT CGT CM C C 3 CGC CTG M C CAC AM CCA TTC A m
T h r ser Tyr Pro Thr C l y Phe V a l V a l A r g G l n Pro A r g Leu A s n Him L y s Pro P h e T h r
660
GTT Tff CTT GAC CPl M G T C T GAT CTA GCG TCT GAT GCC G T T T T C M G ATC T T C ATT GCA
A h V a l Phe Lyu I l e Phe I l a G l y
V a l ser V a l ASP h u LYE sar A B V
~ a l Ala Ser A E ~
720
CCC A M TAC CAC GCC M C GGT TAC CCA CTA M C A T T C M GAG GAC TGG ATG AAA TTC TAC
Pro L y s Tyr Him A l a A a n G l y Tyr Pro V a l Amn 110 G l u G l u Anp T r p Met LYE P h a !Iyr
768
G M CTC GAC TGG T T C 0% CAG M C CIT CTC CCG GCC AM ACA AM T T C
G l u Leu Aep T r p Phe V a l C l n LYE L.u V a l Pro A l a Lym T h r L y e Leu
Fig. 9. Nucleotide and deduced amino acid sequence of the 768 bp insert from the pHV-2
cRNA clone. A single asparaginyl residue, which is a potential site for N-linked glycosylation,
is underlined.
amino acid sequences of all three arylphorins without the introduction of
gaps, revealing certain conserved residues shared by all four proteins (asterisked residues in Fig. 10). These amino acid identities tended to occur in clusters of two to four residues and were restricted to the extreme C-termini of
the proteins. This finding suggests that the gene encoding p82 shares a common ancestor with the arylphorin genes, and further, that this polypeptide is
a storage protein.
The partial sequences for pHV-1 and pHV-2 shown each contained a single
potential N-linked glycosylation site (underlined Asn residues in Figs. 9 and
11). The results of metabolic radiolabeling experiments in the presence of
tunicamycin suggested that this functional site (or one like it present elsewhere
in the molecule) is used in the post-translational processing of p82 (see Fig.
2C). In spite of the apparent lack of any effect on p76 synthesis by tunicarnycin,
its propensity to bind concanavalin A (unreported observations) is consistent
with carbohydrate being covalently bound to it as well. These results raise the
possibility that the carbohydrate attached to p76 (and possibly p74 as well) is
146
Leckrc and Miller
M s a : F A Q R P N Y Y D I H N D K N Y E Q I R F L D M F E M T F L Q Y L Q K G
I I
I I
I 1
I
I
I
pHV-2: Q L T G N F L P Y A C R S N N Y N I H S E K N Y E Y I R F L D T Y E K T
B m 2 : F A Q R P D Y Y N L H T E E N Y E R V R F L D T Y E K T F V Q F L Q K D
M s a : H F K A F D K E I N F H D V - K A V N F V G N Y W Q A N A D L Y N E E V
I
I
I I
I
I
I
I
I I I I I
I I I I I
I
I
I l l
I l l
I
I
p H V - 2 : F F Q F L - Q K G D F K T P E K E M N Y V G N Y W H M N Q D L Y S E H S
I
I I
I
B m 2 : H F E A F G Q K I D F H D P - K A J N F V G N Y W Q D N A D L Y G E E V
MSa:
T K
I
- L Y Q R S Y E I N A R H V L G A A P K P F N K Y S F I P S A L D F
I
I
I
I l l 1
I l l
I l l 1 I I I I
I I I I I I I I I I
I I I I I I
I I I l l
I l l 1
pHV-2: N K E L H Q Y S Y E I I A R H V L G G S P K P F D K Y A F M P T A L D F
I
I
I I
B m 2 : T K D - Y Q R S Y E V F A R R V L G A A P M P F D K Y A F H P S A M D F
M 5 a : Y Q T S L R D P V F Y Q L Y D R I I N Y I N E F K Q Y L Q P Y N Q N D L
I
I
I I
I l l
I I I I I I I I I I I I I
I I I I I I I I I I I I I I
*
*
I
I
I l l
I
I I
I l l
p H V - 2 : Y Q T S L R D P A F Y Q L Y Q R I V D Y L I A Y K E Y V K P Y S H N D L
B m 2 : Y Q T S L R D P A F Y Q L Y N R I V E Y I V E F K Q Y L K P Y T Q D K L
M s a : H F V G V K I S D V K V D K L A T Y F E Y Y D F D V S N S V F V S K K D
I I I I I I I
I I I I I
I
I
****
I l l
I I
I
I I
I I
I I
I
I
p H V - 2 : H F V G V K I N D V K V S E L V T Y F D Y F D F N A T S S V F Y S Q E E
****
I
I I
B m 2 : Y F D G V K I T D V K V D K L T T F T E N F E F D A S N V S Y F S K E E
M s a : I K N F P Y G Y K V R Q P R L N H K P F S V S I G V K S D V A V D A V F
I
I
IllII***III
* I
I l l * * I l l 1
I * * I 1 I I
p H V - 2 : L T S Y P T G F V V R Q P R L N H K P F T V S V D L K S D V A S D A V F
I***
I I
*
Bm2: I K N N H V H E L R C A T R L N H S P F N V N I E V D S N V A S D A V V
M s a : K I F L G P K Y D S N G F P I P L A K N W N K F Y E L D W F V H K V M P
* 1 1
I***
lIIl**l*l
I
I
I
I l l I**I*
I I
B m 2 : K M L L A P K Y D D N G I P L T L E D N W M K F F E L D W F T T K L T A
/ I
I I
I
I
pHV-2:K I F I G P K Y H A N G Y P V N I E E D T M K F Y E L D W F V Q K L V P
*
***
M s u : G Q N H I
pHV-2: A K T K L
I
Bm2: G Q N K I
Fig. 10. Alignment of the Heliothis virescens pHV-2 amino acid sequence with those determined for the arylphorins from Manduca sexta [37] and Bombyx mori [38]. The entire deduced
amino acid sequence of pHV-2 is shown, overlapping the Manduca and subunit (Ms a) and
Bombyx storage protein 2 (Bm 2) polypeptides approximately from residues 310-565 (in proteins that are -705 amino acids in length in both species). Amino acid residues common to
pHV-2 and either of the other two sequences are connected by vertical bars, and asterisked (*)
residues denote those that are also shared with the p82 sequence deduced from clone pHV-1
(see Fig. 11).
Analyses of Storage Proteins in Heliothis
147
60
A T A rcc ACA G A T TGT CTA ATG ccc TTC GTC *AA TCC CCT GAG CTT GGC CAC GAG ATT GTT
Ile Trp Arg Asp Cys Leu net Ala Leu Val Lym Ser pro G l u Leu Gly His Glu Ile Val
120
M G CAG GGT TAC TCT TCA GGT CTT TTA TAC CAC AAT CCA CTG CCG TTC CCT CTA AGG CCC
Lys Cln Gly Tyr Ser Ser Gly Lou Leu Tyr His Asn G l y Val Pro Phe Pro Val Arg Pro
180
ATT TAC TTC AAC TTG GAT CAG CCC CAC TTC CTA AAT GAA ATC CAA GAA ATC TTA CAC TAC
lle Tyr Phe Asn Leu Asp Cln Pro G l n Phe Val Asn Glu Ile Gln Glu Ile Leu Asp Try
240
GAG CGC CGT ATT CGT GAC CCC ATT GAC CAC GGT TAC GTT GTT AAC CAC CTT GGT GAA CAC
Clu Arg Arg Ile Arg Asp Ala Ile Asp Gln Gly Tyr Val Val Asn HIS Leu tly GlU H I S
300
ATT GAC ATC TGC GCT CCA GAG CCT ATC GAA ATC TTG GGT AAT CTT ATT GAG GCT AAC GTT
Ile ASP Ile cys la Pro Glu Ala Ile ~ l u11e Leu Gly Asn LEU Ile Glu Ala A s n Val
160
GAC TCT CCT AAT GGC A M TAC TAC AAG GAC TTC ATC AGC ATC TCG AAG M G CTT TTG GGC
A S P Ser Pro Asn ~ l y
Lyc Tyr Tyr Lys Asp Phe Ile Ser Ile TrP LYS Lye Leu Leu GlY
420
AAC TCC ATT GTT CAA GAA CAG CAG TAC CAC M C M T TAC CTC CCC CTC CTN GTC CCC TCG
A s n 5er Ile Val G l n G l u Gln Gln Tyr Hls Asn Asn Tyr Val Pro Leu Val Val Pro Ser
480
GTC TTG GAA CAC TAT CAA ACT GCT CTT CGT GAT CCT GCC TTC TAC ATC ATC TGG AAG CGT
Val mu Glu His Tyr Cln Thr Ala Leu Arg Asp Pro All Phe Tyr Met Ile Trp Lys Arg
540
GTC TTG GGA CTG TTC CAA ATG TGG CAG GAG AAA CTT CCT CTG TAC AAG AAA GAA GAA CTT
Val Leu Gly Leu Phe G l n Met Trp Gln Glu Lys Leu Pro Leu Tyr Lys Lys Glu Glu Leu
600
GCT ATG CCC CAA GTG GCC ATC CAG AAG GTC GAT GTA GAC RAG CTG ATC ACA TAC TTC GAA
Ala Met Pro cln Val Ala Ile Cln Lys Val Asp Val Asp Lys Leu Wet Thr Tyr Phe Clu
660
CAC ACT TAC T T G M C CTG TCC TCT CAC CTC CAT ATG M C GAG C A C CAA G T T AAC GAA GTC
His Thr Tyr Leu A m Val Ser ser His Leu His net Asn Glu Asp Glu Val Lys Glu Val
I
I
720
CAC GAC CAA GTC CGC GTG TTG GTA C M CAC CCC GTC TTG M C CAC AAG M G TAC CAA GTT
Hls Asp Gln Val Arq Val Leu Val Gln His Pro Val Leu Aan His Lys Lyc Tyr Cln Val
780
CGC GTA CAC GTT M G AGC GAG GTC GCC M G ACC GTC CGC GTC M G TTC TTC TTC GCA CCC
Arg Val H ~ Val
S
LYS ser clu Val Ala ~ y Thr
s
Val Arg va1 ~ y Phe
r
Phs Leu la Pro
840
TAC CAC ACC C M CCC C M GAG ATC CCT CTC CAC CTC M C ACC C M M C TTC ATG CAG
L y r Tyt A5p Thr Gln tly Gln Glu Ils Pro Leu His Leu Asn Thr Gln Asn Phe net G l n
AAA
900
CTG GAT GAG TTC CTA TAT GAC CTT CCT TCT CCC G M TGC GTC ATT T C T CGT GAT TCT GTT
Leu Asp Glu Phe Leu Tyr Asp Leu Pro Ser Gly Glu Cys Val 119 See Arg Asp Ser V a l
960
GAC ACT TCT CGC M G UU TTG ATG TCT GCC M T CAA GTC TAT G M GCG GTA GTA AAG GCT
Asp Thr 5er Gly Lys Lys Lau Met Ser Gly Aen Clu Val Tyr Glu Ala Val Val Lys Ala
1020
GTG CAA GGC AAG GGT CAT TAC ACC ATC AAC GAG M C CCT G M AAA CTC GCC GAT CAT CTT
Val Gln G l y Lys Gly His Tyr Thr Ile Asn Glu Asn Pro Clu Lys h u Ala Asp His Leu
1062
1085
TTG CTG NCT AAG GGT CCC GTC GGC GCA TGC CTT TCG TCC TGA TGGTCTACATCTCGGMTACCGC
Leu Leu ’” Lys Gly Arg Val Gly Ala Cys Leu Ser Ser ***
1164
GCACCGAAGC~GCTCCTGAAGCCGTCTCTTACCCCGCTTGGT~TCTTGGCCTGTCTCCCACCATTCCTGCACTGACCG
1213
ACGAGCCATTAGCCTTCCCACTCAACAGCCCTCTTCACCCATGGCAGTTGGAGGGAGTC~GAACTTGCACCTCC~GA
1322
TGTCTTGATCPACCACAAGCATACCCCCGIUATCGAGGTTCCCCACATGGAATAAGTGATTCTCGGGATGTTAGTGACG
1401
CCAGAGTTAGAAC~GTTGCrrCTCCGTGMTTTGTTTGTTACTGAAGTG~TTTATGGAGTT~T~TCTGTATGACC
1480
TCTGCIVL9AGCMTTTGGGGCTGCCCAGCTAGTTCAAATTACTTTMCATCAGITTTGGTGTCGAGTAACMTCAATCTGC
1559
AmATGTTIL4TG~GTATGTATPTATTACTATTACTATATGTATTTATTGTTGATATATATCTTATATGTGTGTATTGTATTAT
1583
GTAGTG-GTATGATGATCAUAAAAM
Fig. 11. The nucleotide and deduced amino acid sequence of part of the -2,200-bp insert
from the pHV-I cDNA clone. This cDNA contained a consensus polyadenylation signal sequence (underlined) that was l l bp 5’ to a short poly(A) tail. A single asparaginyl residue,
which is a potential site for N-linked glycosylation, is underlined.
148
Leclerc and Miller
O-glycosidically linked through serine or threonine residues, an enzymatically
mediated process not inhibited by tunicamycin.
DISCUSSION
We have identified three abundant polypeptides in the hemolymph of H.
virescens larvae that later come to reside in pupal fat body. The subunit and
native molecular weights of these proteins, their synthesis by and export from
fat body, and their apparent resorption by fat body from the blood during
pharate pupal development are properties characteristic of insect storage proteins [1,3,4]. All three proteins assemble into complexes having a molecular
weight of 450,000 that, on the basis of binding to a DEAE column, appear to
be composed of one native hexamer made up exclusively of p82 subunits and
another assembled from equal amounts of the p74 and p76 subunits. Solution
immunoprecipitation studies with pulse-labeled fat bodies showed that the
p74 and p76 storage proteins were both synthesized over a developmental period which was slightly more restricted than that of the p82, particularly in
young pupae. The p82 storage protein could also be distinguished from the
other two polypeptides on the basis of its predominant localization in the
hemolymph during pupal development.
Three distinct cDNA clones derived from abundant fat body mRNAs were
also recovered and analyzed. That all three clones corresponded to storage
protein sequences was indicated by the abundance of hybridizing transcript,
its restriction to fat body and testes (tissues that both synthesize some or all
of the storage proteins), and its developmental pattern of accumulation which
was substantiallysimilar to storage protein synthesis. One cDNA clone, pHV-1,
was unambiguously shown to be equivalent to the p82 storage protein in an
epitope selection experiment in which a recombinant fusion protein was detected with the p82 antibody. This assignment was also consistent with the
relatively high levels of p82 accumulating in testes (unreported observations)
that mirrored the accumulation of an abundant pHV-l-hybridizing transcript
found in this organ (Fig. 7A). Similar immunological screens of bacterial colonies harboring pEX expression plasmids with pHV-2 and pHV-3 restriction
fragments using the p74-p76 antibody failed to reveal positive clones. This
outcome is most likely attributable to the presence of an interesting E. coli
antigen that cross-reacted with this antibody. We think it likely that these two
cDNAs correspond to p74 and p76 by the criteria noted above. More importantly, a Manduca arylphorin antibody [7] recognized both of these polypeptides in immunoblot studies (unreported observations) which in turn is
consistent with the arylphorin-like amino acid composition and sequence determined for the pHV-2 cDNA open reading frame. Since testes synthesize
relatively small amounts of p76, a relationship that was born out in Northern
blot analysis of testis RNAs (Fig. 7B,C),
we conclude that it corresponds to
the pHV-2 cDNA.
The deduced amino acid sequence of the p82 cDNA, pHV-1, bore some similarity to the arylphorins from Bombyx mori [37] and Manduca sexfa [38]. This
polypeptide was in turn structurally distinct from a second storage protein
from Bombyx, SP-1, which is synthesized predominantly by females [8,39]; in
Analyses of Storage Proteins in Heliothis
149
this connection, we note that sex-specific differences in the accumulation of
the storage proteins were not noted for Heliothis. The expression of the putative arylphorin subunits, p74 and p76, was coordinately regulated in fat body
both at the levels of transcript accumulation and relative rate of protein synthesis. The pattern of p82 storage protein and mRNA expression that differed
over developmental time, coupled with its reduced level of resorption by
pharate pupal fat body, suggests that it serves a physiologic role which is distinct from the arylphorins. Like Munducu arylphorin [34], expression of the
Neliothis storage proteins was low or absent in stages bracketing the fourth-fifth
larval instar molt indicating that their genes may be negatively regulated by
20-hydroxyecdysterone .
The cDNA clones and antibodies raised to the Heliothis storage proteins have
been of immediate use in our ongoing studies of extrinsic and intrinsic factors
that turn these genes on and off. Full-length clones corresponding to each of
the genes are currently being sought from a genomic library, and we anticipate that their availability will facilitate future studies of storage protein processing and metabolism through transfection of appropriate constructs into
lepidopteran cell cultures [40].
LITERATURE CITED
1. Wyatt GR, Pan ML: Insect plasma proteins. Annu Rev Biochem 47,779 (1978).
2. Gotz P, Boman HG: Insect immunity. In: Comprehensive Insect Physiology, Biochemistry
and Pharmacology. Kerkut GA, Gilbert LI, eds. Academic Press, Orlando, Florida, p p
543-485 (1985).
3. Levenbook L: Insect storage proteins. In: Comprehensive Insect Physiology, Biochemistry
and Pharmacology, Kerkut GA, Gilbert LI, eds. Academic Press, Orlando, Florida, pp
307-346 (1985).
4. Thomson ]A: Major patterns of gene activity during development in holometabolous insects. Adv Insect Physioll2,321(1975).
5, Kinnear JF, Thomson JA: Nature, origin and fate of the major haemolymph proteins in Calliphora. Insect Biochem 5,531 (1975).
6 . Sekeris CE, Scheller K: Calliphorin, a major protein of the blowfly: Correlation between the
amount of protein, its biosynthesis, and the titer of translatable Calliphorin-mRNAduring
development. Dev Biol59,12 (1977).
7. Kramer SJ, Mundall EC, Law JH: Purification and properties of manducin, an amino acid
storage protein of the haemolymph of larval and pupal Mnnduca sexta. Insect Biochem 10,
279 (1980).
8. Tojo S, Nagata M, Kobayashi M: Storage proteins in the silkworm, Bombyx rnori. Insect
Biochem 10,289 (1980).
9. Thomson JA, Radok KA, Shaw DC, Whitten MI, Foster GG, Bert LM: Genetics of lucilin, a
storage protein from the sheep blowfly Lucilia cupvina (Calliphoridae). Biochem Genet 14,
145 (1976).
10. Tojo S, Betchaku T, Ziccardi VJ, Wyatt JR: Fat body protein granules and storage proteins in
the silkmoth, Hyalophora cecropia. J Cell Biol78,823 (1978).
11. Telfer WH, Keim PS, Law JH:Arylphorin, a new protein from Hyalophora cecropia: Comparisons with calliphorin and manducin. Insect Biochem 13,601 (1983).
12. Miller SG, Silhacek DL Identification and purification of storage proteins in tissues of the
grcater wax moth, Galleria mellonellu (L). Insect Biochern 12,277 (1982).
13. Scheller K, Zimmerman HI', Sekeris CE: Calliphorin, a protein involved in cuticle formation
of the blowfly, Calliphora uicina. 2 Naturforsch 350,387 (1980).
14. Haunerland NH, Bowers WS: Binding of insecticides to lipophorin and arylphorin, two
hemolymph proteins of Heliothis zea. Arch Insect Biochem Physiol3,87 (1986).
150
Leclerc and Miller
15. Riddiford LM, Hice RH: Developmental profiles of the mRNAs for Manduca arylphorin and
two other storage proteins during the final larval instar of Manducn sexta. Insect Biochem
15,489 (1985).
16. Palli SR, Locke M: The synthesis of hemolymph proteins by the larval epidermis of an insect, Calpodes ethlius (Lepidoptera: Hesperiidae). Insect Biochem 17,711 (1987).
17. Palli SR, Locke M: The synthesis of hemolymph proteins by the larval midgut of an insect,
Calpodes ethlius (Lepidoptera: Hesperiidae). Insect Biochem, 17,561 (1987).
18. Fife HU, Palli SR, Locke M: A function for the pericardial cell in an insect. Insect Biochem
17,829 (1987).
19. Proshold FI, Bartell JA: Inherited sterility in progeny of irradiated male tobacco budworms:
Effects in reproduction, developmental time, and sex ratio. J Econ Entomol63,280 (1970).
20. Shapiro JP, Keim PS, Law JH: Structural studies on lipophorin, an insect lipoprotein. J Biol
Chem 259,3680 (1984).
21. Towbin H, Staehelin T, Gordon J: Electrophoretic transfer of proteins from polyacrylamide
gels to nitrocellulose sheets: Procedure and some applications. Proc Natl Acad Sci USA 76,
4350 (1979).
22. Watson CJ, Jackson JF: An alternative procedure for the synthesis of double-stranded cDNA
for cloning in phage and plasmid vectors. In: DNA Cloning, Vol. I. Glover D, ed. IRL Press,
Oxford, pp 79-88 (1985).
23. Huynh TV, Young RA, Davis RW: Construction and screening cDNA libraries in At10 and
Xgtll. In: DNA Cloning, Vol. 1. Glover D, ed. IRL Press, Oxford, pp 49-88 (1985).
24. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York (1982).
25. Xu S-Y: A rapid method for preparing phage A DNA from agar plate lysates. Gene Anal
Techn 3,90 (1986).
26. MacDonald RJ, Swift GH, Przybyla AE, Chirgwin JM: Isolation of RNA using guanidinium
salts. Methods Enzymol152,219 (1987).
27, Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal Biochem 262,156 (1987).
28. Stanley KK, Luzio JP: Construction of a new family of high efficiency bacterial expression
vectors: Identificationof cDNA clones coding for human liver proteins. EMBO J 3,1429 (1984).
29. Sanger GS, Nicklen AR, Coulson AR: DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA 74,5463 (1977).
30. Chen EY, Seeburg PH. Supercoil sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4,165 (1985).
31. Henikoff S: Unidirectional digestion with exonudease 111 creates targeted breakpoints for
DNA sequencing. Gene 28,351 (1984).
32. Haunerland NH, Bowers WS: A Larval specific lipoprotein: Purification and characterization
of a blue chromoprotein from Heliothis zea. Biochem Biophys Res Comrnun 134,580 (1986).
33. Tkacz JS, Lampen JD: Tunicamycin inhibition of polyisoprenol N-acetylglucosaminyl pyrophosphate formation in calf liver microsomes. Biochem Biophy Res Commun 65,248 (1975).
34. Webb BA, Riddiford LM: Synthesis of two storage proteins during larval development of the
tobacco hornworm, Manducu sextu. Dev Biol 130,671 (1988).
35. Ray A, Memmel NA, Orchekowski RP, Kumaran AK: Isolation of two cDNA clones coding
for larval hemolymph proteins of Galleria mellonella. Insect Biochem 17,603 (1987).
36. Haunerland NH, Bowers WS: Arylphorin from the corn earworm, Heliothis zea. Insect
Biochem 16,617 (1986).
37. Willott E, Wang X-Y, Wells MA: cDNA and gene sequence of Manduca sexfa arylphorin, an
aromatic amino acid-rich larval serum protein. J Biol Chem 264, 19052 (1989).
38. Fujii T, Sakurai H, Izumi S, Tomino S: Structure of the gene for the arylphorin-type storage
protein SP 2 of Bombyx mori. J Biol Chem 264, 11020 (1989).
39. Sakurai H, Fujii T, lzumi S, Tomino S: Structure and expression of gene coding for sex-specific
storage protein of Bombyx mori. J Biol Chem 263,7876 (1988).
40. Lynn DE, Dougherty EM, McClintock JT, Loeb M. Development of cell lines from various
tissues of lepidoptera. In: Invertebrate and Fish Tissue Culture. Kuroda Y, Kurstak E,
Maramorosch K, eds., Japan Scientific Societies Press, Tokyo, pp 239-242 (1988).
Документ
Категория
Без категории
Просмотров
2
Размер файла
1 349 Кб
Теги
heliothis, molecular, protein, virescens, analysis, identification, storage
1/--страниц
Пожаловаться на содержимое документа