close

Вход

Забыли?

вход по аккаунту

?

Inhibition of the production of proinflammatory cytokines and immunoglobulins by interleukin-4 in an ex vivo model of rheumatoid synovitis.

код для вставкиСкачать
874
INHIBITION OF THE PRODUCTION OF
PROINFLAMMATORY CYTOKINES AND
IMMUNOGLOBULINS BY INTERLEUKIN-4 IN AN
EX VIVO MODEL OF RHEUMATOID SYNOVITIS
PIERRE MIOSSEC, JEROME BRIOLAY, JULIE DECHANET, JOHN WIJDENES,
HECTOR MARTINEZ-VALDEZ, and JACQUES BANCHEREAU
Objective. To assess the spontaneous production
of proinflammatory cytokines and immunoglobulins in
rheumatoid arthritis (RA) synovitis and modulation by
interleukin-4 (IL-4).
Methods. We developed an ex vivo model of RA
synovitis using pieces of RA synovium, and have studied
the regulation of the production of IL-lf?, IL-6, tumor
necrosis factor a (TNFa), IgM, and IgG.
Results. Spontaneous production of proinflammatory cytokines in vitro was active, with prolonged
cytokine gene transcription and translation. IL-6 was
produced at higher levels than either IL-lf? or TNFa,
and explants produced more IgG than IgM. In contrast,
IL-4 and interferon-y were undetectable. When pieces
of synovium were incubated in the presence of IL-4,
reduction of spontaneous proinflammatory cytokine and
Ig production was observed.
Conclusion. These results extend the observations of the antiinflammatoryproperties of IL-4 to an ex
vivo situation, and provide the rationale for the clinical
use of IL-4 in RA.
From the Departments of Immunology and Rheumatology,
and INSERM U 80, H8pital Edouard Herriot, Lyon, the ScheringPlough Laboratory for Immunological Research, Dardilly , and the
Blood Bank, BesanCon, France.
Ms. Dechanet’s work was supported by the Fondation
MCrieux.
Pierre Miossec, MD, PhD: Associate in Immunology and
Rheumatology, HGpital Edouard Herriot; Jtr8me Briolay, PhD:
Schering-Plough Laboratory for Immunological Research; Julie
Dechanet, BSc: Schering-Plough Laboratory for Immunological
Research; John Wijdenes, PhD: Blood Bank, Hector MartinezValdez, MD, PhD: Schering-Plough Laboratory for Immunological
Research; Jacques Banchereau, PhD: Director, Schering-Plough
Laboratory for Immunological Research.
Address reprint requests to Pierre Miossec, MD, PhD,
Departments of Immunology and Rheumatology, HGpital Edouard
Herriot, Lyon Cedex, France.
Submitted for publication December 6, 1991; accepted in
revised form March 31, 1992.
Arthritis and Rheumatism, Vol. 35, No. 8 (August 1992)
Rheumatoid arthritis (RA) is an inflammatory
joint disease in which perpetuation of the chronic
synovitis leads to bone and cartilage degradation (1,2).
RA therapy is limited by the lack of an identified
causative agent as well as the lack of a model that
reproduces the synovitis. High levels of proinflammatory cytokines such as interleukin-1 (IL-1), tumor
necrosis factor a (TNFa), and interleukin-6 (IL-6) are
produced by the synovitis and are thought to play a
major role in joint degradation (3-9). In contrast, other
cytokines produced by T cells, such as interferon-?
(IFNy) or IL-4, are virtually undetectable, despite the
presence of the many T cells that infiltrate the RA
synovium (10-12).
To be as close as possible to the situation in vivo,
a model of RA should conserve the synovium architecture and the dynamic activation of the cells, as reflected
in the sustained production of factors. In such a model,
it would be possible to study the regulation of the
production of factors such as cytokines that are involved
in inflammation and joint degradation. Consistent with
these requirements, we used explants of RA synovium
to construct an ex vivo model of the production of
cytokines and immunoglobulinsin RA synovitis, and we
show that this was an active process, with prolonged
cytokine gene transcription and translation. Furthermore, IL-4 was found to inhibit the spontaneous production of proinflammatory cytokines and Ig, both at the
protein and the messenger RNA (mRNA) levels. Our
findings extend the known antiinflammatory properties
of IL-4 to an ex vivo situation and suggest the potential
clinical utility of IL-4.
PATIENTS AND METHODS
Patients. Sixteen patients with R A , according t o the
revised criteria of the American College of Rheumatology
(formerly, t h e American Rheumatism Association) (13),
IL-4 INHIBITS CYTOKINE PRODUCTION IN RA SYNOVITIS
875
Table 1. Clinical characteristics of the patients*
Patient
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Agelsex
51lF
44/F
59/F
42lF
67M
44/F
64/F
56lF
62/M
57/F
53lF
43lF
41lF
55iF
61/F
53M
Disease
duration,
years
9
14
13
12
9
22
21
12
6
15
19
15
6
12
7
24
RF
+
+
+
+
+
-
-
+
+
+
+
+
+
+
Surgical
procedure
Treatment
Wrist synov.
Wrist synov.
Wrist synov.
Wrist synov.
TKR
Wrist synov.
TKR
Wrist synov.
Wrist synov.
Wrist synov.
TKR
Wrist synov.
Wrist synov.
Wrist synov.
Wrist synov.
Wrist synov.
TP
Red. (5 mg)
Gold; Pred. (3 mg)
TP; Pred. (12 mg)
DP
TP
Red. (12 mg)
MTX; Pred. (5 mg)
Pred. (8 mg)
MTX
Pred. (8 mg)
MTX
DP
TP
DP
MTX
* The mean 2 SD age of the patients was 53 f 8, and the mean f SD disease duration was 14 f 6
years. RF = rheumatoid factor; wrist synov. = wrist synovectomy; TP = tiopronin; Red. =
prednisone (daily dose); TKR = total knee replacement; DP = D-penicillamine; MTX = methotrexate.
were recruited into this study. The characteristics of the
patients are given in Table 1. Most of the patients were
receiving nonsteroidal antiinflammatory drugs. In addition, 7
patients were taking prednisone (4-12 mdday), 7 took
D-penicillamine or tiopronin, 1 took gold salts, and 4 were
taking methotrexate. Treatment with these slow-acting drugs
was stopped 1 week before surgery.
Synovium samples were obtained at the time of joint
surgery: wrist synovectomy in 13 patients, total knee replacement in 3. Normal synovium was obtained from patients who were undergoing knee arthroscopy for ligament
symptoms. We used samples from those whose arthroscopy
findings were normal.
Cytokines. Human recombinant IL-4 (rIL-4) purified
from Escherichia coli was purchased from Schering-Plough
Research (Bloomfield, NJ). The specific biological activity
was 1 x lo7 units/mg (batch 9ILE-1001 [14]). One unit of
activity has been defined as the amount of IL-4 that gives
half-maximal stimulation of phytohemagglutinin blast proliferation (15). Human rIL-2 (2 x lo7 unitslmg) was kindly
provided by Dr. R. Kastelein (DNAX, Palo Alto, CA).
Purified human rIL-6 (1 x lo7 unitdmg) and TNFa (2 x lo7
unitdmg) were purchased from Genzyme (Boston, MA).
Synovium preparation and culture. Synovium was
obtained under sterile conditions and was immediately
placed in phosphate buffered saline (PBS) containing antibiotics. The synovium samples were cut into small pieces of
-2 mm3. Sections were cultured in triplicate in RPMI 1640
(complete medium; Gibco, Grand Island, NY) supplemented
with 10% heat-inactivated fetal calf serum (Gibco), 2 mM
glutamine, 100 units/ml penicillin, 50 p g / d gentarnicin, and
20 mM HEPES buffer at 37°C in a humidified atmosphere of
5% CO, and 95% air.
Cultures were performed in 24-well flat-bottomed
plates (Falcon, Oxnard, CA) containing 1 synovium sample
in a final volume of 2 ml of complete medium. Cultures were
incubated in the absence or presence of increasing concentrations of IL-4, ranging from 0 to 250 units/ml. It had been
determined that these concentrations yielded maximal effects (optimum inhibition of IL-6 and Ig production by
mitogen-stimulated peripheral blood mononuclear cells
[PBMC] after 10 days of culture). Supernatants were harvested after 10 days of culture. In some experiments, supernatants were collected after various time periods. Cycloheximide (350 d m l ; Sigma, St. Louis, MO) and actinomycin D
(5 pg/ml; Sigma) were added at the beginning of culture.
Control and cycloheximide-treated synovium sections were
incubated for 24 hours, washed, and then incubated with
medium alone for the remaining culture period. Anti-IL-4
antibody was a rabbit polyclonal antibody, which at a
1 :1 ,OOO dilution, blocked the CD23 expression induced on B
cells by 10-9M IL-4 (16).
Measurements of cytokine levels. Levels of IL-6
immunoreactivity were measured by double-sandwich
enzyme-linked immunosorbent assay (ELISA), as described
(17). Microtiter plates (%-well) were coated overnight at
4"C, with 2.5 &ml of mouse monoclonal BE8 anti-IL-6
antibody in carbonate buffer, pH 9.8. After washing, wells
were saturated with PBS plus 5% bovine serum albumin for
1.5 hours at room temperature. After washing, serial dilutions of human rIL-6 standard (Genzyme) or supernatants
were added to the wells for 30 minutes. IL-6 fixation was
detected with a biotinylated mouse BE4 anti-IL-6 monoclonal antibody (MAb). After subsequent incubation with
streptavidin-alkaline phosphatase conjugate and washing,
nitrophenyl phosphate (Sigma) in diethanolamine buffer was
added for 30 minutes at 37°C. Optical density (OD) was
measured at 405 nm in a plate reader. Data were processed
on a computer and expressed in ng/ml. Assay sensitivity was
5 pglml.
IL-6 biological activity was measured in an IL-6dependent plasmacytoma KD83 assay, developed by Dr.
Vithal Ghanta (University of Alabama at Birmingham). Cells
(4 x 10'/well) were incubated in the presence of serial
half-dilutions of supernatants. After 48 hours, cell proliferation was measured by 'H-thymidine incorporation.
MIOSSEC ET AL
876
The IFNy levels were measured as for IL-6 with a
2-site sandwich ELISA as described (18). Anti-IFNy MAb
A35 (10 d m l ; 200 pl/well) was used as first antibody, and
biotinylated anti-IFNy MAb B27 was used as second antibody. Binding was monitored with alkaline phosphatasecoupled avidin. Sensitivity of the assay was 50 pglml.
IL-4 levels were also measured with a 2-site sandwich ELISA as described (16). The first antibody was a
rabbit anti-rIL-4 IgG (10 &ml; 100 $/well), and the second
a rat anti-IL-4 MAb. Binding of the rat antibody was
monitored using horseradish peroxidase-conjugated goat
anti-rat immunoglobulin (Tago, Burlingame, CA). Sensitivity of the assay was 15 pglml.
Levels of IL-1p and T N F a were measured with a
sandwich ELISA (kindly provided by Medgenix; Brussels,
Belgium). These assays use several different monoclonal
antibodies for coating and detection. Sensitivity of these
assays was 5 pglml.
Measurements of immunoglobulin levels. Ig levels in
culture supernatants were measured by double-sandwich
ELISA, as described previously (19). Briefly, microtiter
plates were coated with 200 pl of specific anti-IgG and
anti-IgM antibodies in carbonate buffer, pH 9.6, overnight at
4°C. After washing, serial dilutions of standard IgG and IgM
and of supernatants were added for 2 hours at room temperature. After washing, specific alkaline phosphataseconjugated anti-IgG or anti-IgM was added for 2 hours. After
washing, nitrophenyl phosphate was added for 2 hours at
37°C. OD was measured at 405 nm in a plate reader. Data
were expressed in nglml.
Measurements of mRNA levels for cytokines. Total
RNA was extracted essentially as described by Chompczynski and Sacchi (20). Briefly, synovium samples were lysed in
a guanidinium isothiocyanate solution, followed by extraction with phenol-chloroform and precipitation with ethanol.
RNA was quantitated by spectrophotometry , and its integrity verified by denaturing electrophoresis (formamide/
formaldehyde) on a 0.9% agarose gel stained with ethidium
bromide. Total unfractionated RNA (1 .O pg) was converted
into a single-stranded complementary DNA (cDNA) by a
standard reverse-transcription reaction. In a final volume of
40 11.1, RNA was mixed with a solution containing 1.0 pg of
oligo(dT) (12-18; Pharmacia LKB, Uppsala, Sweden), 1.0
mM each of all 4 deoxynucleotides, 80 units of RNase
inhibitor, 50 mM Tris, pH 8.3, 75 mM KCI, 10 mM dithiothreitol, 3 mM MgCI,, and 200 units of Superscript (RNase
H- MMLV reverse transcriptase; Bethesda Research,
Gaithersburg, MD). The reaction was carried out for 1 hour
at 37°C.
The polymerase chain reaction (PCR) was performed
as described by Saiki et a1 (211, with minor modifications.
Single-stranded cDNA (5 4)generated by the reverse transcription reaction was diluted in a 100-pI solution of 100 LCM
of each deoxynucleotide, 100 ng of each 5' and 3' Primers, lo
KC'- lo5mM MgC129 and 0-01%
Tris* pH 8-3*50
gelatin. The mixture was heated at 100°C for 5 minutes and
quickly chilled in ice. T W Polymerase (2 units; Perkin
Elmer/Cetus, Norwalk, CT) was added, and the reaction was
allowed to proceed through 36 cycles of primer annealing (at
6o"c, 30 seconds), extension (at 72"C, 1.0 minutes), and
denaturation (94"C, 30 seconds). PCR products were analyzed on a 2% agarose gel, transferred onto a nylon membrane,
800
Control
.
I
600.
400.
2
4
10
8
6
12
Days
Control
P
A
0
0
-
+ Actinomycin D
- - I
--
I
2
8
6
4
1
0
1
2
Days
30-
c
+ normal
--)-
normal+lL-4
+ RA+11-4
20.
10.
(0
2
0
0
2
4
6
8
10
Days
Kinetics ofinterleukin-6 (IL-6) production by rheumatoid
Synoviurn sections from RA
(RA) synovium
patients were cultured for 10 days in the presence or absence of
cycloheximide (A), actinomycin D (B), or IL-4 (C). In A, synovium
samples were incubated for 24 hours, with (or without) cycloheximi& (350 d r n l ) , washed, and incubated in medium alone for the
rest of the culture; in B, synovium samples were incubated for the
duration of the culture with (or without) actinomycin D (5 &rnl); in
C, normal and RA synovium samples were incubated for the
duration of the culture with (or without) IL-4(50 unitslml). Supernatants were collected on various days and tested for IL-6 production by enzyme-linked imrnunosorbent assay.
Figure
IL-4 INHIBITS CYTOKINE PRODUCTION IN RA SYNOVITIS
877
France). Their sequences are as follows: for IL-6, sense
CCCAAGCTTAGTTGCCTTCTCCCTGGG, antisense
-101
Control
+ 11-4
CCCTCTAGAATITGCCGAAGAGCCCTCA,and reporter
CCAGCCTGCTGACGAAGCTGCAGGCACAG; for IL- t p,
sense CCCAAGCnATGATGGCITAITACAGTGGCAAT,
antisense CCCTCTAGAGGAAGACACAAATTGCATGGTGAA, and reporter ATGGAGCAACAAGTGGTG'ITCTCCAGA; and for pactin, sense GTGGGCCGCTCTAGGCACCA
and antisense TGGCC'ITAGGGTGCAGGGGG.
Statistical analysis. Results are expressed as the mean
f SEM or as the percentage of control production. Differences between treatments of different samples from the same
synovium were compared by nonparametric Wilcoxon
paired t-test. Intra-assay variability was estimated by measurements of spontaneous IL-6 production from replicates of
pieces of the same synovium. The mean 2 SEM spontaneous IL-6 production in 9 and 6 replicates from 2 different RA
synovium samples was 79.7 ? 5.8 n g h l and 112.7 k 11.6
ng/ml, respectively; coefficients of variation were 23% and
20%, respectively.
RESULTS
Control
+ 11-4
.
t
0
Q
Y
u.
z
I-
r
0
looL
100
10
Control
+ 11-4
Figure 2. IL-4 inhibits spontaneous cytokine production by RA
synovium. RA synovium samples from 14 different patients were
cultured for 10 days in the presence or absence of 50 unitdm1 of IL-4.
Levels of IL-6 (A), IL-lp (B),and tumor necrosis factor a (TNFa) (C)
were measured in supernatants by enzyme-linked immunosorbent
assay. See Figure 1 for explanations of other abbreviations.
and hybridized with a y3'P end-labeled (T4 kinase; Boehringer, Mannheim, FRG) oligonucleotidereporter probe, unrelated to the amplifying primers. primers and reporter oligonucleotides (24-36-mer) were purchased from Genset (Pans,
Spontaneous production of immunoglobulinsand
cytokines by RA synovium in an ex vivo model of RA
synovitis. An ex vivo model of RA synovitis was
established using synovium sections obtained at surgery, mostly for active synovitis of the wrist. RA
synovium samples were cultured in medium alone for
10 days, and levels of Ig and cytokines in culture
supernatants were measured. Fourteen different synovium samples were studied as a group. Synovium
pieces produced microgram amounts of IgG and IgM,
with higher levels of IgG (mean +- SEM 16.1 +- 2.2
pg/ml, range 4.0-26.8) than IgM (8.1 ? 3.7 pg/ml,
range 0.3-43.2; P < 0.05). Nanogram amounts of
cytokines were detected, with higher levels of IL-6
(mean ztr SEM 362 ? 60 ng/ml, range 78-880) than
IL-IP (1.39 f 0.51 ng/ml, range 0.22-6.31; P < 0.001)
and T N F a (1.22 ? 0.33 nglml, range 0-3.55; P < 0.001).
In 5 of 14 samples, T N F a was undetectable. In sharp
contrast, T cell-derived cytokines such as IL-4 and
I F N y could not be detected in any of these supernatants (data not shown). Thus, RA synovium spontaneously produced high levels of Ig and proinflammatory
cytokines without production of IFNy and IL-4.
Because RA is a chronic inflammatory disease,
it was important to elucidate whether the established
ex vivo model would also demonstrate persistent and
active cytokine production. Kinetic studies indicated
that spontaneous IL-6 production in vitro increased
over time, thus demonstrating the presence of an
active process (Figure 1). Incubation of synovium
sections with cycloheximide (an inhibitor of protein
synthesis) or with actinomycin D (an inhibitor of
MIOSSEC ET AL
878
Table 2. Interleukin-4 (IL-4) inhibits the production of both immunoreactive and biologically active
IL-6 by rheumatoid synovium*
IL-6 production (ng/ml)
ELISA
Bioassay
Synovium
Control
Sample I
Sample 2
Sample 3
Sample 4
Sample 5
Mean 2 SEM
236
218
42
54
340
178 2 57
With
IL-4
With
IL-2
34
64
16
22
28
238
I68
36
90
338
174 2 53
32 2 8t
Control
With
IL-4
With
IL-2
228
294
32
70
218
44
58
8
24
20
168 2 50
30 2 9 t
264
232
20
204
192
182 2 42
* Samples of synovium from 5 patients with rheumatoid arthritis were cultured for 10 days in the
presence of IL-4 (50 units/ml) or IL-2 (50 unitslml). IL-6 production in supernatants was measured by
KD83 biological assay and by enzyme-linked immunosorbent assay (ELISA).
t P < 0.05 versus control (no addition).
transcription) inhibited IL-6 production (Figures 1A
and B). A sample of normal synovium was also found
to produce IL-6. Although the cellular composition of
RA and normal synovium is different, IL-6 production
by a normal synovium sample was 5-10-fold lower
than that of an RA synovium producing moderate
amounts of cytokines, when compared according to
tissue weight (Figure 1C). Thus, this culture system
appears to be a dynamic system which may represent
an ex vivo model of RA synovitis.
IL-4 inhibits IL-6 production by RA synovium.
IL-4 has been shown to inhibit the production of
proinflammatory cytokines and immunoglobulins by
mitogen-activated PBMC (22-27). In sharp contrast,
IL-4 increased IL-6 production by purified B cells and
endothelial cells (28,29). Since RA synovium is composed of different cell types, we used our RA model to
test how 1L-4 would regulate the production of these
proteins. Thus, synovium samples were incubated
with and without 50 unitdm1 of IL-4. Levels of IL-6
were measured after 10 days of culture. Results obtained for each synovium sample are shown in Figure
2A. IL-4 induced a profound reduction of IL-6 production (mean ? SEM 362 & 60 ng/ml without IL-4 versus
92 ? 20 ng/ml with 1L-4; P < 0.001). Similar results
were obtained with a biological assay for IL-6, indicating that IL-4 was also inhibiting the production of
biologically active IL-6 (Table 2).
Addition of IL-2 (50 unitdml) to the same
cultures failed to inhibit IL-6 production. IL-4 inhibited IL-6 production in a dose-dependent manner
(Figure 3). A concentration of IL-4 as low as 2 units/ml
resulted in significant inhibition of IL-6 production,
and a maximal effect was obtained with 50 units/ml,
showing a mean IL-6 production that was 25% of the
control value. Kinetic studies had indicated that IL-6
production in vitro increased over time. Addition of a
single dose of IL-4 resulted in a blockade of IL-6
production, which was sustained over time (Figure
1C). The observed inhibition was indeed due to IL-4,
since a neutralizing anti-IL-4 antibody prevented the
IL-&induced inhibition of IL-6 production (data not
shown). The results also indicated that IL-4 can block
spontaneous IL-6 production by normal s ynovium
(Figure 1C).
100 -
I
11-6
80 -
40 20 60
%
s
O
A
0
2
10
50
250
Concentration of IL-4 (U/ml)
Figure 3. Dose-response curve of the inhibitory effect of IL-4 on
IL-6 and IgG production by RA synovium. RA synovium samples
from 6 patients were cultured for 10 days in the presence of
increasing concentrations of IL-4. 1L-6 and IgG production in
supernatants was measured by enzyme-linked immunosorbent assay, and the results are expressed as the mean 2 SEM percentage of
control production. See Figure 1 for explanations of other abbreviations.
879
IL-4 INHIBITS CYTOKINE PRODUCTION IN RA SYNOVITIS
vium using PCR techniques followed by Southern blot
analysis with specific probes. IL-6 and IL-1p mRNA
could be detected, and IL-4 greatly reduced the levels
of both IL-6 and IL-1p mRNA (Figure 4). The specificity of the inhibitory effect of IL-4 is supported by the
unaltered levels of the “house-keeping gene” pactin
(Figure 4). Kinetic studies showed that IL-4 reduced
levels of IL-6 and IL-lp mRNA in synovium after 2
days, which contrasts with their persistent expression
in the absence of IL-4 (data not shown).
IL-4 inhibits IgM and IgG production by RA
synovium. Since IL-4 was shown to inhibit Ig production by mitogen-activated PBMC, we tested whether
IL-4 would also regulate the production of immunoglobulins by RA synovium samples. Levels of Ig were
measured in supernatants of RA synovium incubated
with and without IL-4, and the results are presented in
i
‘
E
cn
--
10
.-5
1
\
3.
E
ul
4. IL-4 inhibits IL-6 and IL-lp messenger RNA (mRNA)
expression by RA synovium. Synovium samples from an RA patient
were cultured for 3 days in the presence or absence of 50 unitdm1 of
Figure
IL-4.Extraction of total mRNA was followed by polymerase chain
reaction amplification with specific primers. The agarose gel stained
with ethidium bromide is shown for pactin. IL-6 and IL-Ip mRNA
characterization was accomplished with Southern blot analysis
using specific probes. See Figure 1 for explanations of other
abbreviations.
IL-4 inhibits the production of IL-lP and TNFa
by RA synovium. Since IL-1p and TNFa were also
produced during cultures of synovium explants, we
determined whether IL-4 would also block the production of these proinflammatory cytokines. The results
(Figures 2B and C) indicate that 1L-4 strongly inhibited
the spontaneous production of TNFa (mean 5 SEM
1.22 ? 0.33 ng/ml without IL-4 versus 0.24 ? 0.14 with
IL-4; P < 0.008) and IL-lp (1.39 2 0.51 ng/ml without
IL-4 versus 0.48 0.18 with IL-4; P < 0.001). In 5 of
14 samples, the effect on TNFa was not evaluable
because levels of TNFa were undetectable in these
supernatants. Levels of IFN y remained undetectable
in supernatants in the presence and absence of IL-4.
IL-4 inhibits proinflammatory cytokine mRNA
expression in cultures of RA synovium. Expression of
mRNA specific for cytokines was studied in RA syno-
c
0
w
0
3
U
2
n
Control
+ 11-4
Control
+ 1L14
*
Figure 5. IL-4 inhibits spontaneous immunoglobulin production by
RA synovium. RA synovium sections from 14 different patients
were cultured for 10 days in the presence or absence of 50 unitslml
of IL-4. Levels of IgM (A) and IgG (B)were measured in supernatants by enzyme-linked immunosorbent assay. See Figure l for
explanations of other abbreviations.
880
MIOSSEC ET AL
Figures 5A and B. IL-4 inhibited the production of
both IgM (mean 2 SEM 8.1 -t 3.7 pg/ml without IL-4
versus 4.2 2 2.7 with IL-4; P < 0.004) and IgG (16.1 5
2.2 pdml without IL-4 versus 10.4 -+ 2.0 with IL-4; P
< 0.01). The concentrations of IL-4 required to inhibit
IgG production were comparable to those needed to
inhibit IL-6 production (Figure 3). However, the extent of inhibition was lower for IgG than for IL-6 (P<
0.05 for 50 units/ml of IL-4, n = 6).
DISCUSSION
The hallmark of rheumatoid arthritis is the
chronic synovitis, which is characterized by an uncontrolled proliferation of synoviocytes, together with a
massive infiltration by mononuclear cells (2,10,30).
The persistence of the synovitis leads to cartilage and
bone destruction, and removal of the synovitis with
local and/or systemic treatment protects joints from
destruction. Thus, controlling the production of the
factors involved in the perpetuation of synovitis represents a major goal in RA treatment. The limitations
of current therapeutic agents stress the need for new
therapeutic regimens (1).
It is suspected that soluble factors including
cytokines produced at the site of the synovitis play a
pivotal role in the perpetuation of the synovitis and the
resulting bone destruction (3 I). In particular, large
amounts of 1L-1, TNFa, IL-6, transforming growth
factor p, and platelet-derived growth factor (PDGF)
are seen in RA synovial fluid (3,4,6-9,32). Therefore,
we reasoned that it would be valuable to seek potential
therapeutic agents that would block the production of
proinflammatory cytokines in an in vitro model that
closely resembled the inflamed RA joint. We developed an ex vivo model of RA, in which small pieces of
surgically removed inflamed synovium are cultured in
2 ml of culture medium and the release of cytokines is
measured in the presence or absence of interfering
agents.
Immunoreactive IL-6, IL-1, and TNFa were
detected in culture supernatants by ELISA techniques. Furthermore, concordant results were obtained in a biological assay and an immunoassay, as
well as at the mRNA level in the case of IL-6. The lack
of TNFa in some samples might be related to the
presence of soluble receptors for TNFa (33). Since RA
is a chronic inflammatory disease, it was important to
elucidate whether the established ex vivo model would
also demonstrate persistent and active cytokine production. Accordingly, kinetic studies showed that cy-
tokines progressively accumulated in the culture supernatant. This was an active process that was
dependent on protein synthesis and transcription,
since we found that cycloheximide and actinomycin D
efficiently blocked cytokine release.
Analysis of mRNA expression in cultured explants also demonstrated the presence of IL-6 mRNA
over the entire duration of culture. This contrasts with
the short-term IL-6 mRNA expression by polyclonally
activated PBMC (34). Interestingly, we were able to
show that samples of normal synovium could also
produce low levels of IL-6. The explants also secreted
large amounts of IgM and IgG. Levels of IgG were
higher than those of IgM, reflecting the secondary type
of Ig production during chronic inflammation. These
high levels of immunoglobulins produced in this ex
vivo system are likely to originate from the plasma cell
infiltrates of the RA synovitis (35).
Thus, the synovium explants are not merely
tissue “sponges” that passively release preformed
cytokines, but rather, they represent a dynamic ex
vivo model of RA. It is believed that the conserved
tissue architecture of the culture system supports the
integrity of the original chronic inflammatory reaction.
The T cell cytokine pattern remains to be studied
during the early, preclinical phase of RA. Other culture conditions might have to be selected to restore the
reduced T cell cytokine production observed during
the chronic phase.
Having established an ex vivo system of
chronic RA synovitis, we sought to determine whether
biological-response modifiers would modulate ongoing
cytokine production. We focused our attention on
IL-4, since this molecule has recently been shown to
inhibit the secretion of the proinflammatory cytokines
IL-1, TNFa, and 1L-6 by activated PBMC as well as
by monocytes/macrophages (22-27), and since the
opposite effects were obtained with B cells and endothelial cells (28,29). The present study demonstrates
that 1L-4 strongly inhibits the production of proinflammatory cytokines by rheumatoid synovial explants,
which are composed of different cell types. Inhibition
was clearly seen after a 48-hour incubation period and
was long lasting. After 10 days, the production of all 3
cytokines was blocked by approximately 75%. Because these cytokines often act synergistically in many
biological assays, their reduced production is likely to
result in a significant reduction in the biological activity of RA synovitis products and, most particularly, in
synoviocyte proliferation. The observed inhibition
was specific for IL-4, since an inhibitory anti-IL-4
IL-4 INHIBITS CYTOKINE PRODUCTION IN RA SYNOVITIS
antibody could prevent IL-4-induced inhibition of
cytokine production. IL-4 was active at low concentration, with maximal inhibition obtained with approximately 50 unitdml. The IL-4-induced inhibition of
cytokine production was not merely an inhibitory
effect displayed by any given cytokine: IL-2, another
T cell cytokine, failed to block the production of IL-6.
Whether cytokines other than IL-4 are capable of
inhibiting this cytokine production remains to be determined. The antiinflammatory effects of IL-4 observed in our ex vivo model of RA extend our initial
observations in studies using mononuclear cell suspensions and suggest a clinical potential for IL-4 (discussed below).
Our RA synovitis model system also results in
the spontaneous production of large amounts of IgG
and IgM, and LL-4 was found to partially inhibit this
process. Concentrations of IL-4 needed to inhibit this
phenomenon were comparable to those needed to
inhibit cytokine production, but the overall inhibition
of Ig production was less than that of cytokine production. At first glance, it appears that this inhibitory
effect of IL-4 on Ig production is in direct conflict with
the stimulatory effects of IL-4 described previously
(36,37). However, more recent studies have also demonstrated the ability of IL-4 to block either polyclonal
or antigen-specific production of Ig (38,39).
The activation and proliferation of synoviocytes represent a major feature of RA synovitis (30,4042). The expansion of these cells is probably partly due
to the local excess of TNFa and IL-I, cytokines that
are known to show growth factor activity on fibroblasts (42,43). Therefore, the reduced production of
these cytokines in the presence of IL-4 would be
expected to rob synoviocytes of at least some of their
growth factors. We still have to determine whether
IL-4 would inhibit the production of fibroblast growth
factor and PDGF, two major fibroblast growth factors
that are present in large amounts in synovial fluid
(40-44). Another positive impact of IL-4 in the control
of synovitis is its inhibitory effect on the proliferation
of synoviocytes in culture (unpublished observations).
Although complete understanding of RA pathogenesis remains a long-term project, various concepts
have emerged which could lead to new therapeutic
approaches (1,2). When considering cytokine regulation, tools under development include receptor antagonists, soluble receptors, and antibodies directed
against cytokines or their receptors. 1L-1 production
by RA synovitis could be down-regulated with an
anti-TNFa antibody (45). 1L-1-receptor antagonist
88 1
inhibits 1L-1-related processes in vitro and in vivo and
has been used recently as a systemic treatment in RA
(46-48).
The present approach with IL-4 has the major
advantage of not being limited to a single cytokine, but
rather, it affects a cascade of proinflammatory cytokines in which TNFa, IL-I, and IL-6 act on each
other. Thus, the inhibition of proinflammatory cytokine production by IL-4 might be of major clinical
interest in chronic inflammatory diseases. Another related useful property of IL-4 is its ability to inhibit
cytokine-induced bone resorption in vivo (49). Furthermore, RA represents an inflammatory disease which
might be linked to a disequilibrium in favor of the
proinflammatory TH 1 helper T cell population rather
than the TH2 population (50). Because IL-4 has been
shown to permit the development of TH2 cells, which
produce IL-4 (51), administration of IL-4 may result in
the reestablishment of an appropriate equilibrium between THI and TH2 cell populations. If this is the case,
then administration of IL-4 could slow down the longterm progression of the disease. It remains to be demonstrated whether the reduced IL-4 production is already present during the earliest phase of the disease or
is related to chronicity. Modulation of the cytokine
network in RA might include the use of IL-4 either
systemically or locally at the site of inflammation.
ACKNOWLEDGMENTS
We thank A. Waitz and J. P. Revillard for reading the
manuscript, and M. Vatan for preparing the manuscript.
REFERENCES
1. H a m s E D Jr: Rheumatoid arthritis: pathophysiology
2.
3.
4.
5.
6.
and implications for therapy. N Engl J Med 322:12771289, 1990
Ziff M: Rheumatoid arthritis: its present and future. J
Rheumatol 17: 127-132, 1990
Wood DD, Ihrie EJ, Dinarello CA, Cohen PL: Isolation
of an interleukin-1-like factor from human joint effusions. Arthritis Rheum 26:975-983, 1983
Miossec P, Dinarello CA, Ziff M: Interleukin-1 lymphocyte chemotactic activity in rheumatoid arthritis synovial fluid. Arthritis Rheum 29:461470, 1986
Pettipher ER, Higgs GA, Henderson B: Interleukin 1
induced leukocyte infiltration and cartilage proteoglycan
degradation in the synovial joint. R o c Natl Acad Sci
USA 83:8749-8753, 1986
Miyasaka N, Sat0 K, Goto M: Augmented interleukin-1
882
production and HLA-DR expression in the synovium of
rheumatoid arthritis patients: possible involvement in
joint destruction. Arthritis Rheum 31:480-486, 1988
7. Saxne T, Palladino MA, Heinegkd D, Tala1 N, Wollheim FA: Detection of tumor necrosis factor a but not
tumor necrosis factor p in rheumatoid arthritis synovial
fluid and serum. Arthritis Rheum 31:1041-1045, 1988
8. Guerne P-A, Zuraw BL, Vaughan JH, Carson DA, Lotz
M: Synovium as a source of interleukin 6 in vitro:
contribution to local and systemic manifestations of
arthritis. J Clin Invest 83:585-592, 1989
9. Firestein GS, Alvaro-Gracia J, Maki R: Quantitative
analysis of cytokine gene expression in rheumatoid
arthritis. J Immunol 144:3347-3353, 1990
10. Kurozaka M, Ziff M: Immunoelectron microscopic
study of the distribution of T cell subsets in rheumatoid
synovium. J Exp Med 158:1191-1210, 1983
11. Firestein GS, Zvaifler NJ: Peripheral blood and synovial
fluid monocyte activation in inflammatory arthritis. 11.
Low levels of synovial fluid and synovial tissue interferon suggest that y-interferon is not the primary macrophage activating factor. Arthritis Rheum 33:864-871,
1987
12. Miossec P, Navilliat M, Dupuy d’Angeac A, Sany J ,
Banchereau J: Low levels of interleukin-4 and high
levels of transforming growth factor p in rheumatoid
synovitis. Arthritis Rheum 33: 118&1187, 1990
13. Arnett FC, Edworthy SM, Bloch DA, McShane DJ,
Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang
MH, Luthra HS, Medsger TA Jr, Mitchell DM, Neustadt DH, Pinals RS, Schaller JG, Sharp JT, Wilder RL,
Hunder GG: The American Rheumatism Association
1987 revised criteria for the classification of rheumatoid
arthritis. Arthritis Rheum 31:315-324, 1988
14. Le HV, Ramanathan L, Labdon JE, Mays-Ichinco CA,
Syto R, Arai N, Hoy P, Takebe Y, Nagabhushan TL,
Trotta PP: Isolation and characterization of multiple
variants of recombinant human interleukin 4 expressed
in mammalian cells. J Biol Chem 263:10817-10823, 1988
15. Spits H, Yssel H, Takebe Y, Arai N, Yokota T , Lee F,
Arai K, Banchereau J, DeVries JE: Recombinant interleukin-4 promotes the growth of human T cells. J Immuno1 135: 1142-1 147, 1987
16. Chretien I, van Kimmenade A, Pearce MK, Banchereau
J, Abrams JS: Development of polyclonal and monoclonal antibodies for immunoassay and neutralization of
human interleukin-4. J Immunol Methods 1 17:67-81,
1989
17. Wijdenes J, Clement C, Klein B, Morel-Fournier B, Vita
N, Ferrara P, Peters A: Human recombinant dimeric
IL-6 binds to its receptor as detected by anti-IL-6
monoclonal antibodies. Mol Immunol 28: 1183-1 192,
1991
18. Favre C, Wijdenes J , Cabrillat H, Djossou 0,
Banchereau J, DeVries JE: Epitope mapping of recom-
MIOSSEC ET AL
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
binant human gamma interferon using monoclonal antibodies. Mol Immunol 26:17-25, 1989
Defrance T, Aubry JP, Rousset F, Vanbervliet B, Bonnefoy JY, Arai N, Takebe Y, Yokota T, Lee F, Arai K,
DeVries JE, Banchereau J: Human recombinant IL-4
induces FCEreceptors (CD23) on normal human B
lymphocytes. J Exp Med 165:1459-1467, 1987
Chompczynski P,Sacchi N: Single-step method of RNA
isolation by acid guanidium thiocyanate-phenolchloroform extraction. Anal Biochem 162: 156-159, 1987
Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R,
Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA
polymerase. Science 239:487491, 1988
Hart PH, Vitti GF, Burgess DR, Whitty GA, Piccoli DS,
Hamilton JA: Potential antiinflammatory effects of interleukin 4: suppression of human monocyte tumor necrosis factor a, interleukin 1, and prostaglandin E,. Proc
Natl Acad Sci USA 86:3803-3807, 1989
Essner R, Rhoades K, McBride WH, Morton DL,
Economou JS: IL-4 down-regulates IL-I and T N F gene
expression in human monocytes. J Immunol 142:38573861, 1989
Cheung DL, Hart PH, Vitti GH, Whitty GA, Hamilton
JA: Contrasting effects of interferon-gamma and interleukin-4 on the interleukin-6 activity of stimulated human monocytes. Immunology 71:70-75, 1990
Donnelly RP, Fenton MJ, Finbloom DS, Gerrard TL:
Differential regulation of IL-I production in human
monocytes by IFN-7 and IL-4. J Immunol 145569-575,
1990
Donnelly RP, Fenton MJ, Kaufman JD, Gerrard TL:
IL- 1 expression in human monocytes is transcriptionally
and posttranscriptionally regulated by IL-4. J Immunol
14613431-3436, 1991
Briolay J , Dechanet J, Blanchard D, Banchereau J,
Miossec P: Interleukin 4 inhibits polyclonal immunoglobulin secretion and cytokine production by peripheral
blood mononuclear cells from rheumatoid arthritis patients. J Clin Immunol 12:3644, 1992
Smeland EB, Blomhoff HK, Funderud S, Shalaby MR,
Espevik T: Interleukin 4 induces selective production of
interleukin 6 from normal human B lymphocytes. J Exp
Med 170:1463-1468, 1989
Howells G, Pham P, Taylor D, Foxwell B, Feldman M:
Interleukin 4 induces interleukin 6 production by endothelial cells: synergy with interferon-?. Eur J Immunol
21:97-101, 1991
Burmester GR, Dimitriu-Bona A, Waters SJ, Winchester RJ: Identification of three major synovial lining cell
populations by monoclonal antibodies directed to l a
antigens and antigens associated with monocytesl
macrophages and fibroblasts. Scand J Immunol 17:6982, 1983
Miossec P: Role of interleukin 1 in the pathogenesis of
IL-4 INHIBITS CYTOKINE PRODUCTION IN RA SYNOVITIS
rheumatoid arthritis. Clin Exp Rheumatol 5:305-308,
1987
32. Fava R, Olsen N, Keski-Oja J, Moses H, Pincus T:
Active and latent forms of transforming growth factor p
activity in synovial effusions. J Exp Med 169:291-296,
1989
33. Seckinger P, Isaaz S, Dayer J-M: A human inhibitor of
tumor necrosis factor a. J Exp Med 167:1511-1516, 1988
34. Navarro S, Debili N, Bernaudin JF, Vainchenker W,
Doly J: Regulation of the expression of IL-6 in human
monocytes. J Immunol 14234339-4345, 1989
35. Smiley JD, Sachs C, Ziff M: In vitro synthesis of
immunoglobulin by rheumatoid synovial membrane. J
Clin Invest 47:624-632, 1968
36. Isakson PC,Pure E, Vitetta S, Krammer PH: T cellderived B cell differentiation factor($: effect on the
isotype switch of murine B cells. J Exp Med 155:734748, 1982
37. Defrance T, Vanbervliet B, Pkne J, Banchereau J:
Human recombinant IL-4 induces activated B lymphocytes to produce IgG and IgM. J Immunol 141:20002005, 1988
38. Llorente L, Crevon ML, Karray S, Defrance T,
Banchereau J, Galanaud P: Interleukin-4 counteracts the
helper effect of IL-2 on antigen-activated human B cells.
Eur J Immunol 19:765-769, 1989
39. Callard RE, Smith SH, Scott KE: The role of interleukin
4 (IL-4) in specific antibody responses by human B cells.
Int Immunol3:157-163, 1991
40. Lafyatis R, Remmers EF, Roberts AB, Yocum DE,
Sporn MB, Wilder RL: Anchorage-independent growth
of synoviocytes from arthritic and normal joints: stimulation by exogenous platelet-derived growth factor and
inhibition by transforming growth factor-beta and retinoids. J Clin Invest 83:1267-1276, 1989
41. Remmers EF, Lafyatis R, Kumkumian GK, Case JP,
Roberts AB, Sporn MB, Wilder RL: Cytokines and
growth regulation of synoviocytes from patients with
rheumatoid arthritis and rats with streptococcal cell wall
arthritis. Growth Factors 23179-188, 1990
883
42. Bucala R, Ritchlin C, Winchester R, Cerami A: Constitutive production of inflammatory and mitogenic cytokines by rheumatoid synovial fibroblasts. J Exp Med
1733569-574, 1991
43. Kovacs EJ: Fibrogenic cytokines: the role of immune
mediators in the development of scar tissue. Immunol
Today 12: 17-23, 1991
44. Raines EW, Dower SK, Ross R: Interleukin-1 mitogenic
activity for fibroblasts and smooth muscle cells is due to
PGDF-AA. Science 243:393-396, 1989
45. Brennan FM, Jackson A, Chantry D, Maini R, Feldmann M: Inhibitory effect of the TNFa antibodies on
synovial cell interleukin-1 production in rheumatoid
arthritis. Lancet II:244-247, 1989
46. Eisenberg SP, Evans RJ, Arend WP, Verderber E,
Brewer MT, Hannum CH, Thompson RC: Primary
structure and functional expression from complementary DNA of a human interleukin-1 receptor antagonist.
Nature 343:341-346, 1990
47. McIntyre KW, Stepan GJ, Kolinsky KD, Benjamin WR,
Plocinski JM, K&a KL, Campen CA, Chizzonite RA,
Kilian PL: Inhibition of interleukin 1 (IL-1) binding and
bioactivity in vitro and modulation of acute inflammation in vivo by IL-1 receptor antagonist and anti-IL-1
receptor monoclonal antibody. J Exp Med 173:931-939,
1991
48. Lebsack ME, Paul CC, Bloedow DC, Burch FX, Sack
MA, Chase W, Catalan0 MA: Subcutaneous IL-1 receptor antagonist in patients with rheumatoid arthritis (abstract). Arthritis Rheum 34 (suppl 9):S45, 1991
49. Watanabe K, Tanaka Y,Morimoto I, Yahata K, Zeki K,
Fujihira T, Yamashita U, Eto S: Interleukin-4 as a
potent inhibitor of bone resorption. Biochem Biophys
Res Commun 172:1035-1041, 1990
50. Mosmann TR, Coffman RL: TH, and TH, cells: different
patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol7:145-173, 1989
51. Swain SL, Weinberg AD, English M, Huston G: IL-4
directs the development of Th2-like helper effectors. J
Immunol 145:3796-3806, 1990
Документ
Категория
Без категории
Просмотров
5
Размер файла
930 Кб
Теги
production, synovitis, mode, inhibition, proinflammatory, immunoglobulin, interleukin, vivo, cytokines, rheumatoid
1/--страниц
Пожаловаться на содержимое документа