close

Вход

Забыли?

вход по аккаунту

?

Interleukin-10 functions as an antiinflammatory cytokine in rheumatoid synovium.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 39, No. 3, March 1996, pp 386-395
0 1996, American College of Rheumatology
386
.~
INTERLEUKIN-10 FUNCTIONS AS AN
ANTIINFLAMMATORY CYTOKINE IN RHEUMATOID SYNOVIUM
PIA ISOMAKI, REIJO LUUKKAINEN, RIITTA SAARIO, PAAVO TOIVANEN, and JUHA PUNNONEN
Objective. Interleukin-10 (IL-10) is an antiinflammatory cytokine that has been shown to play a role in
rheumatoid arthritis (RA). We therefore investigated
the effects of IL-10 on the function and phenotype of
synovial fluid mononuclear cells (SFMC) derived from
patients with RA. In addition, we studied the production
of IL-10 in rheumatoid joints, and the role of endogenous IL-10 in the regulation of SFMC function.
Methocis. The presence of IL-10 in rheumatoid
joints was studied using IL-lhpecific enzyme-linked
inmunosorbent assay (ELISA) and reverse transcriptme
polymerase chain reaction (RT-PCR) techniques. The
effects of recombinant human IL-10 or neutralizing
anti-IL-10 monoclonal antibodies (MAbs) on both cytokine production and phenotype of SFMC were evaluated
using cytokine-specificELISAs and flow cytometry. The
effect of IL-10 on proliferation of SFMC was determined
by incorporation of tritiated thymidine.
Resuh. IL-10 was detected by ELISA in 22 of 23
SF samples, and was spontaneously produced by cultured SFMC. IL-10 messenger RNA was detectable in
all 8 SFMC samples, as determined by RT-PCR. Neutralization of endogenously produced IL-10 by antiIL-10 MAbs resulted in increased production of IL-lP,
tumor necrosis factor a (TNFa),and granulocyt+
macrophage colony-stimulating factor (GM-CSF) by
SFMC, and in enhanced proliferation of SFMC. In
Presented in part at the Ninth International Congress of
Immunology, San Francisco, CA, July 23-29, 1995.
Supported in part by grants from the Academy of Finland,
the Sigrid Jusklius Foundation, and the Turku University Foundation.
Pia Isomdci, MD, Paavo Toivanen, MD: Turku University,
Turku, Finland; Redo Luukkainen, MD: Satalinna Hospital, Harjavalta, Finland; Riitta Saario. MD: Turku University Central Hospital, Turku, Finland; Juha Punnonen, MD: Turku University,
Turku, Finland, and DNAX Research Institute, Pal0 Alto, California.
Address reprint requests to Pia IsomBki, MD, Department
of Medical Microbiology, Turku University, Kiinarnyllynkatu 13,
FIN-20520 Turku, Finland.
Submitted for publication August 14, 1995; accepted in
revised form October 30, 1995.
particular, the production of TNFa was dramatically
increased by anti-IL-10 MAbs. Moreover, the expression of HLA-DR molecules by SF macrophages was
increased, and the expression of CD16 was decreased by
anti-IL-10 MAbs. In contrast, addition of recombinant
IL-10 signi6cantly decreased the production of IL-lP,
TNFa, and GM-CSF by SFMC, and decreased spontaneous and IL-Unduced proliferation of SFMC. Finally,
IL-10 decreased HLA-DR expression and increased the
expression of the Fcy receptors, CD16 and CD64, by SF
macrophages
Conclusion. These data indicate that endogenously produced IL-10 functions as an immunoregulatory molecule in rheumatoid synovium. Importantly,
exogenous IL-10 has potent antiinflammatory effects on
SFMC, suggesting that IL-10 may be useful in the
treatment of patients with RA.
.
Rheumatoid arthritis (RA) is a chronic autoimmune disorder characterized by accumulation of
activated T cells, macrophages, and plasma cells in the
joints. Although the cause of the disease is still unknown, recent studies have shown that cytokines
secreted by the activated cells are likely to play a
major role in the maintenance of the inflammatory
process, and in the induction of bone and cartilage
destruction in rheumatoid synovium.
Macrophage-derived proinflammatory cytokines such as interleukin-1 (IL-1), tumor necrosis
factor a (TNFa), and granulocytemacrophage colonystimulating factor (GM-CSF) have previously been
detected in the joints of patients with RA ( 1 4 ) . Both
IL-1 and T N F a stimulate collagenase and prostaglandin E production, and induce cartilage destruction in vitro (5-7). GM-CSF has been shown to upregulate class I1 major histocompatibility complex
(MHC)expression on synovial macrophages (8). The
importance of cytokines in the pathogenesis of arthritis has also been demonstrated in vivo in different
animal models. Intraarticular injection of 1L-1 into
IL-10 IN RHEUMATOID ARTHRITIS
rabbit knee joints induces synovitis with an accumulation of inflammatory cells and cartilage degradation
(9). Systemic administration of IL-1 accelerates the
development and progression of collagen-induced arthritis in mice (lo), which can be partially prevented
by an IL-I receptor antagonist protein (11). Similarly,
mice that overexpress TNFa spontaneously develop
destructive arthritis, which is prevented by the administration of anti-TNFa monoclonal antibodies (MAbs)
(12). Anti-TNFa MAbs have also been shown to
ameliorate synovitis in murine collagen-inducedarthritis (13). In addition, there is recent evidence that
anti-TNFa therapy is useful in the treatment of patients with RA (14,15).
IL-10 is an antiinflammatory cytokine secreted
by activated T cells, monocytes, and B cells (16,17). It
was originally characterized as a cytokine-synthesis
inhibitory factor because of its capacity to inhibit
cytokine production by mouse Thl cells (18). More
recently, IL-10 has been shown to have potent inhibitory effects on both T cell and monocyte functions.
IL-10 inhibits both the expression of class I1 MHC
molecules and the production of proinflammatory
cytokines such as IL-1, IL-6, IL-8, TNFa, and GMCSF, by human monocytes in vitro (19,20). IL-10 also
inhibits T cell proliferation, both directly and indirectly, by diminishing the antigen-presenting and accessory cell capacity of monocytes (20,21). Moreover,
IL-10 has been shown to inhibit Ig secretion by unfractionated peripheral blood mononuclear cells
(PBMC) through suppression of the accessory cell
function of monocytes (22), although IL-10 also has
direct stimulatory effects on proliferation and production of Ig by purified B cells (23). Based on animal
models, IL-10 has potent antiinflammatory effects in
vivo. IL-lO-deficient mice develop a chronic enterocolitis that resembles human Crohn’s disease (24). In
addition, neutralization of endogenous IL-10 by antiIL-10 MAbs results in more severe collagen-induced
arthritis in mice (25). IL-I0 has also been successfully
used to treat inflammatory disorders in animal models.
Mice can be protected from lethal endotoxemia by a
single injection of recombinant 1L-10 (26), and administration of IL- 10 suppresses induction of experimental
allergic encephalomyelitis in Lewis rats (27).
It has been shown that IL-10 is spontaneously
produced by synovial membrane cells derived from
patients with RA (28), and recently, it was demonstrated that activated T cell clones from rheumatoid
synovial membrane produce high levels of IL-10 compared with T cell clones derived from the peripheral
387
blood (29). In addition, the production of IL-10 by
PBMC has been shown to be higher in patients with
RA, systemic lupus erythematosus, or Sjogren’s syndrome than in healthy controls (30). Levels of IL-10
are also elevated in the synovial fluid (SF) and serum
of RA patients (31).
We have studied the role of IL-I0 in the regulation of cytokine production, and in the proliferation
and phenotype of SF mononuclear cells (SFMC) derived from patients with RA. Because IL-10 production and the activation state of SFMC from patients
with RA are increased, as compared with those of
PBMC from healthy individuals, the effects of both
exogenous recombinant IL- I0 and neutralizing antiIL-10 MAbs were investigated. Our results show that
IL-10 inhibits cytokine production and proliferation of
SFMC, and modulates the phenotype of SF macrophages. Anti-IL-10 MAbs had opposite effects as
compared with IL-10, suggesting an important role for
endogenously produced IL-10 as a regulator of SFMC
phenotype and function. Our results provide further
evidence that IL-10 may be regarded as a possible
therapeutic agent for RA.
PATIENTS AND METHODS
Patients. Twenty-six patients with RA (19 women
and 7 men) were enrotled in this study. The median age of
the patients was 56 years (range 24-77), and the median
duration of disease was 17.5 years (range 140). Mean (+SD)
erythrocyte sedimentation rate (ESR) at the time samples
were obtained was 53 f 25 mm/hour. RA was determined
according to the criteria of the American College of Rheumatology (formerly, the American Rheumatism Association)
(32). Five patients had seronegative RA, and 1 of the 5 had
concurrent sacroiliitis. Nineteen patients were receiving
disease-modifying antirheumatic drugs, 21 patients were
receiving steroids, and 24 patients were treated with nonsteroidal antiinflammatory drugs. This study was approved by
the ethical committee of Turku University Central Hospital.
Reagents. Purified recombinant human IL-2, recombinant human IL-I0 (specific activity 2 x lo7 unitdmg), and
the neutralizing anti-IL-10 MAb 19F1 (19,20) were kindly
provided by Dr. Jan E. de Vries (DNAX Research Institute,
Palo Alto, CA). Fluorescein isothiocyanate (F1TC)conjugated anti-human CD3, CD14, and nonspecific mouse
IgG antibodies, and phycoerythrin (PEjconjugated antihuman CD14, CD16, CD23, CD25, CD69, HLA-DR, and
nonspecific mouse IgG antibodies were purchased from
Becton Dickinson (Mountain View, CA). FITC-conjugated
anti-human CD64 antibodies were purchased from Pharmingen (San Diego, CA).
Cell preparations and culture conditions. SF samples
were obtained by needle aspiration from inflamed knee joints
into heparinized tubes. After centrifugation, SF supernatants were stored at -70°C until analyzed by enzyme-linked
388
immunosorbent assay (ELISA) for the presence of cytokines.
SFMC were isolated by a Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) density gradient centrifugation, and
washed twice with phosphate buffered saline (PBS) at 4°C.
Macrophages were enriched from cell suspensions by adherence to plastic petri dishes (Bibby Sterilin Ltd., Stone,
England) for 1 hour at 37°C. More than 80% of this adherent
cell population consisted of macrophages, as determined by
anti-CD14 staining and flow cytometry. Adherent cells,
nonadherent cells, or total SFMC were cultured at lo6
cells/mUwell, or, when cytokine production was studied, 2 x
lo6 cells/mUwell were used. Cells were cultured in Iscove’s
modified Dulbecco’s medium (Gibco BRL, Paisley, Scotland), supplemented with 10% heat-inactivated fetal calf
serum (FCS; Bioproducts for Science, Indianapolis, IN) and
50 d m l of gentamycin (Biological Industries, Bethaemek,
Israel). Cells were cultured in 24-well plates (Costar, Cambridge, MA) at 37°C in a humidified atmosphere containing
5% CO,. IL-10 (100 units/ml, 5 ng/ml), or anti-IL-I0 MAbs
(5 d m l ) were added at the onset of the cultures. In order to
study cytokine production, 1 &ml of lipopolysaccharide
(LPS; Sigma, St. Louis, MO) was added to the cultures,
together with IL-I0 or anti-IL-10 MAbs, and supernatants
were collected after a culture period of 18 hours. Supernatants were centrifuged briefly to remove cell debris and
stored at -70°C until used for ELISA.
Immunofluorescence analysis. Cells were harvested
after a culture period of 3 days, and washed twice with PBS
supplemented with 2% FCS, 0.01% sodium azide. Cells were
incubated with 1% normal mouse serum (Dako, Glostrup,
Denmark) for 30 minutes at 4°C. After 2 washes, FITC- and
PE-conjugated MAbs were added at saturating concentrations for 30 minutes at 4°C. Isotype-matched unspecific
mouse IgG was used as a negative control Ab. Two additional washes were performed, and labeled cells were analyzed using a FACScan (Becton Dickinson) flow cytometer
and LYSYS I1 software. In order to quantify the effects of
IL-10 on the expression of surface antigens, mean fluorescence intensity (MFI) for each staining was calculated.
Cytokine ELISA. Cytokine levels in the S F samples
and culture supernatants were determined using cytokinespecific ELISAs, which were either described previously or
obtained commercially and used according to the manufacturers’ instructions. IL-10, TNFa, and GM-CSF levels were
measured as described (33,34). The sensitivity of these
ELISAs was 50 pg/ml. IL-1p levels were measured using
ELISA kits obtained from Cistron Biotechnology (Pine
Brook, NJ), which detect mature IL-lp, but have 1&15%
cross-reactivity with IL-1 p precursor. The sensitivity of this
ELISA was 30 pg/ml. Duplicate determinations, which differed <8% from each other, were performed for each
sample.
Proliferation assays. For 4 days, lo5 cells were cultured in triplicate in 200 p4 of RPMI medium supplemented
with 10% heat-inactivated normal human serum, 0.1 mM of
mercaptoethanol (Sigma), and 50 d m l of gentamycin, in
flat-bottom %well microtiter plates (Costar). IL-2 (100
units/ml), IL-10 (100 unitdml), or anti-IL-10 MAbs (5 &ml)
were added at the onset of the cultures. Tritiated thymidine
(3H-TdR; 1.0 pCi/well, 2.0 CVmmole) was added for the final
ISOMAKI ET AL
Table 1. Synovial fluid cytokine levels in patients with rheumatoid
arthritis*
Cytokine level (pg/ml)
Patient
IL-10
IL-Ip
TNFa
GM-CSF
~
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
545
3,642
1,346
1,211
>5,OOO
768
>5,OOO
2,754
1,710
2,096
>5,OOO
>5,OOO
1,278
<so
4,418
2,213
875
49 1
649
2,599
>5,OOO
3,118
1,426
<30
<30
<30
107
32
46
<30
<30
<30
<30
32
<30
75
<30
40
<30
43
I77
<30
<30
<30
101
<30
<so
<so
<50
<50
<50
<50
<so
101
<so
<so
<so
<50
215
420
82
1,327
5,227
2,232
2,606
2,094
<so
<so
<so
<so
487
<so
<so
<so
3%
3,817
72 I
90
<so
<so
4 0
187
<50
<so
<50
<so
93
<so
3,781
>5,OOO
>5,OOO
<so
* Cytokine levels were determined using specific enzyme-linked
immunosorbent assays, as described in Patients and Methods. Each
value represents the mean of duplicate determinations. IL = interleukin; TNFa = tumor necrosis factor a; GM-CSF = granulocytemacrophage colony-stimulating factor.
18 hours of culture, and the plates were harvested and
analyzed by scintillation counting (Wallac, Turku, Finland).
Messenger RNA (mRNA) isolation and reverse
transcriptase-polymerase chain reaction (RT-PCR) analysis.
Total RNA was extracted from SFMC as described by
Chirgwin et a1 (35). Briefly, cells were homogenized in 4M
guanidium isothiocyanate, and RNA was purified with ultracentrifugation through cesium chloride cushion. Two micrograms of total RNA was reverse transcribed using superscript reverse transcriptase (Gibco BRL, Gaithersburg, MD)
and oligo(dT) 12-18 as a primer (Gibco BRL), according to
the procedure of Krug and Berger (36), in a 20-p4 reaction.
The equivalent of 50 ng of total RNA was used for amplification reactions. Each 50-pl PCR reaction contained 1 unit
of AmpliTaq DNA polymerase (Perkin Elmer, Norwalk,
CT), 5 p4 of 1OX PCR buffer (Perkin Elmer), 2 &of MgCl,,
200 p M of each dNTP, and 25 nmoles of each primer. The
following primers, kindly provided by Dr. Rene de Waal
Malefyt (DNAX Research Institute), were used: IL-10 sense
5‘-ATCCCCCAAGCTGAGAACCAAGACCCA-3’; IL-10
antisense 5’-TCTCAAGGGGCTGGGTCAGCTATCCCA3’; hypoxanthine-guanine phosphoribosyltransferase
(HPRT) sense 5‘-CTGGCGTCGTGATTAGTGATGATGA3’; and HPRT antisense 5’-CTTAGGCTTTGTATTTTGC’ITTTCC-3’.
Reactions were incubated in a Perkin-Elmer-Cetus
DNA Thermal Cycler 9600 for 40 cycles (denaturation for 30
IL-10 IN RHEUMATOID ARTHRITIS
389
tides, probes were run through a Nick column (Pharmacia).
Following hybridization for 3 hours at 60°C membranes
were washed in 2X saline-sodium citrate, 0.1% sodium
dodecyl sulfate, for 20 minutes at room temperature and for
30 minutes at 55°C. Membranes were exposed to Kodak
XAR-5 film for 2-24 hours. The IL-10 oligonucleotide probe
was as follows: 5'-CAGGTGAAGAATGCCTAATAAG-
CTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGT'ITGACATC-3'.
Figure 1. The expression of interleukin-I0 (IL-10) messenger RNA
by synovial fluid mononuclear cells (SFMC) from 8 patients with
rheumatoid arthritis (lanes 1-8). Peripheral blood mononuclear cells
(PBMC) from a healthy volunteer were used as a negative control
(lane 9). Total RNA from SFMC and PBMC was isolated and
subjected to reverse transcription. Complementary DNA was amplified using primers specific for hypoxanthine-guanine phosphoribosyltransferase (HPRT) and IL-10. Complementary DNA specific
for HPRT was detected using staining with ethidium bromide, and
that specific for IL-10 was analyzed using Southern blotting (see
Patients and Methods for details).
seconds at 94°C annealing for 30 seconds at 55"C, and
extension for 60 seconds at 72°C). Twenty microliters of
each PCR product was electrophoresed through 1.2% agarose gel, and visualized as ultraviolet fluorescence after
staining with ethidium bromide. Gels were denaturated in
3M NaCl and 0.4M NaOH, and transferred to a nytran
membrane (Schleicher & Schuell, Keene, NH) according to
the manufacturer's instructions. Membranes were prehybridized in QuickHyb solution (Stratagene, La Jolla, CA) for
2 hours at 60°C. The oligonucleotide probe, specific for a
sequence internal to the primers used in the amplification,
was labeled with Y ~ ~ P - A T(Amersham,
P
Arlington Heights,
IL) using T4 polynucleotide kinase (Stratagene) for 5' end
labeling as described (19). To remove unincorporated nucleo-
RESULTS
Production of IL-10 in the joints of patients with
RA. We first studied the levels of IL-10 in SF samples
from 23 patients with RA. Because IL-1, TNFa, and
GM-CSF have been shown to play a role in the
pathogenesis of RA, the SF levels of these cytokines
were compared with those of IL-10. IL-10 was detected in 22 of 23 samples, and the median level of
IL-10 was 2,096 pg/ml (Table 1). No significant correlation between ESR and SF IL-10 levels was observed
(data not shown). In contrast to IL-10, detectable
amounts of IL-1p and TNFa were observed only in 9
of 23 and 11 of 23 patients, respectively. Moreover,
GM-CSF could be detected in 8 SF samples. Consistent with the high S F IL-10 levels in vivo, SFMC from
8 of 8 patients with RA spontaneously produced IL-10
during a culture period of 18 hours (mean ? SEM
1,284 ? 450 pg/ml). In addition, IL-10 mRNA was
detectable in all 8 SFMC samples studied by RT-PCR,
indicating local, ongoing production of IL-10 in the
joints (Figure 1). Based on these data, IL-10 was
consistently present in rheumatoid SF, suggesting a
Table 2. The effects of interleukin-10 (IL-10)
and anti-IL-10 monoclonal antibodies (MAbs) on IL-lp, tumor necrosis factor a (TNFa),and
granulocytemacrophage colony-stimulating factor (GM-CSF) production by synovial fluid mononuclear cells (SFMC) from patients with
rheumatoid arthritis*
IL- 1p production (pglml)
Patient?
1
2
3
4
5
6
7
8
ps
Medium
IL-10
363
1,075
722
987
338
765
910
ND
126
765
193
127
40
395
554
ND
0.018
Anti-IL-10
973
996
1,741
1,506
648
1,284
1,236
ND
0.028
TNFa production (pg/ml)
GM-CSF production (pglml)
Medium
IL-10
Anti-IL-10
1,215
1,997
235
1,207
236
527
822
838
<50
>6,000
2,702
5,005
5,116
2,869
2,436
>6,000
>6,000
0.012
395
<50
<50
<50
<50
108
<50
0.012
~
Medium
IL-10
Anti-IL-10
142
<50
51 I
<50
110
<50
I34
3,118
827
126
812
508
502
817
675
0.012
4 0
<50
172
<50
<50
<50
<50
<50
<50
0.068
~
~~
~
* Different stimuli were used in the culture of SFMC. 1L-10 was used at a concentration of 100 units/& and anti-Ill0 MAbs at a concentration
of 5 &&. Lipopolysaccharide (1 &ml) was added to all cultures. Each value represents the mean of duplicate determinations. ND = not
done.
t Patients 1-5 correspond to patients 3, 7, 8, 12, and 23, respectively, in Table 1.
t P values were calculated using the Wilcoxon signed-rank test. Cytokine levels produced in the presence of IL-10 or anti-IL-10 MAbs were
compared with those produced in medium alone. Limit values were used for levels under 50 or above 6,000.
ISOMAKI ET AL
390
HLA-DR
CD16
CD64
PATIENT 1
(medium vs IL-1 0)
1
PATIENT 2
(medium vs 11-1 0)
1
1
I
PATIENT 3
(medium vs IL-1 0)
I
PATIENT 3
I
1
(medium vs
11-1 0 + dL-10)
Figure 2. The effects of interleukin-I0 (IL-10) on the expression of HLA-DR, CD16, and CD64 by synovial fluid macrophages
from 3 representative patients with rheumatoid arthritis. Patients 1 and 2 correspond to patients 20 and 9, respectively, in Table
I. Adherent synovial fluid mononuclear cells were cultured in the presence of IL-10 (100 unitslml) for 3 days, and the expression
of HLA-DR, CD16, and CD64 by CD14+ cells was analyzed using flow cytometry. Histograms represent the expression levels
in the cells, cultured in the presence (dotted histogram) and absence (open histogram) of IL-10. The bottom row shows the effects
of neutralizing anti-IL 10 monoclonal antibodies on IL- lwmediated modulation of surface antigen expression.
role for IL-10 as a regulator of the inflammatory
process in the joints of patients with RA.
Effects of IL-10on IL-lP, TNFa,and GM-CSF
production by SFMC. We next studied the effects of
exogenous IL-10 on the production of the proinflammatory cytokines IL-lp, TNFa, and GM-CSF by
SFMC derived from 8 patients with RA. No spontaneous production of these cytokines by SFMC was
detectable in vitro. Therefore, LPS was added to
enhance the activation state of macrophages. As
shown in Table 2, recombinant human IL-10 (100
unitdml) strongly inhibited IL- 1/3 and T N F a production by SFMC. This effect was observed in all patients
studied. GM-CSF was produced in detectable amounts
in 4 of 8 SFMC samples. Similar to IL-Ip and T N F a
production, GM-CSF synthesis by SFMC was inhibited by IL-I0 (Table 2).
In order to study the role of endogenous IL-10
IL-10 IN RHEUMATOID ARTHRITIS
in the regulation of cytokine synthesis by SFMC, we
added neutralizing anti-IL-10 MAbs (5 pg/ml) to the
cultures of LPS-stimulated SFMC. Anti-IL-10 MAbs
increased IL-1/3 levels in 6 of 7 patients (Table 2). In
addition, the levels of TNFa were dramatically increased in response to anti-IL-10 MAbs. Also, after
the addition of anti-IL-10 MAbs, GM-CSF could be
detected in all supernatants. These results suggest that
endogenous IL-10 produced by SFMC inhibits the
production of IL-1, TNFa, and GM-CSF in inflamed
joints, and the levels of these cytokines can be further
down-regulated by exogenous IL-10.
Effects of IL-10 on the phenotype of SF macrophages and T cells. SF macrophages express enhanced
levels of HLA-DR molecules (37) and the Fcy receptors CD16 and CD64 (38), as compared with PB
monocytes. We studied the effects of IL-10 and neutralizing anti-IL-10 MAbs on HLA-DR, CD16, CD23,
and CD64 expression by CD14+ SF cells. In preliminary experiments, IL- 10 induced maximal phenotypic
changes after a culture period of 3 days (data not
shown). Therefore, adherent or total SFMC from 8
patients with RA were cultured for 3 days in the
presence or absence of IL-10 (100 units/ml) or antiIL-10 MAbs (5 pg/ml), and the expression of these
surface antigens was analyzed using flow cytometry.
The effects of exogenous IL-10 on the expression of HLA-DR, CD16, and CD64 by SF macrophages from 3 representative patients with RA are
shown in Figure 2. IL-I0 significantly decreased
HLA-DR expression by S F macrophages. This effect
was observed in all patients studied, but the level of
inhibition varied from patient to patient. The MFI
(?SEM) of HLA-DR expression by macrophages
cultured in medium alone was 212 ? 35, and that of
cells cultured with IL-10 was 109 ? 20 (n = 8). In
contrast to HLA-DR, the expression of the Fcy receptors CD16 and CD64 was consistently increased by
IL-10. The MFIs (+SEM) ’; CD16 expression and
CD64 expression, respectively, were 20 2 7 (n = 8)
and 10 ? 2 (n = 8) in the medium, and 59 ? I0 and 23
f 4 in the cells cultured with IL-10. The effects of
IL-10 were inhibited by the addition of neutralizing
anti-IL-10 MAbs to the cultures, which reflected the
specificity of the effects. IL-10 had no significant effect
on the expression of CD23 by macrophages (data not
shown). Comparable results were obtained using adherent cells and total SFMC (data not shown).
When added alone, neutralizing anti-IL-10
MAbs generally had opposite effects on the phenotype
of SF macrophages as compared with those of recom-
39 1
HLA-DR
CD16
CD64
Figure 3. The effects of neutralizing anti-interleukin-10 (anti-IL10) monoclonal antibodies (MAbs) on the expression of HLA-DR,
CD16, and CD64 by synovial fluid macrophages from a patient with
rheumatoid arthritis (patient 12 in Table 1). Adherent synovial fluid
mononuclear cells were cultured in the presence of 5 &ml of
anti-IL-10 MAbs for 3 days, and the expression of HLA-DR, CD16,
and CD64 by CD14+ cells was analyzed using flow cytometry.
Histograms represent the expression levels in the cells, cultured in
the presence (dotted histogram) or absence (open histogram) of
anti-IL-10 MAbs.
binant IL-10. Figure 3 shows the effects of anti-IL-10
MAbs on the phenotype of SF macrophages from a
patient with RA. Anti-IL-10 MAbs significantly increased HLA-DR expression by macrophages in 4 of 8
SFMC samples. The most potent effects of anti-IL-10
MAbs were observed on macrophages in which the
HLA-DR expression was low, whereas no or minimal
effect was detected on macrophages that expressed
high levels of HLA-DR (data not shown). The MFI (?
SEM) of HLA-DR expression by cells cultured with
anti-IL-10 MAbs was 317 2 60 (n = 8), and that of
cells cultured in medium alone was 212 ? 35. AntiIL-10 MAbs decreased the expression of CD16 by
macrophages from all 8 patients studied (MFI & SEM
8 ? 3 in cells cultured with anti-IL-10 MAbs, and 20 ?
7 in cells cultured in medium alone), but, again, the
degree of this effect vaned among patients. Anti-IL-10
MAbs had no significant effect on the expression of
CD23 or CD64 by S F macrophages (Figure 3 and data
not shown). Nevertheless, these results suggest that
endogenous IL-10 regulates the phenotype of SF macrophages in patients with RA.
The effects of IL-10 on the expression of HLADR, CD23, CD25, and CD69 by SF CD3+ cells were
also studied. Nonadherent cells or total SFMC were
cultured in the presence of IL-10 or neutralizing antiIL-I0 MAbs for 3 days, and the expression of the
surface antigens was studied using flow cytometry.
However, IL-10 or anti-IL-10 MAbs had no effects on
the expression levels of the above-mentioned surface
antigens (data not shown), which is consistent with
studies on normal human T cells (39).
ISOMAKI ET AL
392
7
M&Urn
L-10
a-lo
n-z
IL-2 + L-10
Figure 4. The effects of interleukin-10 (IL-10) and anti-IL-10 monoclonal antibodies (MAbs) on spontaneous (A)and IL-2induced (B)
proliferation of synovial fluid mononuclear cells (SFMC).SFMC
from 7 patients with rheumatoid arthritis were cultured in the
presence or absence of IL-10 (100 unitdml), IL-2 (100 units/ml), or
anti-IL-10 MAbs (5 d m l ) for 4 days. Proliferation was measured
by tritiated thymidine incorporation during the final 18 hours of
culture. Data are presented as the percentage of control SFMC
levels from 7 experiments, each performed using triplicate cultures.
Bars show the mean and SEM.
Effects of IL-10 on the proliferation of SFMC.
Finally, we investigated the effects of IL-10 and antiIL-10 MAbs on proliferation of SFMC. As shown in
Figure 4A, IL-10 significantly inhibited spontaneous
proliferation of SFMC, whereas the addition of antiIL-10 MAbs to these cultures resulted in increased
proliferation. SFMC proliferation in the presence of
IL-10 was 40 2 5% (mean -I- SEM) and, in the
presence of anti-IL-10 MAbs, 161 2 17%, compared
with that in medium alone, as determined by 3H-TdR
incorporation. Similar effects were demonstrated in all
7 patients studied.
Since it has been previously shown that IL-10
inhibits IL-2 production by T cells (21,40), we added
saturating concentrations of exogenous IL-2 in order
to study whether IL-10-mediated inhibition of SFMC
proliferation was due to inhibition of IL-2 production.
As expected, IL-2 strongly increased the proliferation
of SFMC. Importantly, however, IL-10 significantly
inhibited proliferation of SFMC, even in the presence
of 100 units/ml of IL-2 (Figure 4B). Proliferation of
SFMC that were cultured in the presence of IL-2 and
IL-10 was, on average, 65 2 9% (mean 2 SEM)
compared with that in the presence of IL-2 alone.
These data indicate that IL-10 inhibits both spontaneous and IL-2induced proliferation of SFMC, and suggest that IL-10-mediated inhibitory effects were not
solely due to inhibition of IL-2 production by T cells.
DISCUSSION
The present study demonstrates that endogenously produced IL-10 functions as an antiinflammatory molecule in the joints of patients with RA. In
addition, although IL-10 is produced in rheumatoid
synovium, exogenous IL-10 had potent inhibitory effects on cytokine production and HLA-DR expression
by SF macrophages. Moreover, IL-10 inhibited spontaneous and IL-2-induced proliferation of SFMC, supporting the conclusion that IL-10 suppresses the function of both T cells and macrophages in rheumatoid
synovium.
IL-10 was detected in 22 of 23 SF samples using
ELISA, and was spontaneously produced in cultures
of SFMC. In addition, IL-10 mRNA synthesis was
observed in all 8 SFMC samples studied, indicating
local production of IL-10 in the joints. In a previous
study that demonstrated the production of IL-10 by
RA synovial membrane cells, IL-10 was not detectable
in rheumatoid SF (28). However, our results are
consistent with those in a recent study by Cush et a1
(31), which also demonstrated the presence of IL-10 in
SF samples from patients with RA. The reason for the
different results among these studies remains to be
shown. Our results suggest that IL-10 is present in SF
more consistently than IL-lp, TNFa, or GM-CSF,
which may be due to IL-lsmediated down-regulation
of these cytokines. However, our data also demonstrate
the presence of IL-lp, TNFa, and GM-CSF in some
samples that have relatively high levels of IL-10, and
the role of IL-10 in the regulation of cytokine production in vivo in the inflamed joints of patients with RA
remains to be studied. In addition, it cannot be ruled
out that soluble IL-1 and TNFa receptors in SF
affected the results of IL-1 and TNFa ELISAs. Nevertheless, the present data indicate that IL-10 is constitutively produced in the joints of patients with RA.
Although the levels of IL-10 in the synovium
are relatively high, our data suggest that IL-10 is
produced at suboptimal levels in rheumatoid synovium, since exogenous IL-10 had potent inhibitory
effects on SF macrophage and T cell function. Our
results demonstrate that exogenous IL- 10 decreases
the production of IL-lp, TNFa, and GM-CSF by
SFMC. In contrast, neutralizing anti-IL-10 MAbs
increased the production of proinflammatory cytokines, especially TNFa, suggesting that IL-10 is a
major down-regulator of TNFa production in the
synovium. Katsikis et a1 (28) have recently demonstrated a decrease in IL-1p and TNFa production by
synovial membrane cells that are cultured in the
presence of IL- 10. Synovial membrane cells spontaneously produced IL-lp and TNFa, whereas, in our
study, LPS was added to SFMC cultures to enhance
the production of these cytokines. Nevertheless, as
IL-10 IN RHEUMATOID ARTHRITIS
described for synovial membrane cell cultures, our
data indicate that IL-10 inhibits the production of
proinflammatory cytokines by SFMC from patients
with RA.
The ability of 1L-10 to down-regulate the production of IL-lp, TNFa, and GM-CSF by SFMC is
likely to inhibit the inflammatory process in rheumatoid synovium, because these cytokines are believed
to play an important role in the pathogenesis of RA.
Both IL-1 and TNFa have been shown to be arthritogenic in animal models (9-13). In addition, treatment
of RA patients with anti-TNFa MAbs has resulted in
clinical improvement of the disease (14,15). The role of
GM-CSF in rheumatoid inflammation is less well established. However, GM-CSF enhances the production of IL-1 and TNFa and the expression of class I1
MHC antigens by human monocytes, and increases
the number of macrophages in the inflamed synovium
(8,41). Moreover, the addition of anti-GM-CSF MAbs
to synovial tissue culture supernatants down-regulates
HLA-DR expression by monocytes, suggesting that
GM-CSF may contribute to the increased expression
of HLA-DR molecules by SF macrophages (8). Therefore, the ability of IL-10 to down-regulate GM-CSF
production, in addition to inhibition of IL-1 and TNFa
production, further supports the conclusion that IL-10
has important antiinflammatory effects in rheumatoid
synovium.
IL- 10 significantly reduced HLA-DR expression by SF macrophages from patients with RA. The
decrease in HLA-DR expression induced by IL-10 has
been demonstrated to result in diminished antigenpresenting capacity of normal human monocytes (20).
A preferential expression of certain T cell receptor V,
chains in SF T cells has been reported (42,43), suggesting that T cells that are specific for the unknown
antigen potentiate an immune response in rheumatoid
joints. Therefore, the IL-10-induced decrease in antigenpresenting capacity of synovial macrophages might
suppress T cell activation and proliferation, leading
to attenuation of the inflammatory cascade in the
inflamed joints. In addition to these indirect inhibitory
effects, IL-10 can directly reduce the proliferation of
purified T cells, which can be completely restored by
addition of low concentrations of IL-2 (21). When
antigen-presenting cells are present, IL-2 can only
partially prevent IL-lcmediated inhibition of T cell
proliferation (20). Our results demonstrating a decrease in both spontaneous and IL-2-induced proliferation of SFMC in response to IL-10, together with the
fact that macrophages are abundantly present in
393
SFMC, suggest that IL-10 inhibits SF T cell proliferation mainly by indirect mechanisms.
In contrast to HLA-DR expression, the expression of the Fcyreceptors CD16 and CD64 by synovial
macrophages was significantly increased by IL- 10.
IL-10 has previously been shown to enhance CD64
expression by PB monocytes, but no effect on CD16
expression has been demonstrated (44).The increase
in CD16 expression by SF macrophages was observed
in every sample studied (n = 8). In addition, neutralization of endogenous IL-10 by anti-IL-10 MAbs
resulted in decreased expression of CD16 by SF
macrophages, supporting the conclusion that this effect was specific for IL-10. The effects of IL-10 on
CD16 expression were not specific for macrophages
from patients with RA, because similar effects were
observed in PB monocytes from healthy volunteers
(n = 5 ; data not shown). To our knowledge, these data
are the first demonstration of induction of CD16 expression by IL-10.
Fcy receptors have been shown to mediate
important beneficial effects such as phagocytosis and
clearance of immune complexes, but they also have
destructive proinflammatory effects in rheumatoid
joints (38,45). In RA, immune complexes accumulate
in the joints, and they have been shown to activate
inflammatory cells by crosslinking Fc receptors (45). It
has also been shown that Fc receptor-deficient mice
have a significant reduction in the reverse-passive
Arthus reaction, as demonstrated by the presence of
edema, hemorrhage, and neutrophil infiltration of the
injected skin (49, which indicates the pathologic potential of Fc receptors in immune complex diseases.
However, it has been recently shown that Fc receptor
crosslinking on monocytes strongly inhibits expression of both CD80 (B7-1) and CD86 (B7-2), which
mediate important costimulatory signals to T cells
through binding to their ligand, CD28 (46). Downregulation of these molecules impairs the capacity of
monocytes to function as antigen-presenting cells and,
as a consequence, T cell activation becomes impaired
(46). Since IL-10 increased both CD16 and CD64
expression by SF macrophages in our study, it is
possible that enhanced crosslinking of these molecules
may decrease the antigen-presenting capacity of SF
macrophages. However, more experiments on the
function of Fcy receptors are required in order to
understand their possible role in the pathogenesis
of RA.
Taken together, our results demonstrate that
IL-10 has important immunoregulatory effects on
ISOMAKI ET AL
394
SFMC from patients with RA. The present data suggest that endogenously produced IL-10 functions as an
antiinflammatory molecule in rheumatoid synovium,
because neutralizing anti-IL- 10 MAbs strongly enhanced cytokine production and proliferation of
SFMC. The expression of HLA-DR molecules on SF
macrophages was also increased by anti-IL- 10 MAbs.
Importantly, however, exogenous IL-10 inhibited ILlp, TNFa,and GM-CSF production and proliferation
of SFMC, and also decreased HLA-DR expression on
SF macrophages, suggesting that IL-10 is endogenously produced at suboptimal levels. The present
results, together with a recent study indicating that
administration of high doses of IL-10 is safe in humans
(47), provide further evidence that IL-10 may be useful
in the treatment of patients with RA.
ACKNOWLEDGMENTS
We thank Tuna Haarala, Satu Kling, and Marju
Niskala for technical assistance. We are grateful t o Dr. Jan
E. d e V i e s for valuable discussions, and to Dr. Benjamin G.
Cocks and Dr. Bruce Bennett for their kind help and
support. Dr. Timo Mottonen is acknowledged for providing
patient samples.
REFERENCES
1. Miyasaka N, Sat0 K, Goto M, Sasano M, Natsuyama M, Inoue
2.
3.
4.
5.
6.
7.
8.
K, Nishioka K: Augmented interleukin-1 production and
HLA-DR expression in the synovium of rheumatoid arthritis
patients: possible involvement in joint destruction. Arthritis
Rheum 31:480486, 1988
Buchan G, Barrett K, Turner M, Chantry D, Maini RN,
Feldmann M: Interleukin-I and tumour necrosis factor mRNA
expression in rheumatoid arthritis: prolonged production of
1L-la. Clin Exp Immunol73:449-455, 1988
Chu CQ, Field M, Feldmann M, Maini RN: Localization of
tumor necrosis factor a in synovial tissues and at the cartilagepannus junction in patients with rheumatoid arthritis. Arthritis
Rheum 34:1125-1132, 1991
Haworth C, Brennan FM, Chantry D, Turner M, Maini RN,
Feldmann M: Expression of granulocyte macrophage colonystimulating factor in rheumatoid arthritis: regulation by tumor
necrosis factor a. Eur J Immunol 21:2575-2579, 1991
Dayer J-M, de Rochemonteix B, Burrus €3, Demczuk S ,
Dinarello CA: Human recombinant interleukin I stimulates
collagenase and prostaglandin E2 production by human synovial
cells. J Clin Invest 77:645-648, 1986
Dayer J-M, Beutler B, Cerami A: Cachectidtumor necrosis
factor stimulates collagenase and prostaglandin E2 production
by human synovial cells and dermal fibroblasts. J Exp Med
162:2163-2 168, 1985
Campbell IK, Piccoli DS, Roberts MJ, Muirden KD, Hamilton
JA: Effects of tumor necrosis factor a and p on resorption of
human articular cartilage and production of plasminogen activator by human articular chondrocytes. Arthritis Rheum 33:
542-552, 1990
Alvaro-Gracia JM, Zvaifler NJ, Firestein GS: Cytokines in
chronic inflammatory arthritis. IV. Granulocytehnacrophage
colony-stimulating factor-mediated induction of class I1 MHC
antigen on human monocytes: possible role in rheumatoid
arthritis. J Exp Med 170865-875, 1989
9. Pettipher ER, Higgs GA, Henderson B: Interleukin 1 induces
leukocyte infiltration and cartilage proteoglycan degradation in
the synovialjoint. Proc Natl Acad Sci U S A 833749-8753, 1986
10. Hom JT, Bendele AM, Carlson DG: In vivo administration with
IL-I accelerates the development of collagen-induced arthritis
in mice. J Immunol 141:834441, 1988
11. Wooley PH, Whalen JD, Chapman DL, Berger AE, Richard
KA, Aspar DG, Staite ND: The effect of an interleukin-l
receptor antagonist protein on type I1 collagen-induced arthritis
and antigen-induced arthritis in mice. Arthritis Rheum 36:13051314, 1993
12. Keffer J, Lesley P, Cazlaris H, Georgopoulos S , Kaslaris E,
Kioussis D, Kollias G: Transgenic mice expressing human
tumour necrosis factor: a predictive genetic model of arthritis.
EMBO J 10:4025431, 1991
13. Williams RO, Feldmann M, Maini RN: Anti-tumor necrosis
factor ameliorates joint disease in murine collagen-induced
arthritis. Proc Natl Acad Sci U S A 89:97849788, 1992
14. Elliott MJ, Maini RN, Feldmann M, Long-Fox A, Charles P,
Katsikis P, Brennan FM, Walker J, Bul H, Ghrayeb J, Woody
JN: Treatment of rheumatoid arthritis with chimeric monoclonal
antibodies to tumor necrosis factor a.Arthritis Rheum 36: 16811690,1993
IS. Elliott MJ, Maini RN, Feldmann M, Kalden JR, Antoni C,
Smolen JS, Leeb B, Breedveld FC, Macfarlane JD, Bijl H,
Woody JN: Randomised double-blind comparison of chimeric
monoclonal antibody to tumour necrosis factor a (cA2) versus
placebo in rheumatoid arthritis. Lancet 344: 1105-1 110, 1994
16. Vieira P, de Waal Malefyt R, Dang M-N, Johnson KE,
Kastelein R, Fiorentino DF, de Vries JE, Roncarolo M-G,
Mosmann TR, Moore KW: Isolation and expression of human
cytokine synthesis inhibitory factor cDNA clones: homology to
Epstein-Bam virus open reading frame BCRFI. Proc Natl Acad
Sci U S A 88:1172-1176, 1991
17. Yssel H, de Waal Malefyt R, Roncarolo M-G, Abrams JS,
Lahesmaa R, Spits H, de Vries JE: IL-I0 is produced by subsets
of human CD4+ T cell clones and peripheral blood T cells. J
Immunol 149:237%2384, 1992
18. Fiorentino DF, Bond MW, Mosmann TR: Two types of mouse
T helper cell. 1V. Th2 clones secrete a factor that inhibits
cytokine production by Thl clones. J Exp Med 170:2081-2095,
1989
19. De Waal Malefyt R, Abrams J, Bennett B, Fidgor CG, de Vries
JE: Interleukin 10 (IL-10)
inhibits cytokine synthesis by human
monocytes: an autoregulatory role of ILlO produced by monocytes. J Exp Med 174:120%1220, 1991
20. De Waal Malefyt R, Haanen J, Spits H, Roncarolo M-G, te
Velde A, Figdor C, Johnson K, Kastelein R, Yssel H, de Vries
JE: Interleukin-I0 (IL-10) and viral IL-I0 strongly reduce
antigen-specific human T cell proliferation by diminishing the
antigen-presenting capacity of monocytes via downregulation of
class I1 major histocompatibility complex expression. J Exp
Med 174:915-924, 1991
21. De Waal Malefyt R, Yssel H, de Vries JE: Direct effects of
IL-I0 on subsets of human CD4+ T cell clones and resting T
cells. J Immunol 150:47544765, 1993
LL. Punnonen J, de Waal Malefyt R, van Vlasselaer P, Gauchat J-F,
de Vries JE: IL-10 and viral IL-I0 prevent IL-4-induced IgE
synthesis by inhibiting the accessory cell function of monocytes. J Immunol 151:1280-1289, 1993
23. Rousset F, Garcia E, Defrance T, Peronne C, Vezzio N, Hsu
D H , Kastelein R, Moore KW, Banchereau J: IL-I0 is a potent
growth and differentiation factor for activated human B lymphocytes. Proc Natl Acad Sci U S A 89:189&1893, 1992
--
395
IL-10 IN RHEUMATOID ARTHRITIS
24. Kuhn R, Liihler J, Rennick D, Rajewsky K, MuUer W: Interleukin-IMeficient mice develop chronic enterocolitis. Cell 75:
263-274, 1993
25. Kasama T, Strieter RM, Lukacs NW, Lincoln PM, Burdick
MD: Interleukin-10 expression and chemokine regulation during
the evolution of murine type I1 collagen-induced arthritis. J Clin
Invest 9 5 2 8 6 8 4 7 6 , 1995
26. Howard M, Muchamuel T, Andrade S, Menon S: Interleukin 10
protects mice from lethal endotoxemia. J Exp Med 177:12051208,1993
27. Rott 0, Fleicher B, Cash E: Interleukin-I0 prevents experimental allergic encephalomyelitis in rats. Eur J Immunol 24:1434
1440,1994
28. Katsikis PD, Chu C-Q, Brennan FM, Maini RN, Feldmann M:
Immunoregulatory role of interleukin 10 in rheumatoid arthritis.
J Exp Med 179:1517-1527, 1994
29. Cohen SBA, Katsikis PD, Chu C-Q, Thomssen H, Webb LMC,
Maini RN, Londei M, Feldmann M: High level of interleukin-I0
production by the activated T cell population within the rheumatoid synovial membrane. Arthritis Rheum 38:94&952, 1995
30. Llorente L, Richaud-Patin Y, Fior R, Alcocer-Varela J,
Wijdenes J, Foumer BM, Galanaud P, Emilie D: In vivo
production of interleukin-I0 by non-T cells in rheumatoid
arthritis, Sjogren’s syndrome, and systemic lupus erythematosus. Arthritis Rheum 37:1647-1655, 1994
31. Cush JJ, Splawski JB, Thomas R, McFarlin JE, Schulze-Koops
H, Davis LS, Fujita K, Lipsky PE: Elevated interleukin-I0
levels in patients with rheumatoid arthritis. Arthritis Rheum
38:%-104,1995
32. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS,
Medsger TA Jr, Mitchell DM, Neustadt DH, Pinals RS, Schaller
JG, Sharp JT, Wilder RL, Hunder GG: The American Rheumatism Association 1987 revised criteria for the classification of
rheumatoid arthritis. Arthritis Rheum 31:315-324, 1988
33. Abrams JS, Roncarolo M-G, Yssel H, Andersson U,Gleich GJ,
Silver JE: Strategies of anti-cytokine monoclonal antibody
development: immunoassay of IL-I0 and IL-5 in clinical samples. Immunol Rev 1 2 7 5 2 4 , 1992
34. Bacchetta R, de Vaal Malefyt R, Huijbens RJF, de Vries JE,
Figdor CG: Host-reactive CD4+ and CD8+ T cell clones
isolated from a human chimera produce IL5, IL2, IFNy, and
35.
36.
37.
38.
granulocytelmacrophage-colony-stimulatingfactor but not IL4.
J Immunol 144:902-908, 1990
Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1852945299, 1979
Krug MS, Berger SI: First-strand cDNA synthesis primed with
oligo(dT). Methods Enzymol 152:316325, 1987
Ridley MG, Kingsley G, Pitzalis C, Panayi GS: Monocyte
activation in rheumatoid arthritis: evidence for in situ activation
and differentiation in joints. Br J Rheumatol 29:844?8, 1990
Wahl SM, Allen JB, Welch GR, Wong HL: Transforming
growth factor-p in synovial fluids modulates Fc-$III (CD16)
expression on mononuclear phagocytes. J Immunol 148:485-
490,1992
39. Spits H, de Waal Malefyt R: Functional characterization of
human IL-10. Int Arch Allerg Immunol 99%-15, 1992
40. Taga K, Tosato G: IL-10 inhibits human T cell proliferation and
IL-2 production. J Immunol 148: 1143-1 148, 1992
41. Hamilton JA: Rheumatoid arthritis: opposing actions of haemopoietic growth factors and slow-acting anti-rheumatic drugs.
Lancet 342536539, 1993
42. Howell MD, Diveley JP, Lundeen KA, Esty A, Winters ST,
Carlo DJ, Brostoff SW: Limited T-cell receptor pchain heterogeneity among interleukin 2 receptor-positive synovial T cells
suggests a role for superantigen in rheumatoid arthritis. Proc
Natl Acad Sci U S A 88:10921-10925, 1991
43. Paliard X, West SG, Lafferty JA, Clements JR, Kappler JW,
Marrack P, Kotzin BL: Evidence for the effects of a superantigen in rheumatoid arthritis. Science 253:325-329, 1991
44. Te Velde AA, de Waal Malefijt R, Juijbens JF, de Vries JE,
Figdor CG: IL-I0 stimulates monocyte Fc-$ surface expression
and cytotoxic activity. J Immunol 149:40484052, 1992
45. Sylvestre DL, Ravetch JV: Fc receptors initiate the Arthus
reaction: redefining the inflammatory cascade. Science 265:
1095-1098,1994
46. Barcy S, Wettendorff M, Leo 0, Urbain J, Kruger M, Ceuppens
JL, de Boer M: FcR cross-linking on monocytes results in
impaired T cell stimulatory capacity. Int Immunol 7:179-189,
1995
47. Chernoff AE, Granowitz EV, Shapiro L, Vannier E, Lonne-
mann G, Angel JB, Kennedy JS, Rabson AR, WoH SM,
Dinarello CA: A randomized, controlled trial of IL-10 in humans. J Immunol 1545492-5499, 1995
Документ
Категория
Без категории
Просмотров
0
Размер файла
978 Кб
Теги
synovium, interleukin, antiinflammatory, function, cytokines, rheumatoid
1/--страниц
Пожаловаться на содержимое документа