close

Вход

Забыли?

вход по аккаунту

?

Isolation and characterization of farnesyl diphosphate synthase from the cotton boll weevil Anthonomus grandis.

код для вставкиСкачать
A r t i c l e
ISOLATION AND
CHARACTERIZATION OF
FARNESYL DIPHOSPHATE
SYNTHASE FROM THE
COTTON BOLL WEEVIL,
Anthonomus grandis
A. Huma Taban, Claus Tittiger, Gary J. Blomquist,
and William H. Welch
Department of Biochemistry and Molecular Biology, University of
Nevada, Reno, Nevada
Farnesyl diphosphate synthase (FPPS) catalyzes the consecutive
condensation of two molecules of isopentenyl diphosphate with dimethylallyl diphosphate to form farnesyl diphosphate (FPP). In insects, FPP is
used for the synthesis of ubiquinones, dolicols, protein prenyl groups, and
juvenile hormone. A full-length cDNA of FPPS was cloned from the
cotton boll weevil, Anthonomus grandis (AgFPPS). AgFPPS cDNA
consists of 1,835 nucleotides and encodes a protein of 438 amino acids.
The deduced amino acid sequence has high similarity to previously
isolated insect FPPSs and other known FPPSs. Recombinant AgFPPS
expressed in E. coli converted labeled isopentenyl diphosphate in the
presence of dimethylallyl diphosphate to FPP. Southern blot analysis
indicated the presence of a single copy gene. Using molecular modeling,
the three-dimensional structure of coleopteran FPPS was determined and
compared to the X-ray crystal structure of avian FPPS. The a-helical
fold is conserved in AgFPPS and the size of the active site cavity is
C 2009 Wiley Periodicals, Inc.
consistent with the enzyme being a FPPS. Keywords: farnesyl diphosphate synthase; cotton boll weevil; isoprenyl
transferase; molecular modeling
Correspondence to: Gary J. Blomquist, Department of Biochemistry and Molecular Biology, University of
Nevada, Reno, NV 89557-0014. E-mail: garyb@cabnr.unr.edu
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 71, No. 2, 88–104 (2009)
Published online in Wiley InterScience (www.interscience.wiley.com).
& 2009 Wiley Periodicals, Inc. DOI: 10.1002/arch.20302
Boll Weevil Farnesyl Diphosphate Synthase
89
INTRODUCTION
Isoprenyl diphosphate synthases, also referred to as prenyltransferases, catalyze the
consecutive condensation of isopentenyl diphosphate (IPP) with allylic prenyldiphosphates. These enzymes are classified according to the product chain length and the
geometry of the newly formed double bonds (E or Z). The short chain
E-prenyltransferases consist of geranyl diphosphate synthase (GPPS), farnesyl diphosphate synthase (FPPS), and geranylgeranyl diphosphate synthase (GGPPS), which
produce products with chain lengths C10, C15, and C20, respectively (Ogura and
Koyama, 1998). Long chain E-prenyltransferases produce polyprenyl diphosphates
ranging in length from C30 to C50, which are involved in respiratory quinone
biosynthesis (Okada et al., 1996). The Z-polyprenyl diphosphate synthases are used for
synthesis of the long chain dolichols and several other very long chain isoprenoids
(Sato et al., 1999).
The structural genes for a variety of E-isoprenyl diphosphate synthases have
been cloned and characterized (Ogura et al., 1997; Wang and Ohnuma, 1999).
Multiple alignments of the deduced amino acid sequences indicate two characteristic
aspartate-rich DDXXD motifs (first aspartate-rich motif: FARM, and second aspartaterich motif: SARM) and five highly conserved regions (Koyama et al., 1993; Chen et al.,
1994; Kellogg and Poulter, 1997). Mutational analyses (Wang and Ohnuma, 1993;
Ohnuma et al., 1998) and X-ray crystallography studies (Tarshis et al., 1996) have
revealed the mechanisms of chain elongation and determination of product chain
length.
Farnesyl diphosphate synthase catalyzes the consecutive condensation of two
molecules of IPP with DMAPP to form farnesyl diphosphate (FPP). In insects, FPP is
used for the synthesis of ubiquinones, dolicols, prenylated proteins, and juvenile
hormone (Schooley and Baker, 1985; Havel et al., 1992). In A. grandis, prenyltransferases have additional importance. A. grandis is among the few insects that use
the isoprenoid pathway for pheromone component synthesis (Mitlin and Hedin,
1974). The male-produced pheromone components of A. grandis are monoterpenoids
(Tumlinson et al., 1969), which are likely synthesized from geranyl diphosphate. The
female boll weevil produces a sesquiterpene pheromone (Hedin et al., 1979), which is
presumably synthesized from FPP. FPPS has been sequenced from several insects
including, Agrotis ipsilon (Castillo-Gracia and Couillaud, 1999), Bombyx mori (Kikuchi
et al., 2001), Drosophila melanogaster (Sen et al., 2007a), and Choristoneura fumiferana
(Cusson et al., 2006).
The X-ray structures have been obtained for the unliganded avian FPPS at a 2.6-Å
resolution (Tarshis et al., 1994), and for a double mutant in the presence of DMAPP,
GPP, and FPP (Tarshis et al., 1996). In addition, crystal structures of Staphylococcus
aureus and Escherichia coli FPPSs bound with IPP were resolved (Hosfield et al., 2004).
More recently, X-ray data have also been reported for Trypanosoma cruzi FPPS (Gabelli
et al., 2006), and for human FPPS (Rondeau et al., 2006). Based on these studies, the
enzyme is a homodimer. The binding site is composed of 10 a-helices that form a large
central cavity and two aspartate-rich motifs are positioned on opposite sides of the
cavity.
In this report, the molecular cloning and expression of the first coleopteran FPPS
is reported. The AgFPPS cDNA was isolated from an A. grandis male gut cDNA library,
and a putative three-dimensional structure of A. grandis FPPS was determined using
molecular modeling.
Archives of Insect Biochemistry and Physiology
90
Archives of Insect Biochemistry and Physiology, June 2009
MATERIALS AND METHODS
Insects
Adult boll weevils and diet pellets were obtained from the USDA-APHIS Misson Plant
Protection Center, Mission, Texas. Adults were segregated by sex according to Burke
(1959).
PCR Cloning of A. grandis FPPS
An AgFPPS gene fragment was amplified by PCR using A. grandis male gut cDNA
library (Taban et al., 2006) as template. Two degenerate PCR primers were designed
based on consensus sequences of previously isolated cDNAs from A. ipsilon and D.
melanogaster. The forward and reverse primers were: YIACNCCNGARAAYAT
(I:inosine) and TCYTWIATRTCNGTNCC, which correspond to the amino acid
sequences LTPENI (position 151–156) and GTDIQD (position 333–338)in the A.
ipsilon protein (AJ009962). PCR amplifications were done in a 50-ml final volume,
containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 50 pmol of each
primer, 2-ml template, 0.2 mM dNTPs, and 2.5 U Taq DNA polymerase (Life
Technologies). The cycling profile was 1 min at 951C, 35 cycles of 40 s at 941C, 1 min
at 501C, 1 min at 721C, and a 10-min extension at 721C. The 560-bp PCR product was
purified from agarose gel using an Ultrafrees-DA centrifugal filter device (Millipore),
cloned into pST-Blue1 (Novagen) and sequenced. The complete cDNA was isolated by
PCR using sequence-specific primers and the cDNA library as template. The fulllength sequence was assembled from overlapping clones, and confirmed by amplifying
the full-length cDNA with primers that span the open reading frame. All other PCR
products were purified with Microcon-PCR centrifugal filter devices (Amicon).
Expression and Purification of A. grandis FPPS
The coding region of FPPS cDNA was modified to insert BamHI and EcoRI sites at the
50 and 30 ends, respectively, using oligonucleotide primers GCGGATCCGTTTTCGG
TGAAATTGTCC and GCGAATTCACACTCCCGTTTGTACAAC by PCR to amplify
the cDNA library template. The PCR reaction was carried out in 50 ml containing
2.5 mM MgCl2, 50 pmol of each primer, 2 ml template, 0.2 mM dNTPs, 2.5 U of Pfu
DNA polymerase (Stratagene), and 1 Pfu buffer provided by the supplier. The
cycling profile was 1 min at 951C, followed by 3 cycles of 40 s at 941C, 1 min at 371C,
2 min ramp to 721C (0.31C/s), 4 min at 721C, 30 cycles of 40 s at 941C, 1 min at 601C,
4 min at 721C, and a 15 min final extension at 721C. The PCR product was digested
with BamHI and EcoRI and subcloned into pTrcHis2c (Invitrogen) to produce a
polyhistidine-tagged fusion protein. The correct insertion of FPPS in the vector was
confirmed by sequencing. Recombinant FPPS was expressed in E. coli Rosetta (DE3)
cells (Novagen) and the fusion protein was purified by immobilized metal affinity
chromatography (IMAC) using Xpress System Protein Purification Kit according to
the supplier’s protocol (Invitrogen).
Sequence Analysis
Sequences were determined using BigDye terminator cycle DNA sequencing kit
(Applied Biosystems) and ABI prism 310 DNA sequencer. Amino acid sequences were
aligned by the program CLUSTAL W (Thompson et al., 1994).
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
91
Southern Blot Analysis
Genomic DNA was isolated from 5 individual males and 5 individual females using
MasterPure DNA purification kit (Epicentre Technologies) and digested with EcoRI.
After agarose gel electrophoresis and blotting to nylon membrane (Hybond N1,
Amersham), the blot was hybridized with 32P-dCTP-labeled AgFPPS cDNA fragment at
421C in 50% formamide, 0.12 M sodium phosphate, pH 7.0, 0.25 M NaCl, and 7%
SDS, and washed twice for 10 min at room temperature with 2 SSC, 0.1% SDS, and
once for 15 min at 371C with 0.2 SSC, 0.1% SDS. The blot was imaged with a
phosphorimager (BioRad).
Prenyltrasferase Assay and Product Analysis
Prenyltransferase assay was performed according to Fujii et al. (1982) with
modifications. The prenyltransferase activity of recombinant FPP was measured in a
200-ml reaction mixture containing 50 mM Tris/HCl, pH 7.4, 2.5 mM MgCl2, 1 mM
DTT, 10 mM KF, 10% glycerol, 10 mM [14C] IPP (55 mCi/mmol, Amersham Pharmacia
Biotech.), 50 mM DMAPP (Sigma), and the indicated amounts of recombinant enzyme.
The mixture was incubated for 1 h at 301C and then treated with concentrated HCl for
30 min at the same temperature to hydrolyze products. The hydrolysates were
extracted with hexane and the radioactivity of extracts was determined by liquid
scintillation counting.
The products of the prenyltransferse assay were analyzed by HPLC using a 250- 4.6-mm C18 reversed-phase column and monitored at 214 nm (Zhang and Poulter,
1993). Instead of HCl treatment, samples were boiled for 5 min and mixed 1:1 with
25 mM NH4HCO3, pH 7.0, and the following gradients of 25 mM NH4HCO3, pH
7.0/acetonitrile were applied: 100% 25 mM NH4HCO3 isocratic for 5 min, 100–0% over
30 min at a flow of 1 ml/min. One-milliliter fractions were collected and the
radioactivity of the fractions was determined by liquid scintillation counting.
Cross-Linking Reaction
Cross-linking reactions were performed on purified, recombinant AgFPPS with
dimethyl suberimidate (DMS, Pierce Biotechnology) according to Davies and Stark
(1970) with some modifications. Each reaction (20 ml) contained 3.5 mg recombinant
purified protein in 0.2 M triethanolamine-HCl, pH 8.5, and 5 or 10 mg of DMS freshly
dissolved in the same buffer. The reaction was incubated at room temperature for
30 min or 1 h and stopped with the addition of an equal volume of Laemmli sample
buffer (BioRad). Samples were denatured at 551C for 30 min and analyzed by 7.5%
SDS-PAGE as described by Laemmli (1970). Gels were stained with Coomassie brilliant
blue and densitometry analysis was performed using Labworks Analysis software
(UVP, Inc.).
Molecular Modeling
The three-dimensional structure of AgFPPS was determined with a combination of
homology modeling (COMPOSER) (Srinivasan and Blundell, 1993) and threading
(GENEFOLD (Jaroszewski et al., 1998)) methods as implemented in SYBYL (Tripos
Associates, St. Louis, MO). The avian FPPS X-ray structure (Tarshis et al., 1994, 1996;
Protein Data Bank entries: 1FPS, 1UBV, 1UBX, 1UBY) was used as a template.
Modeling was carried out with SYBYL, versions 6.6 to 8.0 (Tripos Associates, St Louis,
Archives of Insect Biochemistry and Physiology
92
Archives of Insect Biochemistry and Physiology, June 2009
MO), on a Silicon Graphics (Mountain View, CA) Indigo2 or Fuel workstation. Energybased methods (AMBER force field) were used to refine side chain positions and to
remove bad torsions and bad atomic contacts while retaining the peptide backbone of
the structurally conserved regions (SCRs) of the template. The torsion angles of
peptide bonds were adjusted to 1807151 with minimal constraints (0.1 kJ) using the
AMBER4.1 or AMER7 force field. DMAPP, IPP, and Mg21 were manually docked into
the active site and the FPPS reaction was simulated in the active site. The coordinates
of allylic substrates were transferred from template models into the AgFPPS structure.
The positions of substrates were refined by constrained molecular dynamics using the
TRIPOS force field. Substrates were also docked into the wild-type avian FPPS X-ray
structure (1FPS) and the reaction was carried out in a similar manner. The dimer of
AgFPPS was built using avian FPPS dimer (PDB code: 1FPS) as a template and
structures were subjected to energy minimization.
RESULTS
Isolation of AgFPPS cDNA
A PCR cloning strategy was used to isolate the FPPS cDNA from the male boll weevil
cDNA library. Sequencing of the initial 560-bp fragment amplified by PCR using two
degenerate primers confirmed that it encoded a putative FPPS. Isolation of the fulllength cDNA was performed by PCR using sequence-specific oligonucleotide primers.
The full-length cDNA is 1,835 bp and contains a 1,317-bp open reading frame, 160-bp
50 untranslated region (50 -UTR), and 359-bp 30 UTR including a polyA tail (Fig. 1).
The open reading frame encodes a 438–amino acid protein with a calculated
molecular weight of 50 kDa.
Subsequently, FPPS cDNAs have been isolated from two other coleopterans;
Dendroctonus jeffreyi (AY966009) and Ips pini (AY953507). The boll weevil FPPS
sequence has a 79 and 66% identity to D. jeffreyi and I. pini FPPS sequences. AgFPPS
shares 49% amino acid identity with Bombyx mori, 48% with A. ipsilon, and 46% with D.
melanogaster and avian FPPSs (Fig. 2). Two aspartate-rich motifs and other conserved
regions found in other prenyltransferases also exist in A. grandis FPPS (Figs. 1, 2).
Gene Copy Number
A Southern blot analysis of genomic DNA yielded a single band indicating the presence
of a single FPPS gene in A. grandis (Fig. 3). Two alleles of the gene at sizes 8 and 10 kb
were detected in the insects used for the analysis and one of the insects was
heterozygous for the gene (Fig. 3, lane 8).
Confirmation of the FPPS Activity
In order to verify prenyltransferase activity isolated from A. grandis, the enzyme was
expressed as a His-tagged fusion protein in E. coli. The protein was purified under
native conditions using a His-tag affinity column and assayed for prenyltransferase
activity. The A. grandis protein showed significantly higher prenyltranferase activity
using substrates IPP and DMAPP compared to IPP as the only substrate (Table 1).
Reversed-phase HPLC analysis showed that the major product of the reaction was FPP,
and only minor amounts of GPP were detected (Fig. 4). The longer chain length
product GGPP was not detected under our experimental conditions.
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
93
Figure 1. Nucleotide and deduced amino acid sequence of A. grandis FPPS. Underlined regions are the
sequences from which the degenerate primers were designed for PCR amplification of AgFPPS gene. Two
aspartate-rich motifs are shown in bold.
Cross-Linking With DMS
In order to determine the quaternary structure of AgFPPS, cross-linking was
performed with DMS. The densitometry analysis of polyacrylamide gel of products
indicated that the monomeric form of enzyme (47 kDa) decreased, whereas the
dimeric form of the enzyme (103 kDa) increased both with a higher concentration of
DMS and with longer incubation time (Fig. 5). Although SDS-PAGE analysis indicated
the presence of additional bands, the only protein bands that were affected by DMS
concentration and incubation time are the ones corresponding to the monomeric and
dimeric forms of the enzyme, suggesting that AgFPPS is a dimer.
Molecular Model of AgFPPS
Based on the structure of crystallized avian FPPS, the three-dimensional structure of
AgFPPS was determined. Superposition of structure backbone atoms of the avian and
AgFPPS structures gave a root mean square (r.m.s.) difference of 0.703 Å, indicating
that the overall tertiary structures of both enzymes are very similar. The AgFPPS
primary sequence has a 70–amino acid N-terminal extension, which is not present in
the avian FPPS sequence. However, since there is not any experimental evidence of
cleavage of this sequence in the boll weevil, the whole AgFPPS sequence was used to
build a three-dimensional structure. The molecular structure of AgFPPS shows the
protein folded as a single domain, which was composed of all-antiparallel a-helices
Archives of Insect Biochemistry and Physiology
94
Archives of Insect Biochemistry and Physiology, June 2009
Figure 2. Alignment of the deduced amino acid sequence of FPPSs. AgFPPS is aligned with insect FPPSs
from I. pini, D. jeffreyi, B. mori, A. ipsilon, D. melanogaster, and avian FPPS. Identical residues are indicated by
an asterisk, and similar residues by a period. The boxes indicate five highly conserved regions.
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
males
M
1 2 3 4
95
females
5
6
7
8
9 10 M
10 kb
8 kb
6 kb
4 kb
Figure 3. Southern blot analysis of genomic DNA from individual male (lanes 1–5) and female (6–10) boll
weevils. M: DNA marker.
Table 1. Prenyltransferase Activity of the Purified Recombinant AgFPPS
Expression vector
pTrcHis2c without insert
PTrcHis2c with insert
IPP1DMAPP
IPP only
no enzyme
Prenyltransferase activity (dpm)
122
23,095
1,943
188
The enzyme reaction was performed using His-tag column purified proteins of E. coli expressing either pTrcHis2c
without insert or pTrcHis2c with AgFPPS cDNA insert.
connected by loops (Fig. 6). The overall folding pattern of two enzymes is highly
conserved except for the N-terminal region of AgFPPS (Fig. 6). The average positional
energy of AgFPPS is 0.06 kT, whereas the template crystal structure has an average
positional energy of 0.21 kT. The higher positional energy of AgFPPS is mostly due
to the N-terminal extension. When the N-terminal extension is omitted, the average
positional energy improves (0.12 kT).
Two aspartate-rich sequences that are highly conserved among isoprenyl diphosphate synthases and other catalytically important residues are located around the
major central solvent-accessible channel analogous to the active site cavity in avian
FPPS (Fig. 6). All six aspartate residues in FARM and SARM regions have the same
rotomers and the side chains of all the catalytic residues extend into the active site
cavity and superimpose with analogous residues in the avian FPPS structure except for
the side chain of Lys141 (Lys71 in avian FPPS). When the substrate DMAPP and two
Mg21s are docked into the AgFPPS structure, Lys141 side chain changes its position
and becomes like the analogous Lys in avian structure (Lys 71) (Fig. 6c).
In the AgFPPS and avian structures, DMAPP and two Mg21s occupy the equivalent
positions. DMAPP binds to the allylic substrate-binding site (FARM) as it has been
shown for avian FPPS crystal structure and is in position where diphosphate groups
can bind to the aspartate carboxyl oxygens through magnesium bridges. In addition to
Asp residues in the FARM, Arg196 (Arg126 in avian FPPS) is also in close proximity to
allylic substrate. This residue has been implicated to play an important role during
catalysis (Tarshis et al., 1996; Kellogg and Poulter, 1997).
Condensation of reactants in the active site was simulated, first forming GPP and
then FPP (data not shown). The water-accessible channels of both structures with GPP
bound to an allylic binding site indicate that the hydrocarbon tail is oriented down the
Archives of Insect Biochemistry and Physiology
96
Archives of Insect Biochemistry and Physiology, June 2009
50000
40000
DPM (+/- s.e.)
10000
5000
0
IPP
unused substrate
FPP
GPP
products
Figure 4. Product analysis of A. grandis FPPS. Products of the prenyltransferase assay were determined by
reversed-phase HPLC using [14C]IPP and DMAPP as substrates as described in Materials and Methods. The
retention times were 3–4 min for IPP (C5), 16 min for GPP (C10), and 20–21 min for FPP (C15).
(A)
1
2
3
4
5
6
kDa
200
116
97
66
45
31
log MW
(B)
2.5
2
1.5
1
0.5
0
y = -1.1044x + 2.4538
R² = 0.9742
0
0.2
0.4
0.6
distance
0.8
1
(C)
MW (kDa)
114
103
86
47
40
no DMS 5 µ g/30 min 10 µ g/30 min
23
24
7
14
100
58
12
51
11
5 µ g/1 h 10 µ g/1 h
10
14
18
38
26
27
7
6
39
16
Figure 5. Cross-linking with dimethyl suberimidate. The cross-linking experiment was carried out as
described in Materials and Methods. A: SDS-PAGE of expressed AgFPPS before and after reaction with
cross-linking reagent, DMS. Lane 1, molecular weight standard; lane 2, untreated enzyme (no DMS); lane 3,
enzyme treated with 5 mg DMS for 30 min; lane 4, enzyme treated with 10 mg DMS for 30 min; lane 5, enzyme
treated with 5 mg DMS for 1 h; lane 6, enzyme treated with 10 mg DMS for 1 h. B: Semilog plot of molecular
weight (MW) versus migration of A. C: Densitometry analysis of monomeric and dimeric forms of AgFPPS in
A. Values represent % of total protein. Treatment conditions with DMS are indicated at the top of each
column.
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
97
Figure 6. Structures of (A) A. grandis FPPS and (B) Avian FPPS (1FPS). The catalytic residues are shown in
space fill representation (AgFPPS: R196, R197, C182, F183, D187, D188, D191, D328, D329, D332, K141,
K285, K351, F324, F325; Avian FPPS: R126, R127, F112, F113, D117, D118, D121, D257, D258, D261, K71,
K214, K280, F253, F254) are shown in space fill. FARM and SARM regions are labeled. C: Two conformers
of side chain of Lys141 in AgFPPS. The amino group of the side chain moves from the left side to the top of
the panel upon binding of DMAPP.
hydrophobic pocket (Fig. 7a). The hydrocarbon tail of FPP also extends down the
hydrophobic pocket where further growth is restricted by the size of the binding
pocket (Fig. 7b). Interaction energy calculations with docked FPP ligand
using molecular dynamics revealed favorable interaction with both enzymes
(25379 kcal/mol and 322717 kcal/mol for avian and boll weevil enzymes,
respectively). Radius of gyration (ROG) indicates internal motions of the ligand in
the active site and deformation (DEF) indicates the relative position of a ligand with
respect to a reference position. In both FPPSs, the ROG and DEF averages and
standard deviations are similar (Table 2). ROG measurements indicate that avian FPPS
has a little more room for the FPP ligand. Based on these measurements, AgFPPS
holds the ligand slightly more tightly. In most FPPSs, the fifth and fourth amino acids
before the FARM are Phe Phe or Tyr Phe residues that are indicated to be involved in
the product chain length specificity of the enzyme (Tarshis et al., 1996; Ohnuma et al.,
1996a–c). In wild type avian enzyme (1FPS), these residues (F112, F113) are in
position to prevent elongation of the hydrocarbon tail (Fig. 7b). In AgFPPS, these
residues are Cys and Phe (at positions 182 and 183) and although the fifth amino acid
before FARM is not an aromatic amino acid residue, these residues are still in position
to restrict the growth of the hydrocarbon chain (Fig. 7b). Mutation of these residues in
the avian protein (1UBW, F112A, and F113S) with smaller side chain residues makes
the hydrophobic pocket larger and allows formation of longer products (Tarshis et al.,
1996). Although the presence of Cys residue in AgFPPS in place of Phe residue in
avian FPPS makes the pocket larger, it is still not wide enough to allow condensation
with another IPP. To show more detail, distances between FPP and these two residues
and also conserved Asp residue (Asp117 in avian and Asp197 in boll weevil) were
measured (Table 3). It should be noted that the model used has been globally
minimized only and no refinement of the active/binding site has been made. The
comparison of distances reveals that the AgFPPS pocket is even more restricted than
the avian pocket. Active site residues in close proximity to FPP were further examined
(Table 4). Differences of 0.1 to 4 Å are seen between the boll weevil and analogous
avian residues. Again we note that the boll weevil enzyme has been globally minimized:
No refinement of the active/binding site has been made. The alpha carbons of the
residues in Table 4 superimpose when two structures are overlaid (Fig. 7C), whereas
the side chains are mobile and occupy different locations in the FPP-bound enzymes
(for example, Lys280 [avian]/Lys351 [boll weevil]; Fig. 7C).
The AgFPPS dimer was built using the avian FPPS dimer (1FPS) as a template.
Again, except for the N-terminal segment of the AgFPPS, the structures are very
similar (Fig. 8a). The N-terminal extension of the AgFPPS does not interfere with
Archives of Insect Biochemistry and Physiology
98
Archives of Insect Biochemistry and Physiology, June 2009
Figure 7. Elongation of hydrocarbon tail in the active site. The substrate-binding site cavity of boll weevil
and avian FPPSs is shown with GPP (A) and FPP (B). Water-accessible channel surfaces are shown in green.
The enzyme has been sectioned to show the reactants in the binding/active sites of the enzyme. Residues
involved in chain length determination are shown (AgFPPS: Cys182, Phe183; avian FPPS: Phe112, Phe113).
C: Contains the superimposed structures of avian and boll weevil FPPSs showing active site lysine residues
and bound FPP (shown in red). Backbones were displayed as tubes (magenta: avian, orange: boll weevil).
Boll weevil residues are colored yellow.
Table 2. Radius of Gyration and Deformation Values (A˚) for Ligand FPP in Avian and Boll Weevil
FPPSs
Avian FPPS
AgFPPS
ROGf
ROGI
ROGw
DEFf
DEFI
DEFw
1.5570.20
1.5570.03
1.5470.20
1.5470.03
5.5470.12
5.3770.09
0.8370.10
0.6570.19
0.9170.40
0.5970.24
1.4870.27
1.4270.20
ROGf and DEFf, radius of gyration and deformation of first isoprene unit next to the diphosphate group of FPP,
respectively. L, last isoperene unit; w, whole ligand.
subunit interaction, as it is located outside of the putative subunit interface. The active
sites of each subunit are located close to the dimer interface and open to the outside.
The interaction surfaces of monomers in both structures contain complementary
hydrophobic patches (Fig. 8b). The total amount of hydrophobic areas buried
represents 27 and 26% of the total contact surface areas in avian and AgFPPSs,
respectively. Avian enzyme has slightly more hydrophobic contacts than does the boll
weevil enzyme. Electrostatic potential calculations of the subunit interfaces indicated
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
99
Table 3. Distances (A˚) Between a-Carbon of Selected Active Site Residues and FPPS Methyl Carbon
in Avian and Boll Weevil FPPS Structures
FPP
FPP
F112/C182
F113/F183
D117/D187
8.4/6.5
7.8/5.5
10.3/8.9
F112/C182
F113/F183
D117/D187
8.4/6.5
7.8/5.5
3.8/3.8
10.3/8.9
8.4/8.9
5.8/6.2
3.8/3.8
8.4/8.9
5.8/6.2
Residue numbers in avian/boll weevil enzymes, respectively.
Table 4. Distances (A˚) Between a-Carbon of Selected Active Site Residues in Avian and Boll Weevil
FPPS Structures
R126/R196 D117/D187 D121/D191 D188/D258 K214/K285 K271/K342 K280/K351
R126/R196
D117/D187
D121/D191
D188/D258
K214/K285
K271/K342
K280/K351
10.6/10.7
10.6/10.7
11.9/12.3
19.3/16.9
18.4/15.2
8.2/7.1
16.8/12.9
6.3/5.1
11.2/10.4
11.5/10.9
14.1/17.7
13.7/12.1
11.9/12.3
6.3/5.1
11.6/9.0
15.5/13.1
14.8/18.7
11.4/9.0
19.3/16.9
11.2/10.4
11.6/9.0
8.2/8.2
18.0/22.4
9.1/9.1
18.4/15.2
11.5/10.9
15.5/13.1
8.2/8.2
16.8/20.1
13.8/13.3
8.2/7.1
14.1/17.7
14.8/18.7
18.0/22.4
16.8/20.1
16.8/12.9
13.7/12.1
11.4/9.0
9.1/9.1
13.8/13.3
13.2/16.6
13.2/16.6
Residue numbers in avian FPPS/analogue residue in AgFPPS.
Figure 8. Left pair: A comparison of the avian and boll weevil FPPS dimers. The a-helices are shown as
tubes. One subunit of the dimer is shown in blue and the other one is in cyan. FARM and SARM are in space
fill and located on opposite walls of the binding cavity. Middle and right pairs: Hydrophobic potential of the
interacting surfaces of the FPPS homodimer. The monomers of FPPS have been rotated 901 on the y axis in
opposite directions to show the monomer interface surfaces. The hydrophobic potential is colored from
brown (most hydrophobic) to blue (least hydrophobic).
that 49% of the contact surfaces are positively charged in AgFPPS, which suggests
complimentary electrostatic forces. On the other hand, in avian FPPS only 9% of the
surfaces are positively charged, which indicates repulsive electrostatic forces between
subunits.
DISCUSSION
The isoprenoid pathway has been mostly studied in mammalian systems due to its
importance in the regulation of cholesterol production (Goldstein and Brown, 1990).
In insects, juvenile hormone has been the most studied product of the isoprenoid
pathway (Koyama et al., 1985). However, the importance of the isoprenoid pathway in
general cell function, cell signaling, development, and reproduction is becoming more
clear (Havel et al., 1992; Lai et al., 1998; Van Doren et al., 1998). FPP serves as a
Archives of Insect Biochemistry and Physiology
100
Archives of Insect Biochemistry and Physiology, June 2009
precursor to non-sterol isoprenoid pathway products of insects including dolichols,
ubiquinones, prenyl groups of certain proteins, and juvenile hormones in addition to
being the putative precursor to female-produced pheromones (Hedin et al., 1979).
Insect FPPSs characterized to date are mostly from lepidopterans and were studied in
the context of juvenile hormone biosynthesis (Castillo-Garcia and Couillaud, 1999;
Kikuchi et al., 2001; Cusson et al., 2006; Sen et al., 2007b).
We isolated the first coleopteran FPPS from A. grandis. The predicted amino acid
sequence has high sequence identity to other insect sequences (between 46 to 79%
identity) and to avian FPPS (46%) for which the crystal structure is known (Tarshis
et al., 1994, Fig. 2). The AgFPPS contains a 70-amino-acid-long N-terminal extension,
which is not found in the avian FPPS sequence. Similar N-terminal extensions are
found in other insect sequences (Fig. 2, Cusson et al., 2006) and also are observed in
plant (Cunillera et al., 1997) and mammalian FPPSs (Martin et al., 2007). The
N-terminal extension of AgFPPS displays the characteristics of mitochondrial-targeting
peptide and contains RXXS sequence, which is a consensus cleavage motif in
mitochondrial targeting peptides (Von Heijne et al., 1989, Fig. 2). Recent work has
demonstrated that the N-terminal extension of D. melanogaster FPPS targets the protein
to mitochondria (Martin et al., 2007), which suggests that N-terminal sequence of
AgFPPS and of other insects may act in a similar way.
Southern blot analyses of genomic DNA of A. grandis indicated that AgFPPS
is a single copy gene (Fig. 3). However, this does not rule out the possibility
that a single gene may encode more than one isoform. A survey of the D. melanogaster
genome database indicates that FPPS is a single copy gene that produces two
FPPS transcripts (Sen et al., 2007a). In A. thaliana, there are two FPPS genes encoding
three isoforms, one of which has an N-terminal mitochondrial targeting peptide
(Cunillera et al., 1996, 1997). Similarly, in mammals the single FPPS gene is
alternatively spliced giving rise to mitochondrial and cytosolic/peroxisomal isoforms
(Martin et al., 2007).
Insect sequences also exhibit differences in residues that function in product chain
length determination. The AgFPPS has Cys and Phe residues in place of Tyr-Phe or
Phe-Phe residues found at the fourth and fifth position before the FARM in animal
FPPS. In D. melanogaster, the two aromatic residues are conserved. Interestingly,
another coleopteran FPPS, that from D. jeffreyi, has Tyr and Val residues in place of
these two aromatic residues. In Lepidoptera, two different types of FPPSs were
identified (Cusson et al., 2006). In type-2 lepidopteran FPPSs, only one of the aromatic
residues was conserved as in the case of A. grandis. On the other hand, type-1
lepidopteran FPPS sequences have His and Gln residues in these positions. In
addition, in type-1 moth sequences, the typical DDxxD motif of FARM is replaced by
NDxxE. Although it has been suggested that these active site substitutions in
lepidopteran FPPS may be involved in production of ethyl-branched FPP precursors
of juvenile hormone (Cusson et al., 2006; Sen et al., 2007b), the exact role of these
variations in lepidopteran and in other insect FPPSs is not known.
The prenyltransferase isolated from A. grandis was shown to produce FPP as the
major product (Fig. 4). Molecular modeling studies also suggested that the final
product of the A. grandis enzyme is FPP. Putative fold of boll weevil FPPS indicated that
in spite of the evolutionary distance, boll weevil FPPS has a remarkable conformational
and functional homology to avian FPPS. The global fold is preserved. Except for the
N-terminal extension, the three-dimensional structure of AgFPPS is very similar to the
X-ray structure of avian FPPS (Fig. 6). The AgFPPS protein folds as a single domain
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
101
composed of anti-parallel a-helices, which surround a large central cavity. Improvement of the average positional energy of the AgFPPS structure (0.06 kT vs. 0.12 kT)
when the N-terminal extension is not included in the model, further suggests that
AgFPPS is transcribed as a pro-enzyme and N-terminal extension is cleaved. Critical
residues at the binding/active site are also conserved. The AgFPPS sequence contains
all five conserved regions found in prenyltransferases, including two Asp-rich motifs
(Figs. 1 and 2), and they are located around the hydrophobic central cavity as in the
case of avian FPPS (Fig. 6). Molecular dynamics simulations demonstrate that the
product FPP interacts in an analogous manner with both insect and avian enzymes.
The calculated interaction energies of substrates with enzyme suggest similar binding
for both structures. These observations leave little doubt that the insect enzyme will
have kinetic properties and product specificity similar to the avian enzyme. The major
difference between boll weevil and avian enzyme is the replacement of a phenylalanine
by a cysteine in the bottom of the product specificity pocket. The role of this
substitution is unknown. However, based on our current model of AgFPPS, the active
site cavity is still restricted to prevent formation of longer products (Fig. 7b) and the
product specificity of the AgFPPS also results from steric constraints of the binding site,
similar to avian FPPS. The location of a reactive cysteine residue provides a unique
opportunity to gain insights into isoprenoid-synthesizing enzymes. The physicochemical properties of this site can be probed by thio-reactive reagents of varying polarity
and bulk. Under favorable circumstances, the modified enzyme can also be assayed for
kinetic properties and product specificity. The cysteine can also be used to insert
reporter groups such as fluorophores into the specificity pocket.
Short-chain E-prenyltransferases require divalent metal ions such as Mg21 or Mn21
for catalytic activity and they have a homodimeric structure (Ogura and Koyama,
1998). The only known exception to this is the GPPS from peppermint, which
functions as a heterodimer (Burke et al., 1999). The large subunit of this GPPS
shows a high level of sequence similarity with other prenyltransferases and contains
aspartate-rich motifs. The small subunit lacks these motifs and has a lower level of
sequence similarity to other prenyltransferases. It has been suggested that a small
subunit functions in chain length determination (Burke and Croteau, 2002a). On the
other hand, other plant GPPSs are homodimers (Burke and Croteau, 2002b). Insect
GPPS from Ips pini also has been shown to be active when no heteromeric subunit is
present (Gilg et al., 2005). Recent studies with type-1 and type-2 lepidopteran FPPSs
indicated that type-1 FPPSs were catalytically inactive and type-1 and type-2 FPPSs can
form a heteromer that enhances the activity (Sen et al., 2007b). The cross-linking
experiment with recombinant purified AgFPPS gave strong evidence that the
functional form of AgFPPS is a homodimer similar to the majority of the other FPPSs
(Fig. 5). The model of the AgFPPS dimer indicates that dimer formation is an
energetically favorable process, supporting a homodimeric structure of AgFPPS. In the
dimer structure, the active sites are not hindered and open to the outside (Fig. 8) as in
the case of avian FPPS. The hydrophobic surface interfaces of monomers are also
compatible in both structures (Fig. 8).
LITERATURE CITED
Burke HR. 1959. Morphology of the reproductive systems of the cotton boll weevil (Coleoptera,
Curculionidae). Ann Entomol Soc Am 52:287–294.
Archives of Insect Biochemistry and Physiology
102
Archives of Insect Biochemistry and Physiology, June 2009
Burke C, Croteau R. 2002a. Interaction with the small subunit of geranyl diphosphate synthase
modified the chain length specificity of geranylgeranyl diphosphate synthase to produce
geranyl diphosphate. J Biol Chem 277:3141–3149.
Burke C, Croteau R. 2002b. Geranyl diphosphate synthase from Abies grandis: cDNA isolation,
functional expression and characterization. Arch Biochem Biophys 405:130–136.
Burke CC, Wildung MR, Croteau R. 1999. Geranyl diphosphate synthase: cloning, expression
and characterization of this prenyltransferase as a heterodimer. Proc Natl Acad Sci USA
96:13062–13067.
Castillo-Gracia M, Couillaud F. 1999. Molecular cloning and tissue expression of an insect
farnesyl diphosphate synthase. Eur J Biochem 262:365–370.
Chen A, Kroon PA, Pouter CD. 1994. Isoprenyl diphosphate synthases: Protein sequence
comparisons, a phylogentic tree, and predictions of secondary structure. Prot Sci
3:600–607.
Cunillera N, Arro M, Delourme D, Karst F, Boronat A, Ferrer A. 1996. Arabidopsis thaliana
contains two differentially expressed farnesyl-diphosphate synthase genes. J Biol Chem
271:7774–7780.
Cunillera N, Boronat A, Ferrer A. 1997. The Arabidopsis thaliana FPS1 gene generates a novel
mRNA that encodes a mitochondrial farnesyl-diphosphate synthase isoform. J Biol Chem
272:15381–15388.
Cusson M, Béliveau C, Sen SE, Vandermoten S, Rutledge RG, Stewart D, Francis F, Haubruge E,
Rehse P, Huggins DJ, Dowling AP, Grant GH. 2006. Characterization and tissue-specific
expression of two lepidopteran farnesyl diphosphate synthase homologs: implications for
the biosynthesis of ethyl-substituted juvenile hormones. Proteins 65:742–758.
Davies GE, Stark GR. 1970. Use of dimethyl suberimidate, a cross-linking reagent, in studying
the subunit structure of oligomeric proteins. Proc Natl Acad Sci USA 66:651–656.
Fujii H, Koyama T, Ogura K. 1982. Efficient enzymatic hydrolysis of polyprenyl pyrophosphates. Biochim Biophys Acta 712:716–718.
Gabelli SB, McLellan JS, Montalvetti A, Oldfield E, Docampo R, Amzel LM. 2006. Structure and
mechanism of the farnesyl diphosphate synthase from Trypanosoma cruzi: implications for
drug design. Proteins 62:80–88.
Gilg AB, Bearfield JC, Tittiger C, Welch WH, Blomquist GJ. 2005. Isolation and functional
expression of an animal geranyl diphosphate synthase and its role in bark beetle
pheromone biosynthesis. Proc Natl Acad Sci USA 102:9760–9765
Goldstein JL, Brown MS. 1990. Regulation of the mevalonate pathway. Nature 343:
425–430.
Havel CM, Fisher P, Watson JA. 1992. Isoprenoid synthesis in embriyonic Drosophila cells:
prenylated protein profile and prenyl group usage. Arch Biochem Biophys 295:410–420.
Hedin PA, McKibben GH, Mitchell EB, Johnson WL. 1979. Identification and field evaluation of
the components comprising the sex pheromone of the female boll weevil. J Chem Ecol
5:617–627.
Hosfield DJ, Zhang Y, Dougan DR, Broun A, Tari LW, Swanson RV, Finn J. 2004. Structural
basis for bisphosphonate-mediated inhibition of isoprenoid biosynthesis. J Biol Chem
279:8526–8529.
Jaroszewski L, Rychlewski L, Zhang B, Godzik A. 1998. Fold prediction by a hierarchy of
sequence, threading, and modeling methods. Prot Sci 7:1431–1440.
Kellogg BA, Poulter CD. 1997. Chain elongation in the isoprenoid biosynthetic pathway. Curr
Opin Chem Biol 1:570–578.
Kikuchi K, Hirai M, Shiotsuki T. 2001. Molecular cloning and tissue distribution of
farnesyl pyrophophate synthase from the silkworm Bombyx mori. J Insect Biotechnol Sericol
70:167–172.
Archives of Insect Biochemistry and Physiology
Boll Weevil Farnesyl Diphosphate Synthase
103
Koyama T, Matsubara M, Ogura K. 1985. Isoprenoid enzyme systems of silkworm. II.
Formation of the juvenile hormone skeletons by Farnesyl pyrophosphate synthase II.
J Biochem 98:457–463.
Koyama T, Obata S, Osabe M, Takeshita A, Yokoyama K, Uchita M, Nishino T, Ogura K. 1993.
Thermostable farnesyl diphosphate synthase of Bacillus stearothermophilus: molecular
cloning, sequence determination, overproduction, and purification. J. Biochem. (Tokyo)
113:355–363.
Laemmli UK. 1970. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227:680–685.
Lai C, McMahon R, Young C, Mackay TF, Langley CH. 1998. Quemao, a Drosphila bristle locus,
encodes geranylgeranyl pyrophosphate synthase. Genetics 149:1051–1061.
Martin D, Piulachs MD, Cunillera N, Ferrer A, Belles X. 2007. Mitochondrial targeting of
farnesyl diphosphate synthase is a widespread phenomenon in eukaryotes. Biochim
Biophys Acta 1773:419–426.
Mitlin N, Hedin PA. 1974. Biosynthesis of grandlure, the pheromone of the boll
weevil, Anthonomus grandis, from acetate, mevalonate and glucose. J Insect Physiol
20:1825–1831.
Ogura K, Koyama T. 1998. Enzymatic aspects of isoprenoid chain elongation. Chem Rev
98:1263–1276.
Ogura K, Toyama T, Sagami H. 1997. Polyprenyl diphosphate synthases. In: Bittman R, editor.
Subcellular biochemistry. New York: Plenum Press. p 57–88.
Ohnuma S-I, Hirooka K, Hemmi H, Ishida C, Ohto C, Nishito T. 1996a. Conversion of product
specificity of archaebacterial geranylgeranyl diphosphate synthase. J Biol Chem
271:18831–18837.
Ohnuma S-I, Narita K, Nakazawa T, Hemmi H, Hallberg A-M, Koyama T, Ogura K, Nishito T.
1996b. Conversion from farnesyl diphosphate synthase to geranylgeranyl diphosphate
synthase by random chemical mutagenesis. J Biol Chem 271:10087–10095.
Ohnuma S-I, Narita K, Nakazawa T, Ishida C, Takeuchi Y, Ohto C, Nishito T. 1996c. A role of
the amino acid residue located on the fifth position before the first Aspartate-rich motif of
farnesyl diphosphate synthase on determination of the final product. J Biol Chem
271:30748–30754.
Ohnuma S, Hirooka K, Tsuruoka N, Yano M, Ohto C, Nakane N, Nishino T. 1998. A pathway
where polyprenyl diphosphate elongates in prenyltransferase. J Biol Chem 273:
26705–26713.
Okada K, Suzuki K, Kamiya Y, Zhu X, Fujisaki S, Nishimura Y, Nishino T, Nakagawa T,
Kawamukai M, Matsuda H. 1996. Polyprenyl diphosphate synthase essentially defines the
length of the side chain of ubiquinone. Biochim Biophys Acta 1302:217–223.
Rondeau J-M, Bitsch F, Bourgier E, Geiser M, Hemmig R, Kroemer M, Lehmann S, Ramage P,
Rieffel S, Strauss A, Green JR, Jahnke W. 2006. Structural basis for the exceptional in vivo
efficacy of bisphosphonate drugs. Chem Med Chem 1:267–273.
Sato M, Sato K, Nishikawa S-I, Hirata A, Kato J-I, Nakano A. 1999. The yeast RER2 gene,
identified by endoplasmic reticulum protein localization mutations, encodes cis-prenyltransferase, a key enzyme in dolichol synthesis. Mol Cell Biol 19:471–483.
Schooley DA, Baker F. 1985. Juvenile hormone biosynthesis. In: Kerkut GA, Gilbert LI, editors.
Comprehensive insect physiology biochemistry and pharmacology. Permagon Press,
Oxford, p 363–389.
Sen SE, Trobaugh C, Béliveau C, Richard T, Cusson M. 2007a. Cloning, expression and
characterization of a dipteran farnesyl diphosphate synthase. Insect Biochem Mol Biol
37:1198–1206.
Archives of Insect Biochemistry and Physiology
104
Archives of Insect Biochemistry and Physiology, June 2009
Sen SE, Cusson M, Trobaugh C, Béliveau C, Richard T, Graham W, Mimms A, Roberts G. 2007b.
Purification, properties and heteromeric association of type-1 and type-2 lepidopteran
farnesyl diphosphate synthases. Insect Biochem Mol Biol 37:819–828.
Srinivasan N, Blundell TL. 1993. An evaluation of the performance of an automated procedure
for comparative modeling of protein tertiary structure. Protein Eng 6:501–512.
Taban AH, Fu J, Blake J, Awano A, Tittiger C, Blomquist GJ. 2006. Site of pheromone
biosynthesis and isolation of HMG-CoA reductase cDNA in the cotton boll weevil,
Anthonomus grandis. Arch Insect Biochem Physiol 62:153–163.
Tarshis LC, Yan M, Pouther CD, Sacchettini JC. 1994. Crystal structure of recombinant farnesyl
diphosphate synthase at 2.6-Å resolution. Biochemistry 33:10871–10877.
Tarshis LC, Proteau P, Kellogg BA, Sacchettini JC, Poulter CD. 1996. Regulation of product
chain length by isoprenyl diphosphate synthases. Proc Natl Acad Sci USA 93:15018–15023.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighing, positions-specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.
Tumlinson JH, Hardee DD, Gueldner RC, Thomson AC, Hedin PA. 1969. Sex pheromones
produced by male boll weevil: isolation, identification and synthesis. Science 166:
1010–1012.
Van Doren M, Broihier HT, Moore LA, Lehmann R. 1998. HMG-CoA reductase guides
migrating primordial germ cells. Nature 396:466–469.
Von Heijne G, Steppuhn J, Herrmann RG. 1989. Domain structure of mitochondrial and
chloroplast targeting peptides. Eur J Biochem 180:535–545.
Wang K, Ohnuma S. 1999. Chain-length determination mechanism of isoprenyl diphosphate
synthases and implications for molecular evolution. Trends Biochem Sci 24:445–451.
Zhang D, Poulter CD. 1993. Analysis and purification of phosphorylated isoprenoids by reversephase HPLC. Anal Biochem 213:356–361.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 204 Кб
Теги
weevil, diphosphate, isolation, characterization, grandis, boll, anthonomus, farnesyl, cotton, synthase
1/--страниц
Пожаловаться на содержимое документа