close

Вход

Забыли?

вход по аккаунту

?

MOLECULAR CHARACTERIZATIONS OF TWO CYTOCHROME P450 GENES ENCODING CYP6A41 AND CYP6EK1 FROM THE ORIENTAL FRUIT FLY Bactrocera dorsalis DIPTERATEPHRITIDAE.

код для вставкиСкачать
A r t i c l e
MOLECULAR
CHARACTERIZATIONS OF TWO
CYTOCHROME P450 GENES
ENCODING CYP6A41 AND
CYP6EK1 FROM THE ORIENTAL
FRUIT FLY, Bactrocera dorsalis
(DIPTERA: TEPHRITIDAE)
Yong Huang, Hong-Bo Jiang, Guang-Mao Shen,
Wei Dou, and Jin-Jun Wang
Key Laboratory of Entomology and Pest Control Engineering, College of
Plant Protection, Southwest University, Chongqing, P. R. China
Two P450 genes encoding CYP6A41 and CYP6EK1 were cloned from the
oriental fruit fly using polymerase chain reaction (PCR) and rapid
amplification of cDNA ends (RACE) techniques. CYP6A41 and CYP6EK1
contained open reading frames of 1,530 and 1,524 nucleotides that encode
510 and 508 amino acid residues, respectively. The putative proteins
shared 44% identity with each other. Phylogenetic analysis showed that
CYP6A41 and CYP6EK1 were most closely related to Ceratitis capitata
CYP6A10 and CYP6A subfamily. Expression patterns of the two genes in
different geographical populations (Yunnan, Hainan, Dongguang, and
Guangzhou), developmental stages (eggs, larvae, pupae, and adults), and
tissues (midguts, fat bodies, and Malpighian tubules) were analyzed by
real-time quantitative PCR (RT-qPCR) methods. The results showed that
the expression levels of CYP6EK1 were significantly different among the
four populations, but were not different for CYP6A41. Both the expressions
of CYP6A41 and CYP6EK1 were development specific and had
Grant sponsor: National Basic Research Program of China; Grant number: 2009CB125903, 2009CB119200;
Grant sponsor: Natural Science Foundation of Chongqing; Grant number: CSTC2009BA1042, CSTCJJA80020;
Grant sponsor: Program for Changjiang Scholars and Innovative Research Team in University; Grant number:
IRT0976; Grant sponsor: the earmarked fund for Modern Agro-industry (Citrus) Technology Research System
of China.
Correspondence to: Jin-Jun Wang, College of Plant Protection, Southwest University, Chongqing 400715, P. R.
China. E-mail: jjwang7008@yahoo.com
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 79, No. 1, 31–46 (2012)
Published online in Wiley Online Library (wileyonlinelibrary.com).
C 2011 Wiley Periodicals, Inc. DOI: 10.1002/arch.21003
32
r
Archives of Insect Biochemistry and Physiology, January 2012
significantly higher levels in the larval stage. The expression of CYP6A41
did not vary among the midgut, fat body, or Malpighian tubules; however,
CYP6EK1 expression was higher in the Malpighian tubules. The results
suggest that CYP6A41 and CYP6EK1 might be involved in detoxification
of xenobiotic compounds that were harmful to larval flies or development.
Moreover, high expression of CYP6EK1 in the Malpighian tubules also
C 2011 Wiley Periodicals, Inc.
implied participation in detoxification. Keywords: Bactrocera dorsalis; P450; cloning; expression profiles; RT-qPCR
INTRODUCTION
Oriental fruit fly, Bactrocera dorsalis (Hendel), is one of the most economically important
fruit fly pests in East Asia and the Pacific, where it is a serious pest of a wide range of
tropical, subtropical, and temperate fruit crops (Drew and Hancock, 1994; Clarke et al.,
2005). The infestation serves as an important reason for economic loss, and becomes a
major barrier to trade and economic development. Many previous studies reported that
the damage caused by the oriental fruit fly consists both of punctures of the host tissue
during oviposition and feeding on the fruit pulp by the developing larvae (Shi et al.,
2005). As the number of female flies is the major concern in pest management, it is
crucial to develop a novel control technique to target the female flies (Chen et al., 2008,
2010). In recent years, monitoring of the oriental fruit fly in the field has indicated that
unreasonable use of chemical insecticides has resulted in serious insecticide resistance
in some areas (Hsu et al., 2004, 2008). Various biochemical mechanisms can confer
resistance to insecticides and more than one could be present in the same insect species,
including monooxygenases (cytochrome P450), esterase, and glutathione S-transferase
mediated resistance, as well as decreased cuticular insecticide penetration, and target
site insensitivity mechanisms (Yang et al., 2004; Sun et al., 2006; Penilla et al., 2007).
Nevertheless, few researches have investigated the resistance system in B. dorsalis. As the
major problem to effectively control B. dorsalis in the field, a thorough understanding of
resistance mechanism at the molecular level is needed.
Cytochrome P450 monooxygenases (P450s) comprise a large superfamily of proteins
that are found in virtually all living organisms and play a key role in the detoxification and
metabolism of a diverse array of substrates. Most eukaryotic P450s are heme-dependent
microsomal enzymes that, coupled with NADPH-dependent P450 reductases, constitute
one of the primary enzymes for phase I detoxification of xenobiotics encountered by
organisms (Feyeseisen, 2005). Genome sequencing projects have identified a large number of P450 sequences in eukaryotes (Tijet et al., 2001; Strode et al., 2008). Many P450s
mediated resistance, represented by ∼48–164 genes in insect genomes (Feyeseisen, 2005;
Scott, 2008). Moreover, more than half of the P450 genes belong to either CYP4 or CYP6
families in many species such as the fruit fly, Drosophila melanogaster, and the mosquito,
Anopheles gambiae (Tijet et al., 2001; Ranson et al., 2002).
The regulation of insect P450 gene expression appears to be quite complex. Gene expression profiling in different tissues, developmental stages, and geographic populations
using real-time quantitative polymerase chain reaction (RT-qPCR) methods provide a way
to understanding the physiological roles of insect P450s. To date, the expression patterns
of many insect P450 genes have been documented, especially in CYP6 family. For instance,
various researches have showed the tissue-specific expression of D. melanogaster CYP6G1,
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
33
Plutella xylostella CYP6BG1, Nilaparvata lugens CYP6CS1 and CYP6CW1 (Chung et al., 2007;
Bautista et al., 2009; Yang et al., 2010). Moreover, the developmental stage specific expression of Papilio polyxenes CYP6B, Culex pipiens pallens CYP6F1, Bombyx mori CYP6AB4,
Musca domestica CYP6A36 and CYP6A37 (Harrison et al., 2001; Gong et al., 2005; Zhu
et al., 2008; Yamamoto et al., 2010) have also been reported. The potential role of P450
genes in the insects has been predicted and justified by these experiments. In the present
study, we reported the cloning and characterization of two new P450 genes, CYP6A41
and CYP6EK1, from B. dorsalis. Furthermore, we determined their expression profiles in
different populations, developmental stages, and tissues using RT-qPCR methods. The
study aimed to identify the expression patterns in different population, developmental
stages, and tissues, and thus predicts the potentially involved functions of P450 genes in
B. dorsalis by analogizing with the published P450s in other insects.
MATERIALS AND METHODS
Insects
Four populations of B. dorsalis were collected from fields in Yunnan (YN) Province, Hainan
(HN) Province, and the districts of Dongguang (DG) and Guangzhou (GZ) of Guangdong Province, China, in 2008. The insects were cultured separately in the Key Laboratory
of Entomology and Pest Control Engineering, Southwest University, Chongqing, China.
Adult flies were maintained in cages at 27 ± 0.5◦ C under a 14 h light: 12 h dark photoperiod on artificial diets of 2.5% yeast extract, 7.5% sugar, 2.5% honey, 0.5% agar, and 87%
H2 O. Eclosed larvae were cultured by periodic transfer to bananas. These four populations showed different susceptibilities to malathion, avermectin, and beta-cypermethrin
based on bioassay (Hu et al., 2011).
RNA Isolation and First-Strand cDNA Synthesis
Total RNA used for cloning the full length of P450 cDNAs was extracted with RNAeasy
Micro Kit (Qiagen, Hilden, Germany) from female adults of HN population according
to the manufacture’s instruction. Moreover, to explore the difference between the four
populations, whole-body extracts from individual female adult (10 mg) of four field
populations were prepared for RT-qPCR and treated as one sample. The insects from
HN population were also used to analyze the expression during various developmental
stages. In the tissue-specific experiment, specific tissue (midgut, fat body, and Malpighian
tubule) samples were prepared by dissecting female adults from the HN population using
dissection needle in physiological saline solution under a stereomicroscope (Olympus
SZX12, Tokyo, Japan). Tissues from 10 adults were homogenized with 1 ml RNAeasy Micro
Kit in the glass homogenizer. Triple replications were run for all experiment (populations,
stages, and tissues), respectively.
RNA quantity was checked by measuring the absorbance at 260 nm using a Nanovue
UV-Vis spectrophotometer (GE Healthcare, Fairfield, CT) and the quality was assessed
at the absorbance ratio of OD260/280 . The RNA integrity was further confirmed by 1%
formaldehyde agarose gel electrophoresis. The first-strand cDNA was synthesized using
PrimeScriptTM 1st Strand cDNA Synthesis Kit (Takara, Shiga, Japan). The nucleotide
sequences of degenerate primers used to amplify the cDNA fragments were presented in
Table 1.
Archives of Insect Biochemistry and Physiology
34
r
Archives of Insect Biochemistry and Physiology, January 2012
Table 1. Primers Used for Cloning
Experiments
Degenerate PCR
3 RACE
5 RACE
Full-length confirmation
Primer names and sequences (5 to 3 )
Product length (bp)
P450-S: GAYACNTTYATGTTYRARGGN
P450-A: GCRAAYTTYTGNCCDATRCARTT
A41-S1: CATTCCGTCAGATGGGTAGGCG
A41-S2: AATCGGAGGACGGTCAGGCTATG
EK1-S1: AAGGTATTCTCGCAGCGTCGGC
EK1-S2: ACAGTCGTTTGTGTTCTTCCTCGCC
A41-A1: AGCCTGACCGTCCTCCGATTTC
A41-A2: TGAACACACGCCTACCCATCTGAC
EK1-A1: TGTGCTAACATCATTTGGCGTCATT
EK1-A2: GCCGACGCTGCGAGAATACCTT
A41-FLS: CATTTGCTTTGGACGGAG
A41-FLA: CAAATGTAATCAATCTTCAAC
EK1-FLS: GACGTTTTTATCACTTTGG
EK1-FLA: CTTTAAGAGCTAGCGATAC
450
1,071
831
1,020
778
931
701
1,037
948
1,643
1,524
Cloning of the Full-Length P450 cDNAs
All the degenerate PCR reactions were conducted in a Tgradient PCR Thermal Cycler
(Biometra, Goettingen, Germany) using rTaqTM polymerase (Takara). The PCR program
included an initial denaturation step of 3 min at 94◦ C and then 35 cycles of 94◦ C for
30 sec, 55◦ C for 30 sec, and 72◦ C for 30 sec, with a final extension of 10 min at 72◦ C.
After purification by agarose gel electrophoresis and recycling, the amplified products
were cloned into a pGEM-T easy vector and sequenced (Invitrogen Life Technologies,
Carlsbad, CA).
To obtain the full length of P450 cDNAs, 5 and 3 rapid amplification of
cDNA ends (RACE) analyses were performed by nested PCR with two gene-specific
primers (GSPs) and two oligo (dT) primers UPM and NUP (UPM: CTAATACGACTCA
CTATAGGGCAAGCAGTGGTATCAACGCAGAGT, NUP: AAGCAGTGGTATCAACGC
AGAGT). UPM and NUP were used as sense primers in 5 RACE and antisense primers
in 3 RACE. GSPs (Table 1) used in RACE were designed based on the cDNA fragments
derived from the degenerate PCR. This was performed with the following conditions: an
initial denaturation at 94◦ C for 3 min, followed by 35 cycles of 94◦ C for 30 sec, 67◦ C for
30 sec, and 72◦ C for 1 min, with a final extension at 72◦ C for 10 min.
Based on the 5 untranslated regions (UTR) and 3 UTR of the cloned cDNA fragments obtained from the 5 RACE and 3 RACE, a pair of primers was designed to amplify
the complete open reading frames (ORF) of the two P450 genes (Table 1). The PCR
reaction to confirm the full-length cDNA was performed under the following conditions:
an initial denaturation at 94◦ C for 3 min, followed by 35 cycles of 94◦ C for 30 sec, 50◦ C
for 30 sec, and 72◦ C for 2 min, with a final extension at 72◦ C for 10 min.
Sequence Analysis and Phylogenetic Tree Construction
Sequences were edited with DNAMAN (DNAMAN 5.2.2, Lynnon BioSoft, PointeClaire, Quebec, Canada). Searching for similar sequences was performed using
BLASTP in the nonredundant protein sequences (nr) database of the NCBI website
(http://www.ncbi.nlm.nih.gov). N-terminal transmembrane anchor of the deduced
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
35
proteins was predicted by the TMHMM Server version 1.0 (http://www.cbs.dtu.dk/
services/TMHMM/). ExPASy Proteomics Server (http://cn.expasy.org/tools/pi_tool.html)
was used to compute isoelectric point and molecular weight of the deduced protein
sequences. The phylogenetic tree was constructed by Clustal X 2.0 (Larkin et al., 2007)
and MEGA 4 (Tamura et al., 2007) using the Neighbor-Joining (NJ) method. CYP18A1
from D. melanogaster was used as outgroup. The branch support of the NJ phylogenetic
tree was estimated by the bootstrap test with 1,000 replicates.
RT-qPCR of CYP6A41 and CYP6EK1 mRNA
RT-qPCR was conducted on a Stratagene Mx3000P System using power SYBR Green Mix
with ROX (Takara). The two-step RT-qPCR procedure was run with PrimeScriptTM 1st
Strand cDNA Synthesis Kit for RT-qPCR (Takara) to generate cDNA. Each reaction was
run in a 25 μl volume, which contained 2 μl cDNA templates, 12.5 μl SYBR Green Mix,
1 μl each primer, 0.5 μl ROX, and 8 μl double distilled water. All the reactions were
performed as: 95◦ C for 30 sec, 40 cycles of 95◦ C for 5 sec, 60◦ C for 30 sec. To verify
the specificity of the amplicon for each primer pair, a dissociation curve was constructed
from 60 to 95◦ C at the end of each RT-qPCR run. Each experiment was analyzed in three
biological replicates (three different samples) with two technical replications.
A series of (1/10, 1/50, 1/250, 1/1,250, and 1/2,500) diluted cDNA samples was
employed to construct the standard curve and calculate the efficiency of amplification.
The cycle threshold (Ct) was defined as the cycle at which the fluorescence from a sample
crosses the threshold. Relative expression levels were calculated by the comparative Ct
method and were expressed as 2−Ct (Livak and Schmittgen, 2001). Thus, by using the
cycle difference Ct as the exponent, the precise difference in starting template can be
calculated. The relative quantities were normalized to the stable reference genes evaluated
in our previous study (Shen et al., 2010). As a result, α-tublin (Table 2) was used as the
reference in the different tissues experiment. The geometric average of the most stable
references, 18S and α-tublin in the developmental stage series, and 18s and RPL13 in the
different geographical populations selected by geNorm, was used as an internal control.
Relative fold expression was calibrated against a single sample. When testing the mRNA
expression among different populations, the relative fold expression of two genes in each
population was compared with that in HN population. Similarly, when testing the mRNA
expression among different developmental stages or tissues, the relative fold expression
Table 2. Primers Used for Quantitative Real-Time Polymerase Chain Reaction
Genes
GenBank
accession number
CYP6A41
HQ257452
CYP6EK1
HQ257457
α-tubulin
GU269902
18S
AF033944
RPL13
HM236866
Primer names and sequences (5 to 3 )
A41QS: CACTCTCAGGGCATCTCTTTG
A41QA: GAGAATCGCGCACTTCTAATG
EK1QS: AACTTACGCCGACTTTTACATC
EK1QA: GGTTCGTTCAGACTATTGCACTC
α-tubS: CGCATTCATGGTTGATAACG
α-tubA: GGGCACCAAGTTAGTCTGGA
18S-S: GCGAGAGGTGAAATTCTTGG
18S-A: CGGGTAAGCGACTGAGAGAG
RPL13S: CAGTTGTACGTTGCGAGGAATT
RPL13A: TCTTGATGGAGCACGGGAG
R2 : coefficient of determination.
Archives of Insect Biochemistry and Physiology
Product
PCR
length (bp) efficiencies (%)
R2
195
101.4
0.998
226
114.2
0.992
184
104.8
0.994
191
100.3
0.999
134
110
0.923
36
r
Archives of Insect Biochemistry and Physiology, January 2012
of two genes was compared with that in eggs or fat body, respectively. All the relative
fold expressions were calculated following the MxPro Manual of Mxpro-Mx3000P version
3.20 (Stratagene, Agilent, Santa Clare, CA). Briefly, normalized gene of interest levels
were first calculated for each normalizer separately, and then the geometric mean of all
normalized values was calculated and used for relative fold expression calculations.
Statistical Analysis
Differences in expression levels among the different geographical populations, developmental stages, and tissues were statistically analyzed using analysis of variance (ANOVA),
and the means were separated by Duncan’s multiple range test for significance (P = 0.05)
using SPSS 12.0 for Windows.
RESULTS
cDNA Cloning and Characterization
Total RNA concentrations ranged from 113 to 1,834 ng/μl and the A260:A280 values ranged from 2.161 to 2.281, indicating the high quantity and quality of the total RNA. The 1% agarose gel electrophoresis showed that the total RNA retained its
integrity.
P450 cDNA sequences were identified using a reverse transcription PCR approach
with degenerate primers. Two partial sequences with high homology to P450 superfamily
were obtained. Longer sequences extending into the 5 UTR and encompassing the 3
UTR were obtained by RACE-PCR using GSPs. As a result, we cloned two P450 full-length
cDNA sequences. These two cDNAs were clearly assigned to the P450 superfamily, judged
by their high sequence similarities (Figs. 1 and 2). The sequences were submitted to the
P450 nomenclature committee and classified to the CYP6 family, which were qualified
as CYP6A41 and CYP6EK1. The GenBank accession numbers of CYP6A41 and CYP6EK1
were HQ257452 and HQ257457, respectively.
The CYP6A41 cDNA contained a 55 bp 5 UTR, a 1,530 bp ORF encoding 510
amino acid residues, and a 157 bp 3 UTR. This extended 3 UTR had a single consensus polyadenylation signal sequence (AATAAA) upstream from a 26 bp poly (A) tract.
The CYP6EK1 cDNA contained a 266 bp 5 UTR, a 1,524 bp ORF encoding 508 amino
acid residues, and a 158 bp 3 UTR. This extended 3 UTR also had a single consensus polyadenylation signal sequence (AATAAA) upstream from a 20 bp poly (A) tract.
Moreover, the two sequences had different stop codon, TGA and TAA, for CYP6A41 and
CYP6EK1, respectively.
The putative proteins of CYP6A41 and CYP6EK1 had a predicted molecular weight
of 58.63 and 57.85 kDa with the theoretical isoelectric points of 8.29 and 9.18, respectively. The two CYP6 genes were both typical microsomal P450s; there were hydrophobic
transmembrane regions in the N-terminals of the two deduced amino acid sequences
(Figs. 1 and 2). The deduced amino acid sequences of these two P450 genes exhibited the
typical conserved P450 motifs, including the conserved residues AGxxT in the Helix-I (hydrogen bonding believed to create an oxygen-binding pocket); the absolutely conserved
ExxR motif found in the Helix-K (hydrogen bonding); the CYP6 cDNAs specific region
(PxxFxP); and the heme-binding domain (PFxxGxRxCxG/A).
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
37
Figure 1. Nucleotide and deduced amino acid sequence of CYP6A41 cDNA from Bactrocera dorsalis. The
transmembrane region in the N-terminal anchor is marked with double underline. Regions of conservation
associated with the helix I, helix K, CYP6 family specific region, and heme-binding region are shaded. Putative
polyadenylation signal (AATAAA) in the 3 -untranslated sequence with underline.
Phylogenetic Relationship with Other CYP Members
A BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi) search of GenBank revealed that
both two P450 genes were closest in amino acid sequences to P450s in CYP6 family.
A search indicated that CYP6A41 exhibited the greatest identity with Ceratitis capitata
Archives of Insect Biochemistry and Physiology
38
r
Archives of Insect Biochemistry and Physiology, January 2012
Figure 2. Nucleotide and deduced amino acid sequence of CYP6EK1 cDNA from B. dorsalis. The transmembrane region in the N-terminal anchor is marked with double underline. Regions of conservation associated with
the helix I, helix K, CYP6 family specific region, and heme-binding region are shaded. Putative polyadenylation
signal (AATAAA) in the 3 -untranslated sequence with underline.
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
39
Figure 3. Phylogenetic relationship among CYP6A41, CYP6EK1, and other insect CYP6 genes. The phylogenetic
tree was inferred using the Neighbor-Joining method. Numbers above the branches were bootstrap support
values (values above 40% are shown only). CYP18A1 of Drosophila melanogaster was used as outgroup. The tree
is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the
phylogenetic tree.
CYP6A10 (65%), while CYP6EK1 shared 48% amino acid identity with D. melanogaster
CYP6A2, and a 47% identity with D. melanogaster CYP6M3. To analyze the sequence homology and phylogenetic relationships, 20 insect CYP6 genes were downloaded from GenBank. The constructed tree showed that CYP6A41 was most closely related to CYP6A10
from C. capitata, while CYP6EK1 shared the greatest identity with CYP6A subfamily
(Fig. 3).
Expression Patterns of CYP6A41 and CYP6EK1 among Different Geographical Populations
As indicated by the RT-qPCR, both of the two CYP6 cDNAs can be detected from all the
four geographical populations (Fig. 4). The expression levels of CYP6A41 did not vary
significantly among the four populations. However, in GZ population there was higher
expression of CYP6EK1 than in the other three populations. Additionally, the expression
of CYP6EK1 was the lowest in HN population.
Archives of Insect Biochemistry and Physiology
40
r
Archives of Insect Biochemistry and Physiology, January 2012
Figure 4. Expression levels of CYP6A41 and CYP6EK1 cDNAs in the different geographical populations. Values
are relative fold expression of two genes in each population compared with that in YN population and expressed
as mean ± SE (n = 3). Different letters above the error bar for each gene show significant difference at P <
0.05. YN, Yunnan; HN, Hainan; DG, Dongguan; GZ, Guangzhou.
Developmental-Specific Expression Patterns of CYP6A41 and CYP6EK1
Transcription levels for CYP6A41 and CYP6EK1 mRNAs were detectable at all tested
developmental stages (Fig. 5A). Both CYP6A41 and CYP6EK1 were highly expressed in
the larval stage, but had lower expression in the eggs. Generally, the mRNA levels of
CYP6A41 in larvae, pupae, and adults were 8.27-, 2.41-, and 7.56-fold higher than that in
eggs, respectively, and the expression in larvae and adults was significantly higher than in
eggs and pupae. The levels of CYP6EK1 in larvae, pupae, and adults were 109.84-, 38.46-,
and 64.88-fold higher than that in eggs, respectively, and the difference was significant.
Moreover, both CYP6A41 and CYP6EK1 had higher levels in larvae and adults, and the
difference between these two stages was not significant.
Tissue-Specific Expression Patterns of CYP6A41 and CYP6EK1
The mRNA levels of CYP6A41 expressed in Malpighian tubule and midgut were 1.33-fold
higher and 0.86-fold lower than that in fat body, respectively, but there was no significant
difference among them (P > 0.05) (Fig. 5B). Furthermore, the CYP6EK1 transcripts
in midgut were not significantly different from those in fat body. However, within the
Malpighian tubules, there was 8.98-fold greater transcription than in fat body (P < 0.05).
DISCUSSION
Cloning by PCR with the RACE technique enabled us to successfully obtain full-length
cDNA sequences of P450 genes from B. dorsalis. The predicted amino acid sequences of
CYP6A41 and CYP6EK1 possessed the highly conserved P450 motifs present in all other
CYP6 family members (Figs. 1 and 2), including Helix I (AGxxT), the Helix K (ExxR),
the CYP6-specific region (PxxFxP), and the heme-binding region (PFxxGxRxCxG/A)
(Mestres, 2005). These conserved motifs were usually used to design the degenerate
primers. Degenerate PCR based on the Helix K and the heme-binding region allowed us
to isolate two new CYP6 genes. There is no doubt that additional P450s may be isolated if
more clones are selected and sequenced.
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
41
Figure 5. Expression levels of CYP6A41 and CYP6EK1 cDNAs during the different developmental stages (A)
and tissues (B). Values expressed as mean ± SE (n = 3). Different letters above the error bar for each gene show
significant difference at P < 0.05. The relative fold expression of two genes in each developmental stage was
compared with that in eggs, and in each tissue was compared with that in fat body. MG, midgut; FB, fat body;
MT, Malpighian tubules.
The BLASTP search against the NCBI protein database revealed that CYP6A41 and
CYP6EK1, both of which were new since they were cloned and named for the first time,
were highly similar to many other insect CYP6 genes. CYP6A41 shared 65% identity with
C. capitata CYP6A10. CYP6EK1, which belonged to a new subfamily, shared 47 and 48%
identity with A. gambiae CYP6M3 and D. melanogaster CYP6A2, respectively. According to
the cytochrome P450 nomenclature committee, all members of the same P450 family
should share more than 40% amino acid identity (Nelson et al., 1993). Contrarily, a new
gene such as CYP6EK1 that even shared more than 40% identity with a subfamily may
not belong to it. Phylogenetic analyses showed that CYP6A41 was closest to CYP6A10 but
CYP6EK1 was closest to CYP6A subfamily. However, Chiu et al. (2008) have made it clear
Archives of Insect Biochemistry and Physiology
42
r
Archives of Insect Biochemistry and Physiology, January 2012
that P450 metabolic profiles cannot be predicted simply from the primary sequences of
related P450s. Thus, further study is needed to elaborate the real metabolic profiles of
P450s.
The functional versatility of P450s was largely derived from their molecular diversity.
A substrate molecule may be metabolized by different P450s, and the same P450 can
metabolize different substrates. A different array of P450 isozymes existed in each insect
species, even in different populations of the same species. Bioassays showed that these
four populations of B. dorsalis had significantly different susceptibilities to malathion, avermectin, and beta-cypermethrin. However, our results showed that CYP6A41 expression
was not significantly different among these four populations. Likewise, CYP6EK1 expression was significantly higher in GZ population, but there was no significant difference
among the other three populations. This may suggest that CYP6A41 and CYP6EK1 have
no direct relationship with the detoxification of insecticides. Nevertheless, the expression
patterns may be a result from exposure to more than one insecticide at the same time, so
that cross-bioassay was still needed. In conclusion, the different levels may correlate with
different environmental conditions, which may due to epigenetic inheritance that allows
organisms to respond to a particular environment through changes in gene expression
(Jaenisch and Bird, 2003).
The different expression patterns in the developmental stages were also related to
the function of P450 genes. The P450s detected only in embryos were mostly expressed
in structures such as the yolk cells, or were maternal transcripts; whereas the P450s detected in larvae only were mostly expressed in tissues involved in detoxification (Chung
et al., 2009). Diversity in the developmental-specific expression of insect CYP6 genes was
apparent. Some P450s were expressed throughout all the developmental stages such as
CYP6AE25 of Ostrinia furnacalis (Zhang et al., 2011), CYP6CE1 and CYP6CE2 of Liposcelis
bostrychophila (Jiang et al., 2010), whereas others, such as P. polyxenes CYP6B and Blattella germanica CYP6L1, have developmental stages specific expression patterns (Harrison
et al., 2001; Wen and Scott, 2001). Our study showed that CYP6A41 and CYP6EK1 were
expressed in all the stages and both genes had significantly higher expression levels in
larvae, especially for CYP6EK1. Higher cytochrome P450 levels in nymphal Diaphorina citri
and larval Helicoverpa armigera compared with adults could be related to active feeding
and molting during juvenile stages (Tiwari et al., 2011). Moreover, insect P450s have
been identified to metabolize allelochemicals (Li et al., 2007), such as furanocoumarins,
terpenoids, indoles, glucosinolates, flavonoids, cardenolides, phenylpropenes, ketohydrocarbons, alkaloids, lignans, pyrethrins, and the isoflavonoid rotenone (Schuler, 1996;
Fogleman et al., 1998; Feyeseisen, 2005). For instance, CYP6B1v1 and CYP6B3v1 can metabolize the furanocoumarins in the black swallowtail butterfly, P. polyxenes (Chen et al.,
2002; Li et al., 2004). Generally, both of the two P450 genes may be involved in detoxification of plant secondary substances, which may be most detrimental to the juvenile
flies.
In addition, we determined the two P450 genes expression profiles in three major
tissues of the fruit fly (the midgut, fat body, and Malpighian tubule) because of their
important physiological roles in insects. This is consistent with a presumed function of
P450s in detoxification processes, as the metabolism of both exogenous and endogenous
compounds is likely to occur in these tissues (Dow and Davies, 2006). The insect midgut
is the largest portion of the digestive tract and is also a target of pathogenic microbes,
insecticides, and plant toxins (Tzou et al., 2000; Yang et al., 2010). In addition, the anterior
portion of the midgut has been suggested to play some role in immunity (Senger et al.,
2006). The insect fat body is the main organ involved in energy metabolism and the
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
43
major storage site for glycogen, lipid, and protein (Hoshizaki, 2005), and also has other
physiological functions such as innate immune and detoxification (Liu et al., 2009). The
Malpighian tubules have been suggested to be the primary organs of excretion in insects,
important for the metabolism and detoxification of xenobiotics, and may also be involved
in immunity (Dow and Davies, 2006; Yang et al., 2007). In Drosophila, adult Malpighian
tubules are the key tissue for defense against insecticides such as DDT and can also detect
and mount an autonomous defense against bacterial invasion (Dow, 2008). It has been well
documented that all these three tissues are closely related to the functions of P450 genes
and P450s show tissue-specific expression patterns depending on particular functions
(Chung et al., 2009). For example, D. melanogaster CYP6G1 mRNAs were detected in parts
of the midgut and the Malpighian tubules in early third larvae instars (Chung et al., 2007).
CYP6CS1 and CYP6CW1 from N. lugens were expressed at a basal level in gut tissues and
fat bodies of nymphs (Yang et al., 2010). In D. melanogaster, 15, 3, and 2 P450 genes were
detected in midgut, Malpighian tubules, and fat body, respectively (Chung et al., 2009).
In this study, CYP6A41 and CYP6EK1 were expressed in all the three tissues. CYP6A41
had similar low expression levels in all the three tissues indicating that this gene may play
similar role among these tissues. However, high expression of CYP6EK1 in the Malpighian
tubules suggested that it was necessary in this tissue and may be involved in detoxification
prior to excretion of plant secondary substances or insecticides.
In conclusion, this article reported two new P450 genes, CYP6A41 and CYP6EK1, from
B. dorsalis. Their expression patterns were different between geographical populations,
which may result from the environment stress. The highest expression of CYP6A41 and
CYP6EK1 in the larvae and Malpighian tubules suggested these two genes might be
involved in the development or detoxification. However, we realized that the current
study is just the start to understand the cytochrome P450 system in the oriental fruit fly.
To clarify the role of P450s in the oriental fruit fly, further study such as RNAi will be
essential.
ACKNOWLEDGMENTS
We thank David R. Nelson for his assistance with the naming of CYP6A41 and CYP6EK1.
This manuscript was critically read by Dr. Helen Hull-Sanders.
LITERATURE CITED
Bautista MAM, Miyata T, Miura K, Tanaka T. 2009. RNA interference-mediated knockdown of a
cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella, reduces larval
resistance to permethrin. Insect Biochem Mol Biol 39:38–46.
Chen JS, Berenbaum MR, Schuler MA. 2002. Amino acids in SRS1 and SRS6 are critical for furanocoumarin metabolism by CYP6B1v1, a cytochrome P450 monooxygenase. Insect Mol Biol
11:175–186.
Chen SL, Dai SM, Lu KH, Chang C. 2008. Female-specific doublesex dsRNA interrupts yolk protein
gene expression and reproductive ability in oriental fruit fly, Bactrocera dorsalis (Hendel). Insect
Biochem Mol Biol 38:155–165.
Chen SL, Lu KH, Dai SM, Li CH, Shieh CJ, Chang C. 2010. Display female-specific doublesex RNA
interference in early generations of transformed oriental fruit fly, Bactrocera dorsalis (Hendel).
Pest Manag Sci 67:466–473.
Archives of Insect Biochemistry and Physiology
44
r
Archives of Insect Biochemistry and Physiology, January 2012
Chiu TL, Wen ZM, Rupasinghe SG, Schuler MA. 2008. Comparative molecular modeling of Anopheles
gambiae CYP6Z1, a mosquito P450 capable of metabolizing DDT. Proc Natl Acad Sci USA
105:8855–8860.
Chung H, Bogwitz MR, McCart C, Andrianopoulos A, Ffrench-Constant RH, Batterham P, Daborn
PJ. 2007. Cis-regulatory elements in the Accord retrotransposon result in tissue-specific expression of the Drosophila melanogaster insecticide resistance gene Cyp6g1. Genetics 175:1071–1077.
Chung H, Sztal T, Pasricha S, Sridhar M, Batterham P, Daborn PJ. 2009. Characterization of
Drosophila melanogaster cytochrome P450 genes. Proc Natl Acad Sci USA 106:5731–5736.
Clarke AR, Armstrong KF, Carmichael AE, Milne JR, Raghu S, Roderick GK, Yeates DK. 2005. Invasive
phytophagous pests arising through a recent tropical evolutionary radiation: the Bactrocera
dorsalis complex of fruit flies. Annu Rev Entomol 50:293–319.
Dow J. 2008. New insights into Malpighian tubule function from functional genomics. Comp
Biochem Phys A 150:S135–S135.
Dow JAT, Davies SA. 2006. The Malpighian tubule: rapid insights from post-genomic biology. J
Insect Physiol 52:365–378.
Drew RAI, Hancock DL. 1994. The Bactrocera dorsalis complex of fruit flies (Diptera: Tephritidae)
in Asia. Bull Entomol Res Supplement 2:1–68.
Feyeseisen R. 2005. Insect cytochrome P450. In: Gilbert LI, Iatrou K, Gill SS, editors. Comprehensive
molecular insect science. Elsevier: Amsterdam. p 1–77.
Fogleman JC, Danielson PB, Macintyre RJ. 1998. The molecular basis of adaptation in Drosophila:
the role of cytochrome P450s. Evol Biol 30:15–77.
Gong MQ, Gu Y, Hu XB, Sun Y, Ma L, Li XL, Sun LX, Sun J, Qian J, Zhu CL. 2005. Cloning and
overexpression of CYP6F1, a cytochrome P450 gene, from deltamethrin-resistant Culex pipiens
pallens. Acta Bioch Bioph Sin 37:317–326.
Harrison TL, Zangerl AR, Schuler MA, Berenbaum MR. 2001. Developmental variation in cytochrome P450 expression in Papilio polyxenes in response to xanthotoxin, a hostplant allelochemical. Arch Insect Biochem Physiol 48:179–189.
Hoshizaki DG. 2005. Fat-cell development. In: Gilbert LI, Iatrou K, Gill SS, editors. Comprehensive
molecular insect science. Elsevier: Amsterdam. p 315–345.
Hsu JC, Feng HT, Wu WJ, 2004. Resistance and synergistic effects of insecticides in Bactrocera dorsalis
(Diptera : Tephritidae) in Taiwan. J Econ Entomol 97:1682–1688.
Hsu JC, Wu WJ, Haymer DS, Liao HY, Feng HT. 2008. Alterations of the acetylcholinesterase enzyme
in the oriental fruit fly Bactrocera dorsalis are correlated with resistance to the organophosphate
insecticide fenitrothion. Insect Biochem Mol Biol 38:146–154.
Hu F, Dou W, Wang JJ, Jia FX, Wang JJ. 2011. Purification and biochemical characterization of
glutathione S-transferases from four field populations of Bactrocera dorsalis (Hendel) (Diptera:
Tephritidae). Arch Insect Biochem Physiol 78:201–215.
Jaenisch R, Bird A. 2003. Epigenetic regulation of gene expression: how the genome integrates
intrinsic and environmental signals. Nat Genet 33:245–254.
Jiang HB, Tang PA, Xu YQ, An FM, Wang JJ. 2010. Molecular characterization of two novel
deltamethrin-inducible P450 genes from Liposcelis bostrychophila Badonnel (Psocoptera: Liposcelididae). Arch Insect Biochem Physiol 74:17–37.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace
IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X
version 2.0. Bioinformatics 23:2947–2948.
Li XC, Baudry J, Berenbaum MR, SchulerMA. 2004. Structural and functional divergence of insect CYP6B proteins: from specialist to generalist cytochrome P450. Proc Natl Acad Sci USA
101:2939–2944.
Li XC, Schuler MA, Berenbaum MR. 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu Rev Entomol 52:231–253.
Archives of Insect Biochemistry and Physiology
Characterization of P450 from Oriental Fruit Fly
r
45
Liu Y, Liu HH, Liu SM, Wang S, Jiang RJ, Li S. 2009. Hormonal and nutritional regulation of insect
fat body development and function. Arch Insect Biochem Physiol 71:16–30.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative
PCR and the 2−C T method. Methods 25:402–408.
Mestres J. 2005. Structure conservation in cytochromes P450. Proteins 58:596–609.
Nelson DR, Kamataki T, Waxman DJ, Guengerich FP, Estabrook RW, Feyereisen R, Gonzalez FJ,
Coon MJ, Gunsalus IC, Gotoh O, Okuda K, Nebert DW. 1993. The P450 superfamily: update
on new sequences, gene mapping, accession numbers, early trivial names of enzymes, and
nomenclature. DNA Cell Biol 12:1–51.
Penilla RP, Rodriguez AD, Hemingway J, Trejo A, Lopez AD, Rodriguez MH. 2007. Cytochrome
P450 -based resistance mechanism and pyrethroid resistance in the field Anopheles albimanus
resistance management trial. Pestic Biochem Physiol 89:111–117.
Ranson H, Nikou D, Hutchinson M, Wang X, Roth CW, Hemingway J, Collins FH. 2002. Molecular
analysis of multiple cytochrome P450 genes from the malaria vector, Anopheles gambiae. Insect
Mol Biol 11:409–418.
Schuler MA. 1996. The role of cytochrome P450 monooxygenases in plant-insect interactions. Plant
Physiol 112:1411–19.
Scott JG. 2008. Insect cytochrome P450: thinking beyond detoxification. In: Liu, N, editor. Recent
advances in insect physiology, toxicology and molecular biology. Kerala: Research Signpost.
p 117–124.
Senger K, Harris K, Levine M. 2006. GATA factors participate in tissue-specific immune responses
in Drosophila larvae. Proc Natl Acad Sci USA 103:15957–15962.
Shen GM, Jiang HB, Wang XN, Wang JJ. 2010. Evaluation of endogenous references for gene
expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera:
Tephritidae). BMC Mol Biol 11(76):1–10.
Shi W, Kerdelhue C, Ye H. 2005. Population genetics of the oriental fruit fly, Bactrocera dorsalis
(Diptera: Tephritidae), in Yunnan (China) based on mitochondrial DNA sequences. Environ
Entomol 34:977–983.
Strode C, Wondji CS, David JP, Hawkes NJ, Lumjuan N, Nelson DR, Drane DR, Karunaratne SHPP,
Hemingway J, Black WC, Ranson H. 2008. Genomic analysis of detoxification genes in the
mosquito Aedes aegypti. Insect Biochem Mol Biol 38:113–123.
Sun W, Margam VM, Sun L, Buczkowski G, Bennett GW, Schemerhorn B, Muir WM, Pittendrigh
BR. 2006. Genome-wide analysis of phenobarbital-inducible genes in Drosophila melanogaster.
Insect Mol Biol 15:455–464.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evolutionary genetics analysis
(MEGA) software version 4.0. Mol Biol Evol 24:1596–1599.
Tijet N, Helvig C, Feyereisen R. 2001. The cytochrome P450 gene superfamily in Drosophila
melanogaster: annotation, intron-exon organization and phylogeny. Gene 262:189–198.
Tiwari S, Pelz-Stelinski K, Mann RS, Stelinski LL. 2011. Glutathione transferase and cytochrome P450 (general oxidase) activity levels in Candidatus Liberibacter asiaticus-infected
and uninfected Asian citrus psyllid (Hemiptera: Psyllidae). Ann Entomol Soc Am 104:297–
305.
Tzou P, Ohresser S, Ferrandon D, Capovilla M, Reichhart JM, Lemaitre B, Hoffmann JA, Imler JL.
2000. Tissue-specific inducible expression of antimicrobial peptide genes in Drosophila surface
epithelia. Immunity 13:737–748.
Wen Z, Scott JG. 2001. Cytochrome P450 CYP6L1 is specifically expressed in the reproductive
tissues of adult male German cockroaches, Blattella germanica (L.). Insect Biochem Mol Biol
31:179–187.
Yamamoto K, Ichinose H, Aso Y, Fujii H. 2010. Expression analysis of cytochrome P450s in the
silkmoth, Bombyx mori. Pestic Biochem Physiol 97:1–6.
Archives of Insect Biochemistry and Physiology
46
r
Archives of Insect Biochemistry and Physiology, January 2012
Yang J, McCart C, Woods DJ, Terhzaz S, Greenwood KG, Ffrench-Constant RH, Dow JAT. 2007. A
Drosophila systems approach to xenobiotic metabolism. Physiol Genomics 30:223–231.
Yang Y, Wu Y, Chen S, Devine GJ, Denholm I, Jewess P, Moores GD. 2004. The involvement of
microsomal oxidases in pyrethroid resistance in Helicoverpa armigera from Asia. Insect Biochem
Mol Biol 34:763–773.
Yang Z, Zhang Y, Liu X, Wang X. 2010. Two novel cytochrome P450 genes CYP6CS1 and CYP6CW1
from Nilaparvata lugens (Hemiptera: Delphacidae): cDNA cloning and induction by host resistant rice. Bull Entomol Res 1–9.
Zhang YL, Kulye M, Yang FS, Xiao L, Zhang YT, Zeng HM, Wang JH, Liu ZX. 2011. Identification,
characterization, and expression of a novel P450 gene encoding CYP6AE25 from Asian corn
borer, Ostrinia furnacalis. J Insect Sci 11:1–17.
Zhu F, Feng JN, Zhang L, Liu N. 2008. Characterization of two novel cytochrome P450 genes in
insecticide-resistant house-flies. Insect Mol Biol 17:27–37.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
0
Размер файла
924 Кб
Теги
two, orientalis, molecular, cytochrome, p450, dorsalis, dipteratephritidae, fruits, fly, characterization, genes, cyp6ek1, bactrocera, cyp6a41, encoding
1/--страниц
Пожаловаться на содержимое документа