close

Вход

Забыли?

вход по аккаунту

?

Molecular cloning and characterization of Bombyx mori CREB gene.

код для вставкиСкачать
A r t i c l e
MOLECULAR CLONING AND
CHARACTERIZATION OF Bombyx
mori CREB GENE
Hongsheng Song, Yue Sun and Yang Zhang
College of Life Sciences, Shanghai University, Shanghai, P.R. China,
200444
Muwang Li
Sericultural Research Institute, Chinese Academy of Agricultural
Sciences, Zhenjiang, Jiangsu Province, P.R. China, 212018
The cAMP response element binding protein (CREB), as one of the best
characterized stimulus-induced transcription factors, plays critical roles
in activating transcription of target genes in response to a variety of
environmental stimuli. To characterize this important molecule in the
silkworm, Bombyx mori, we cloned a full-length cDNA of CREB gene
from B. mori brains by using RACE-PCR. The sequence of B. mori
CREB (named BmCREB1) gene contains a 88 bp 50 UTR, a 783 bp
open reading frame (ORF) encoding 261 amino acids and a 348 bp 30
UTR. The deduced BmCREB amino acid sequence has 56.7% and
37.2% homology with CREB from Apis mellifera carnica and
Drosophila melanogaster, respectively. The primary structure of the
deduced BmCREB1 protein contains a kinase-inducible domain (KID)
and a basic region/leucine zipper (bZIP) dimerization domain which
exisits in all CREB family members. Genomic analysis showed there are 9
exons and 5 introns in B. mori CREB genome sequences. We identified
three different isoforms of BmCREB (BmCREB1, BmCREB2 and
BmCREB3) through alternative splicing in C terminal. In addition, the
expression of BmCREB in different developmental stages was investigated by using quantitative real-time PCR in both diapause and non-
Abbreviations: ATF, activating transcription factor; bZIP, basic region/leucine zipper; BmCREB, cAMP response
element binding protein of Bombyx mori; CBP, CREB binding protein; CREB, cAMP response element binding
protein; CREM, cAMP response element modulator; DH, diapause hormone; DL-condition, darkness and low
temperature condition; LW-condition, light and warm temperature condition; KID, kinase-inducible domain;
PCR, polymerase chain reaction; RT- PCR, reverse-transcribed polymerase chain reaction; SG, suboesophageal
ganglion; UTR, untranslated region
Correspondence to: Hongsheng Song, College of Life Sciences, Shanghai University, Shang Da Road 99,
Shanghai, P.R. China. E-mail: hssong@staff.shu.edu.cn
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 71, No. 1, 31–44 (2009)
Published online in Wiley InterScience (www.interscience.wiley.com).
& 2009 Wiley Periodicals, Inc. DOI: 10.1002/arch.20292
32
Archives of Insect Biochemistry and Physiology, May 2009
diapause type of B. mori bivoltine race (Dazao). BmCREB transcripts
showed two peaks in embryonic stage and pupal stage in both types of
bivoltine race. However, consistently higher expression of BmCREB was
found throughout the developmental stages in the diapause type than in
the non-diapause type. These results suggest that BmCREB is involved
C 2009
in the processs of diapause induced by environmental factors. Wiley Periodicals, Inc.
Keywords: CREB; Bombyx mori; brain; diapause
INTRODUCTION
The cAMP response element binding protein (CREB), a prototypical stimulusinducible transcription factor, has been implicated in many important physiological
processes including memory formation (Yin et al., 1995a; Lonze and Ginty, 2002),
growth factor dependent cell survival (Bonni et al., 1999; Riccio et al., 1999), rest
homeostasis (Hendricks et al., 2001), and circadian rhythms (Belvin et al., 1999).
CREB belongs to a family of transcription factors that includes CREB, cAMP response
element modulator (CREM), and activating transcription factor 1 (ATF-1), which is a
member of the super-family of basic region/leucin zipper (bZIP) proteins (Hai and
Hartman, 2001). Like all bZIP transcription factors, CREB family members contain a
C-terminal basic domain that mediates DNA binding, and a leucine zipper domain that
facilitates dimerization (Landschulz et al., 1988; Mayr and Montminy, 2001). This
cAMP-response element (CRE) contains a consensus nucleotide sequence TGACGTCA
which is found within the regulatory (promoter or enhancer) region of many cAMPresponsive genes (Lonze and Ginty, 2002; Hoeffler, et al. 1988). While the bZIP
domain mediates DNA binding and dimerization, the kinase-inducible domain (KID)
flanked by two glutamine-rich regions, referred to as Q1 and Q2/CAD (constitutive
active domain), serves to facilitate interaction with the transcriptional coactivators
(Brindle et al., 1993; Quinn, 1993). Phosphorylated CREB within the KID in a
stimulus-inducible manner recruits the nuclear protein CBP (CREB binding protein)/
p300 contributing to the augmented CREB-mediated transcription (Eckner et al.,
1994; Kwok et al., 1994). CREB/CREM genes undergo extensive splicing events
(Ruppert et al., 1992; Yin et al., 1995b). Their modular structures in combination with
differential splicing and alternative initiation of transcription and/or translation lead to
a variety of transcription factors, which appear to be necessary for a specific temporal
coordination of physiological programs (Walker et al., 1996; Stehle et al., 2001).
The silkworm, Bombyx mori, is a typical insect with embryonic diapause. This
diapause is induced by the diapause hormone (DH) which is secreted from the
neurosecretory cells of suboesophageal ganglion (SG) under the control of brains
(Matsutani and Sonobe, 1987; Imai et al., 1991). The diapause nature of the silkworm
is primarily a genetic character (voltinism), and bivoltine strains use environmental
stimuli as the initial signal to determine the diapause nature. Embryonic diapause is
induced by incubating maternal eggs under continuous light and warm temperature
(251C) (LW-condition), whereas incubation under continuous darkness and low
temperature (151C) (DL-condition) leads to non-diapause eggs in progeny (Watanaba,
1924, Xu, et al. 1995). Thus, the embryonic diapause requires one generation from
the reception of environmental stimuli to the initiation of diapause through hormone
Archives of Insect Biochemistry and Physiology
Cloning and Characterization of Bombyx mori CREB
33
action. There is evidence showed that DH induces diapause in the resulting embryos,
acts on developing oocytes and causes metabolic transformation such as stimulating
accumulation of glycogen in the ovaries through increasing trehalase activity (Ikeda
et al., 1993; Su et al., 1994). However, it is still unknown how a long-lasting effect of
diapause destination from environmental stimuli is controlled by brains.
To investigate the molecular process of diapause destination induced by
environmental stimuli in B. mori, we cloned B. mori CREB genes (BmCREB) from
the brains and analyzed the expression pattern of BmCREB in the different
developmental stages in diapause destination type and non-diapause destination type
of a bivoltine strain which were induced by different environmental conditions during
embryogenesis.
MATERIALS AND METHODS
Insects
A B. mori bivoltine strain (Dazao) was used in all experiments. The diapause nature of
this strain is completely controlled by the incubation conditions (light and
temperature) experienced during the maternal embryonic development. According
to the procedure of Song et al. (2007), eggs incubated under light and warm
temperature (251C) (LW-condition) throughout embryonic development produce
diapause eggs in next generation, while eggs incubated under darkness and low
temperature(151C) (DL-condition) produced non-diapause eggs in the progeny. The
larvae were reared with fresh mulberry leaves or an artificial diet at 251C on a 12hlight/12h-dark photoperiod. Pupae, adults and laid eggs were kept under the same
light and temperature conditions with larvae. The diapause nature of eggs was
checked 2 weeks after oviposition, by which time all non-diapause eggs hatched.
RNA extraction and RT-PCR
Total RNA from various tissues of B. mori was extracted with Trizol reagent
(Invitrogen, USA) according to the manufacturer0 s recommendations. One microgram
total mRNA sample was primed with an Oligo (dT)15 primer and reverse-transcribed
into single-stranded cDNA using M-MLV RTase (Toyobo, Japan). Two specific primers
P1 and P2 (Table 1) designed from conserved amino acid residues of CREBs showed in
the SilkBase (http://morus.ab.a.u-tokyo.ac.jp/) were used for amplification of the
homologous sequence. PCR was carried out with Advantage high-fidelity polymerase
(Takara, Japan) and consisted of 6 min of denaturation at 941C followed by 30 cycles
of: 30 sec at 941C, 1 min at 601C, and 1 min at 721C and a final extension step at 721C
for 10 min. The primers and their corresponding positions are listed in Table 1. The
PCR products were purified from the agarose gel, subcloned into the pMD 18-T
Vector (Takara, Japan) and sequenced on an ABI PRISM 377 DNA sequencer (PerkinElmer).
Rapid Amplification of cDNA Ends (RACE)
To clone the full-length cDNA of BmCREB, 50 -RACE and 30 -RACE were performed by
using the BD SMART RACE cDNA Amplification Kit (Clontech, USA) according to the
manufacturer0 s instructions. In 50 -RACE, first-strand cDNA was generated by reverse
transcription of poly(A)1 RNA from pupal brains using 50 -cDNA synthesis (CDS)
Archives of Insect Biochemistry and Physiology
34
Archives of Insect Biochemistry and Physiology, May 2009
Table 1. Primer sequences designed for BmCREB cloning
Primer ID
P1
P2
P3
P4
P5
P6
P7
P8
P9
P10
P11
P12
Position
Primer sequences
50
50
50
50
50
50
50
50
50
50
50
50
CACCGGGTTCCACTCCTCAT 30
CATTCCCTAGCGGCTTCTCG 30
ACTGCAATTTCTGCTCCTCCAAG 30
CGTTTGTAATGTCCCTTGCGTAG 30
GGGTTCCACTCCTCATGTTGTCA 30
CAGTATGCAGCGAATCAAGATGG 30
ACCTTCCCGTTCACCCAC 30
AGCCAGCTTGACCTCATTCC 30
ACCTTCCCGTTCACCCAC 30
GGGACCCGGTACATAGAATT 30
AATTATTTACAGGTTACGACACTA 30
GCCAATAGTATCAAAATCG 30
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
Exon
2
6
5
3
2
5
2
9
1
7
7
9
The positions are in corresponding to figure 2
primer provided by kits. The cDNA was amplified by PCR using gene specific primers
(GSPs) and P3/P4 (shown in Table 1). P4 nested immediately upstream of P3 (Fig. 2).
In 30 -RACE, first-strand cDNA was generated using 30 -CDS primer. The cDNA was
amplified by PCR using GSPs and P5/P6 (shown in Table 1). The PCR products were
separated on agarose gels, purified, cloned into pMD 18-T vector and sequenced.
Quantitative Real-time PCR analysis
All tissues including brains of 4th or 5th instar larvae and pupae, the whole bodies of
larvae from 1st to 3rd instar just after ecdysis, and embryos of different developmental
stages were collected from diapause destination and non-diapause destination animals.
The total RNA extraction was treated with DNase (RNase-free DNase set, Takara,
Japan) to eliminate potential genomic DNA contamination. The reverse transcription
was performed with ReverTra Ace-á-kit (Toyobo, Japan) and used in the quantitative
real-time PCR (Q-RT-PCR) assays. The negative control without the reverse
transcription enzyme were prepared and analyzed in parallel with the unknown
samples during the Q-RT-PCR assay.
Q-RT-PCR was performed in a 20 ml volume using SYBR Green Real-time PCR
Master Mix (Toyobo, Japan) with template cDNA equivalent to 50 ng RNA and 0.5 mM
primers. The primers for BmCREB were 50 -CGC AGC ATA GAC GGT GAC GA -30
(forward) and 50 -AGA GGG AGC CTG ACT GGG TAG A-30 (reverse), and for
BmG3PDH gene, as endogenous control, were 50 -CGT GGT GGT GGT CAG TTA TTC
A-30 (forward) and 50 -ATA TTC AGC CCC AGC TTT TCC-30 (reverse). Relative
standard curves were generated by serial dilutions (5 ) of template cDNA. Reactions
were run in duplicate on a DNA Engine Opticon2 Continuous Fluorescence detection
system (MJ Research, USA) using the following thermal cycling profile: 951C for 5 min,
followed by 40 cycles of 951C for 20 s, 601C for 30 s. After 40 cycles, samples were run
for the dissociation protocol, showing a single melting peak. Results were analyzed
using the Opticon Monitor analysis software (version 3.1/MJ Research, USA), values
were normalized to BmG3PDH. In addition, OriginPio7.5 was used to analyze statistics.
Data were expressed as the mean7S.D. and anova t-test was used to test significance of
differences.
Archives of Insect Biochemistry and Physiology
Cloning and Characterization of Bombyx mori CREB
35
Sequence Analysis
To analyze intron/exon of the BmCREB, the BmCREB sequences were compared
with silkworm genome draft sequences using a basic local alignment search
tool (BLAST) from GenBank databases (http://www.ncbi.nlm.nih.gov/BLAST/).
The retrieved amino acid sequences from various species at the highest score
were used in the phylogenetic analysis. The protein sequence alignments were
performed by using Vector NTI Advanced 9.0 (InforMax/Invitrogen, USA).
Phylogenetic analysis was carried out with Molecular Evolutionary Genetics Analysis
(MEGA), version3.0. Unrooted phylogenetic trees with balanced or unbalanced
branches were generated.
RESULTS
Cloning of CREB gene and its variants from Bombyx mori brains
To study the characteristics of B. mori CREB, we cloned the B. mori CREB (BmCREB)
genes from pupal brains. A 586 bp cDNA fragment (designated BmC-1) was PCRamplified by using the specific primers P1 and P2, which were designed from a
conserved amino acid fragment of CREBs from silkworm EST database. The primer
P3 and the nested primer P4 (shown in table 1 and Fig. 2) based on the sequence of the
original BmC-1 clone were used for 50 -RACE PCR. A 379 bp fragment (designated 50 BmCREB) was amplified. A 588 bp fragment (designated 30 -BmCREB) was determined by 30 -RACE PCR with the primer P5 and the nested primer P6 (shown in table 1
and Fig. 2). The three overlapping clones of 50 -BmCREB, BmC-1 and 30 -BmCREB
defined a full-length cDNA of the BmCREB gene (designated BmCREB1). The
1219 bp BmCREB1 transcript contains a 88 bp 50 UTR, a 783 bp open reading frame
(ORF) encoding 261 amino acids, and a 348 bp 30 UTR, which exhibited a putative
polyadenylation signal (AATAAA) starting 173 nucleotides upstream of the poly-A tail
(Fig. 1). The primary structure of the deduced BmCREB1 protein showed a centrally
located kinase-inducible domain (KID) as well as a basic region/leucine zipper (bZIP)
dimerization domain which exists in all CREB family members.
To confirm that 50 -BmCREB, BmC-1, and 30 -BmCREB belong to the same
transcript, the PCR amplification with primers designed from the 50 UTR and 30 UTR
of BmCREB1 was performed. One fragment was nearly obtained and analysis of 20
clones revealed a novel BmCREB transcript (designated BmCREB3) in addoition to
BmCREB1. Compared with BmCREB1, there is an additional 12 bp fragment in ORF of
BmCREB3 (Fig. 2, Fig. 3).
To compare the splicing variants of Drosophila CREB and BmCREB3 as
well as silkworm CREB genomic DNA, two primers (P10 and P11, shown in Fig. 2,
Table 1) were designed in exon 7 and used for PCR amplification, respectively.
Sequence analysis indicated that the two PCR products belong to the same
transcript. Another variant was confirmed and designated BmCREB2 which contains
1327 bp including a 597 bp open reading frame (ORF) encoding 199 amino acids.
Because the BmCREB2 splicing form incorporates a stop codon (TAG), the deduced
protein is truncated to the foreside of bZIP region (Fig. 2 and 3). The nucleotide
sequences of BmCREB1, BmCREB2 and BmCREB3 have been submitted to the
GenBank/NCBI Database with accession number of EF682070, EF682068 and
EF682069, respectively.
Archives of Insect Biochemistry and Physiology
Figure 1. Full-length nucleotide and deduced amino acid sequence of the BmCREB1 gene. Numbers on the right refer to the last nucleotide in each line. The start
codon (ATG), stop codon (TGA), polyadenylation signal and poly-A tail are indicated by single underline, double underline, bold underline and broken underline,
respectively. The deduced amino acid sequence is shown below the nucleotide sequence and numbered to the left. The KID domain and the bZIP domain are shown
by gray box and white box, respectively. The aster marks the stop codon. The first 73 nucleotides indicated by gray, where there is a difference between BmCREB1 and
BmCREBN (Accession No. DQ311259).
36
Archives of Insect Biochemistry and Physiology, May 2009
Archives of Insect Biochemistry and Physiology
Archives of Insect Biochemistry and Physiology
)
)
(
(
(1822bp)
BmCREBN
(1231bp)
BmCREB3
(1327bp)
BmCREB2
(1219bp)
BmCREB1
Genome
(1-73)
1
P9
P7
2
P1
(1-59)
5’RACE
P5
AT G
(60-227)
(74-241)
3
P4
(228-377)
(242-391)
4
(378-543)
(392-557)
5
P3
P6
(544-666)
7
8
P10 P11
(558-680) TAG
(558-1327)
(558-680)
6
P2
TGA
(667-1822)
(681-1231)
(681-1219)
9
poly A
poly A
poly A
P12
P8
3’RACE
Figure 2. The BmCREB gene structure and splicing variants. A (I): The primers for the BmCREB transcripts used in PCR cloning strategy. Arrows indicated the
position and direction of the primers. A (II): genomic organization of the BmCREB gene. Exons and introns composing the genes are represented by white boxes and
lines, respectively. A (III): The diagram of the BmCREB splicing variants. Exon boundaries are defined with respect to BmCREB2. Coding regions are indicated by
black boxes; noncoding regions by gray boxes. Introns are shown as disconnected lines. ATG, translation initiation; TAG, TGA translation termination. (B) The
nucleotide sequence spliced region of the BmCREB (1–3) transcripts. The identical nucleotide residues are highlighted in black and conservative residues are in gray.
B
)
(
A
Cloning and Characterization of Bombyx mori CREB
37
38
Archives of Insect Biochemistry and Physiology, May 2009
Figure 3. The amino acid sequence alignments and phylogenetic tree of BmCREBs and homologues. (A):
Amino acid sequence comparison of CREBs from Bombyx mori (Accession No. EF682070, EF682068, EF682069,
DQ311259), Apis mellifera carnica (Accession No. CAD23079), Drosophila melanogaster (Accession No. NP_524087),
Taeniopygia Guttata (Accession No. BAA36482), Rattus norvegicus (Accession No. NP_604392), and Homo sapiens
(Accession No. AAQ24858), as well as ATF-1 (Accession No. AAB25878) and CREM (Accession No. AAC60616)
from human. The highly conservative amino acid residues are highlighted in grey and identical residues are in
black. Two important domains, centrally located KID domain and carboxy-terminally located bZIP domain, are
marked by boxes and labeled their names. (B) Phylogenetic tree of CREBs, besides from species shown in A, also
from Hydra.vulgaris (Accession No.P51985), Ovis.aries (Accession No. AAF90178) and Sebastiscus. marmoratus
(Accession No. ABS29319). The length of each branch represents the distance between each protein and the
common ancestor of that protein and its neighbor. The phylogenic tree was generated using MEGA program.
Archives of Insect Biochemistry and Physiology
Cloning and Characterization of Bombyx mori CREB
39
Structure of Bombyx mori CREB gene
We cloned three BmCREB from the silkworm brains, and found another B. mori
CREB (designated BmCREBN in this paper, Accession No.DQ311259) by searching
NCBI Database. Comparing the BmCREB genome, the longest BmCREB2 was
composed of 9 extrons, others were resultant of alternative splice (Fig. 2). These
results indicate that there are at least four splice variants in BmCREB. The
rearrangement of extrons occur in either 50 -UTR region (BmCREBN) or ORF
(BmCREB1 and BmCREB3). In addition, all the introns are according with the GT-AG
boundaries (Fig. 2) (data not shown).
Sequence Alignment and Phylogenetic analysis
Alignment of amino acid sequences of the BmCREB with those from mammals and
insects indicated a high conservation (Fig. 3A). BmCREB2 shared the identities of
56.7% with the CREB from Apis mellifera carnica, 37.2% with the CREB from Drosophila
melanogaster and 35.1% with the CREB from Homo sapiens. In the C-terminal DNA
binding and dimerization domain (bZIP), and the phosphorylation domain (P box),
BmCREB2 is highly homologous to Apis CREB and Drosophila CREB, as well as
mammalian CREB/CREM proteins. Furthermore, the key regulatory phosphorylation
consensus regions in the P box (Gonzalez and Montminy, 1989) are conserved between
BmCREB2 and mammalian CREBs. The S142 (corresponding to S133 in mammalian
CREB) and the surrounding recognition sequences for PKA, CaMK, and RSK2 are
also conserved. Similar to Aplysia CREB1a (Eisenhardt et al., 2003) and Drosophila
CREB (Yin et al., 1995a), the T138 preserves the GSK3 phosphorylation site, similar to
S129 in mammalian CREBs (Fiol et al., 1994). Due to the sequence identities in
functional regions of the CREB/CREM proteins, we propose that the BmCREBs
belong to CREB/CREM family of transcription factors.
The deduced amino acid sequences of the BmCREBs were aligned with their
orthologues and human homologues, and a phylogenetic tree was generated (Fig. 3B).
The results showed that BmCREB was closer to invertebrate CREB than vertebrate
CREB excepting ATF-1 and the highest similarity with Apis CREB.
Expression patterns of Bombyx mori CREB gene
The mRNA expression of BmCREBs in B. mori was investigated by using
Q-RT-PCR from embryo to the larval and to the pupal stage in diapause and nondiapause type silkworm (Fig. 4). For diapause type silkworm, the BmCREB
transcript remained a high expression level throughout investigated stages, especially
at pupal stage. Two peaks were found on embryonic stage of tenidium formation
and day 1 after pupation. In contrast, the BmCREB transcript in non-diapause
type silkworm showed a relative low expression level, and no remarkable peak
appeared throughout all stages. The differences between diapause type and nondiapause type were at a significant level in all stages except day 2 of 4th instar larva as
well as day 1 of 5th instar larva (difference data not shown). These results strongly
suggest that the expression of BmCREB transcripts in the embryo, larval and pupal
stages could be induced by environmental stimuli during maternal embryonic
developments.
Archives of Insect Biochemistry and Physiology
Figure 4. The developmental expression pattern of BmCREB transcripts investigated by quantitative real-time RT-PCR in the diapause type silkworms (LW) and
non-diapause type silkworms (DL). E: embryonic stage, 1–3 represent the stages of blastokinesis, completion of blastokinesis and tenidium formation, respectively
(according to Kuwana et al. 1968). L4, L5 and P present fourth and fifth larval instar, and pupal development, respectively. Numbers in the each stage refer to the day
in the corresponding developmental stage. Total RNA was extracted from the whole bodies of E, L1, L2 and L3, as well as from the brains of L4, L5 and P. Expression
levels were normalized to the expression of the silkworm BmG3PDH gene. Each point represents the mean values of three different experiments with the S.D. shown
by a vertical bar.
40
Archives of Insect Biochemistry and Physiology, May 2009
Archives of Insect Biochemistry and Physiology
Cloning and Characterization of Bombyx mori CREB
41
DISCUSSION
CREB family is an important transcription factor of stimulus-induced nuclear
responses which underlies the development, function, and plasticity of the nervous
system (Yin et al., 1995a; Belvin et al., 1999; Lonze and Ginty, 2002). In the present
study, we cloned a full-length CREB cDNA from B. mori brains and identified three
CREB transcripts designated as BmCREB1, BmCREB2 and BmCREB3 which are
products from various splicing events. The deduced amino acid sequence of BmCREB
contains a bZIP and phosphorylation domain (P box) which is highly conserved in Apis
CREB and Drosophila CREB, as well as in mammalian CREB/CREM (Fig. 3A), and has
the highest similarity with Apis CREB (Fig. 3B). These results indicate that the
BmCREB we cloned in this study belongs to the member of CREB family.
In mammals and insects, several splicing variants of CREB were described to
correlate with different functional properties (Foulkes et al., 1991; Yin et al., 1995b;
Walker et al., 1996; Eisenhardt et al., 2003; Eisenhardt et al., 2006). Although we
found two clones (gb|AADK01021465.1| and gb|AADK01008237.1|) in the silkworm
genomic database, in which nine exons of BmCREB were separated (Fig. 2), we
speculate that they are one gene because the exon 5 and exon 6 of BmCREB exist in
one transcript, suggesting that the BmCREB gene is a single copy gene. Thus, we
believe that at least four BmCREB variants derive from one BmCREB gene by different
splicing. BmCREBN is a spliced product in 50 UTR region and others are spliced in
ORF (Fig. 2). BmCREB2 variant lacks the bZIP domain of deduced protein (Fig. 2, 3)
and this splicing pattern is also found in Drosophila CREB2 (Yin et al., 1995b), Aplysia
CREB1c (Bartsch et al., 1998) and mouse CREB Delta-14 (Sakai et al., 1999). Inclusion
or exclusion of exons is critical for the function of the encoded proteins. For example,
the different variants of CREB in Drosophila serve as molecular switchs and regulate
memory formation in nervous system (Yin et al., 1995a; Lonze and Ginty, 2002). A
definite statement about the transactivation abilities of the BmCREBs requires further
studies.
CREB family members are required in the nervous system for developmental
processes (Bonni et al., 1999; Riccio et al., 1999) and for formation of long-term
memory (Yin et al., 1994; Yin et al., 1995a; Brightwell et al., 2007). In the process of
memory formation, both new protein synthesis and new gene transcription occur and
then synaptic plasticity changes (Tull, 1997; Miyamoto, 2006). The diapause
characteristic in B. mori indicates that the embryonic diapause is induced by DH
secreted from SG under the control of brain and requires a long-lasting preservation
for environmental signals (Hasegawa, 1957; Yamashita and Hasegawa, 1985; Imai
et al., 1991). In present study, we speculate that BmCREB plays a role in gating
physiology and development of the silkworm, and also in the process of diapause
induced by environments. The expression of BmCREB mRNA in the silkworm brains
showed significant higher in the diapause type silkworm than non-diapause type in
almost all the stages of development (Fig. 4). Furthermore, two peaks of BmCREB
mRNA expression were detected in tenidium formation stage of the embryogenesis
and during pupal stage in the diapause type silkworm, while no obvious peaks in the
non-diapause type silkworm (Fig. 4). Interestingly, the tenidium formation and late
stages of embryogensis are sensitive periods for receiving environmental signals to
determine whether its offsprings are diapause or non-diapause (Hasegawa, 1957;
Yamashita and Hasegawa, 1985). Meanwhile, pupal-adult development is a key stage
during which DH is synthesized and secreted that leads to the egg diapause (Yamashita
Archives of Insect Biochemistry and Physiology
42
Archives of Insect Biochemistry and Physiology, May 2009
and Hasegawa, 1985; Kitagawa et al., 2005). The sustained high expression of the
BmCREB in the diapause type silkworm, especially at the two critical stages suggested
that the activation of BmCREB in transcriptional level is related to the diapause signal
reception in embryogenesis and retrieval in pupal stage. Although it is unknown
whether or how BmCREB is participated in the B. mori diapause determination
induced by environmental stimuli in manner of memory formation, our present study
indicated that BmCREB would be a clue to elucidate an upstream process from the
receptions of environmental stimuli during embryogenesis to preservation and
transmission of the information in pupal brains.
ACKNOWLEDGMENTS
We thank Prof. Yong-Hua Ji, Shanghai University, China for encouragement and
helpful advice on the manuscript. This work was supported by the National Basic
Research Program of China (2006CB500801) and grant from the Education
Committee of Shanghai (06AZ056).
LITERATURE CITED
Bartsch D, Casadio A, Karl KA, Serodio P, Kandel ER. 1998. CREB1 encodes a nuclear activator,
a repressor, and a cytoplasmic modulator that form a regulatory unit critical for long-term
facilitation. Cell 95:211–223.
Belvin MP, Zhou H, Yin JC. 1999. The Drosophila dCREB2 gene affects the circadian clock.
Neuron 22:777–787.
Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME. 1999. Cell survival
promoted by the Ras-MAPK signaling pathway by transcription -dependent and
-independent mechanisms. Science 286:1358–1362.
Brightwell JJ, Smith CA, Neve RL, Colombo PJ. 2007. Long-term memory for place learning is
facilitated by expression of cAMP response element-binding protein in the dorsal
hippocampus. Learn Mem 14:195–199.
Brindle P, Linke S, Montminy M. 1993. Protein-kinase-A-dependent activator in transcription
factor CREB reveals new role for CREM repressors. Nature 364:821–824.
Eckner R, Ewen ME, Newsome D, Gerdes M, Decaprio JA, Lawrence JB. and Livingston DM.
1994. Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD
protein (p300) reveals a protein with properties of a transcriptional adapter. Genes Dev 8:
869–884.
Eisenhardt D, Friedrich A, Stollhoff N, Müller U, Kress H and Menzel R. 2003. The AmCREB
gene is an ortholog of the mammalian CREB/CREM family of transcription factors and
encodes several splice variants in the honeybee brain. Insect Mol Biol 12: 373–382.
Eisenhardt D, Kuhn C, Leboulle G. 2006. The PKA-CREB system encoded by the honeybee
genome. Insect Mol Biol 15:551–561.
Fiol CJ, Williams JS, Chou CH, Wang QM, Roach PJ, and Andrisani OM. 1994. A secondary
phosphorylation of CREB341 at Ser129 is required for the cAMP-mediated control of gene
expression. A role for glycogen synthase kinase-3 in the control of gene expression. J Biol
Chem. 269: 32187–32193.
Foulkes NS, Borrelli E, Sassone-Corsi P. 1991. CREM gene: use of alternative DNA-binding
domains generates multiple antagonists of cAMP-induced transcription. Cell 64:739–749.
Gonzalez GA, Montminy MR. 1989. Cyclic AMP stimulates somatostatin gene transcription by
phosphorylation of CREB at serine 133. Cell 59:675–680.
Archives of Insect Biochemistry and Physiology
Cloning and Characterization of Bombyx mori CREB
43
Hai T, Hartman MG. 2001. The molecular biology and nomenclature of the activating
transcription factor/cAMP responsive element binding family of transcription factors:
activating transcription factor proteins and homeostasis. Gene 273:1–11.
Hasegawa K. 1957. The diapause hormone of the silkworm, Bombyx mori. Nature
179:1300–1301.
Hendricks JC, Williams JA, Panckeri K, Kirk D, Tello M, Yin JC, Sehgal A. 2001. A non-circadian
role for cAMP signaling and CREB activity in Drosophila rest homeostasis. Nat Neurosci
4:1108–1115.
Hoeffler JP, Meyer TE, Yun Y, Jameson JL, Habener JF. 1988. Cyclic AMP-responsive DNAbinding protein: structure based on a cloned placental cDNA. Science 242:1430–1433.
Ikeda M, Su ZH, Saito H, Imai K, Sato Y, Isobe M, Yamashita O. 1993. Induction of embryonic
diapause and stimulation of ovary trehalase activity in the silkworm, Bombyx mori, by
synthetic diapause hormone. J. Insect Physiol 39: 889–895.
Imai K, Konno T, Nakazawa Y, Komiya T, Isobe M, Koga K, Goto T, Yaginuma T, Sakakibara K,
Hasegawa K, Yamashita O. 1991. Isolation and structure of diapause homone of the
silkworm, Bombyx mori. Proc Jap Acad Ser. B67:98–101.
Kitagawa N, Shiomi K, Imai K, Niimi T, Yaginuma T, Yamashita O. 2005. Establishment of a
sandwich ELISA system to detect diapause hormone, and developmental profile of
hormone levels in egg and subesophageal ganglion of the silkworm, Bombyx mori. Zoolog Sci
22:213–221.
Kuwana J, Takami T. Insecta (Kume M, Dan K, eds). Garland NY: Invertebrate Embryology
1968: 86–116.
Kwok RPS, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SGE,
Green MR, Goodman RH. 1994. Nuclear protein CBP is a coactivator for the transcription
factor CREB. Nature 370:223–226.
Landschulz WH, Johnson PF, McKnight SL. 1988. The leucine zipper-a hypothetical structure
common to a new class of DNA binding proteins. Science 240:1759–1764.
Lonze BE, Ginty DD. 2002. Function and regulation of CREB family transcription factors in the
nervous system. Neuron 35:605–623.
Matsutani Y, Sonobe H. 1987. Control of diapause-factor secretion from the suboesophageal
ganglion in the silkworm, Bombyx mori: the role the protocerebrum and triocerebrum.
J Insect Physiol 33:279–285.
Mayr B, Montminy M. 2001. Transcriptional regulation by the phosphorylation -dependent
factor CREB. Nat Rev Mol Cell Biol 2: 599–609.
Miyamoto E. 2006. Molecular mechanism of neuronal plasticity: induction and maintenance of
long-term potentiation in the hippocampus. J Pharmacol Sci 100:433–442.
Quinn PG. 1993. Distinct activation domains within cAMP response element-binding protein
(CREB) mediate basal and cAMP-stimulated transcription. J Biol Chem 268:16999–17009.
Riccio A, Ahn S, Davenport CM, Blendy JA, Ginty DD. 1999. Mediation by a CREB family
transcription factor of NGF-dependent survival of sympathetic neurons. Science
286:2358–2361.
Ruppert S, Cole TJ, Boshart M, Schmid E, Schutz G. 1992. Multiple mRNA isoforms of the
transcription activator protein CREB: generation by alternative splicing and specific
expression in primary spermatocytes. EMBO J 11:1503–1512.
Sakai N, Tolbert LM, Duman RS. 1999. Identification and functional analysis of novel cAMP
response element binding protein splice variants lacking the basic/leucine zipper domain.
Mol Pharmacol 56:917–925.
Song HS, An Y, Suzuki K. 2007. Dynamic changes of free nucleotides in the silkworm
undergoing embryonic diapause induced by environmental factors. Fen Zi Xi Bao Sheng
Wu Xue Bao 40:91–97.
Archives of Insect Biochemistry and Physiology
44
Archives of Insect Biochemistry and Physiology, May 2009
Stehle JH, von Gall C, Korf HW. 2001. Analysis of cell signalling in the rodent pineal gland
deciphers regulators of dynamic transcription in neural/endocrine cells. Eur J Neurosci
14:1–9.
Su ZH, Ikeda M, Sato Y, Saito H, Imai K, Isobe M, Yamashita O. 1994. Molecular
characterization of ovary trehalase of the silkworm, Bombyx mori and its transcriptional
activation by diapause hormone. Biochim Biophys Acta 1218:366–374.
Tull T. 1997. Regulation of gene expression of its roles in long-term memory and synaptic
plasticity. Proc Natl Acad Sci USA 94:4239–4241.
Walker WH, Girardet C, Habener JF. 1996. Alternative exon splicing controls a translational
switch from activator to repressor isoforms of transcription factor CREB during
spermatogenesis. J Biol Chem 271:20145–21050.
Watanabe K. 1924. Studies on the voltinism of the silkworm, Bombyx mori. Bull Seric Exp Stn
6:411–455.
Xu WH, Sato Y, Ikea M, Yamashita O. 1995. Stage-dependent and temperature- controlled
expression of the gene encoding the precursor protein of diapause hormone and
pheromone biosynthesis activating neuropeptide in the silkworm, Bombyx mori. J Biol
Chem 24:3804–3808.
Yamashita O. Hasegawa K. 1985. Embryonic diapause. In Comprehensive Insect Physiology,
Biochemisty and Pharmacology (Kerkut GA, Gilbert LI. eds), Oxford: Pergamon Press
1:407–434.
Yin JC, Del Vecchio M, Zhou H, Tully T. 1995a. CREB as a memory modulator: induced
expression of a dCREB2 activator isoform enhances long-term memory in Drosophila. Cell
81:107–115.
Yin JC, Wallach JS, Del Vecchio M, Wilder EL, Zhou H, Quinn WG, Tully T. 1994. Induction of a
dominant negative CREB transgene specifically blocks long-term memory in Drosophila.
Cell 79:49–58.
Yin JC, Wallach JS, Wilder EL, Klingensmith J, Dang D, Perrimon N, Zhou H, Tully T, Quinn
WG. 1995b. A Drosophila CREB/CREM homolog encodes multiple isoforms, including a
cyclic AMP-dependent protein kinase-responsive transcriptional activator and antagonist.
Mol Cell Biol 15:5123–5130.
Archives of Insect Biochemistry and Physiology
Документ
Категория
Без категории
Просмотров
4
Размер файла
2 019 Кб
Теги
cloning, molecular, morie, characterization, genes, creb, bombyx
1/--страниц
Пожаловаться на содержимое документа