close

Вход

Забыли?

вход по аккаунту

?

Molecular cloning and expression of protein kinase C from Bombyx mori.

код для вставкиСкачать
Archives of Insect Biochemistry and Physiology 61:65� (2006)
Molecular Cloning and Expression of
Protein Kinase C From Bombyx mori
1
1
Tomohide Uno, * Atsushi Nakao,
1
Nakada,
and Osamu Itoh
1
2
Yoshihiro Fujiwara,
1
Chisato Katsurauma,
Takuya
Two partial cDNA clones (Protein kinase C alpha and Protein kinase C iota), each of which encoded a different member of PKCprotein family, were isolated using RT-PCR from mRNA of Bombyx mori. The full-length cDNAs were isolated using SMARTRACE. The cDNAs were expressed in HepG2 cells and the recombinant proteins were partially purified using an affinity
chromatography. Protein kinase C alpha (BPKC alpha) showed a calcium-dependent kinase activity of histones. Whereas
protein kinase C iota (BPKC iota) showed a calcium-independent activity. Bisindolyl maleimide I, a PKC inhibitor, inhibited
these kinase activities. Furthermore, in vitro BPKC alpha interacted and phosphorylated two proteins expressed in the brain of
Bombyx mori: Rab protein, which plays important roles in the vesicle transport in the brain, and bMBD2/3, which is a methyl
DNA-binding protein and regulates transcription. These results suggest that these PKCs phosphorylate various substrate proteins and function in the brain of Bombyx mori. Arch. Insect Biochem. Physiol. 61:65�, 2006.
� 2006 Wiley-Liss, Inc.
KEYWORDS : Bombyx mori; brain; phosphorylation; protein kinase C
INTRODUCTION
PKCs share the same kinase domain and ATP binding site; they differ in their N-terminal domain that
Protein kinase C (PKC) is a serine/threonine
protein kinase that plays many roles in the regulation of growth and differentiation. Following acti-
regulates the catalytic domains and carries the calcium and diacyl glycerol binding sites.
In insects, PKC was partially purified from neu-
vation, PKC is translocated to different cellular
ral tissue of honey bee, Apis mellifera, and showed
compartments where it phosphorylates substrate
a calcium-dependent protein kinase activity (Alt-
proteins (Nishizuka, 1986). PKCs are classified in
felder et al., 1991). Furthermore, a specific substrate
three groups according to their structural and en-
for this PKC was purified to an apparent homoge-
zymatic properties (Quest, 1996). The first group,
neity
conventional PKCs (cPKCs) composed of the
(Muller, 1997). Various PKCs were identified us-
bI, bII,
g
a,
from
neuronal
tissue
of
the
honey
bee
isoforms, require calcium, diacyl-
ing a Drosophila genomic database (Morrison et al.,
glycerol, and negatively charged phospholipids for
2000). Genetic and immunostaining studies indi-
their kinase activity; the second group of novel
cate that insect PKC plays important roles in for-
PKCs (nPKCs),
aging behavior, learning, and memory (Humphries
and
d, e, q, and h, require diacylglycerol
and negatively charged phospholipids; and the
et al., 2003; Choi et al., 1991; Alshuaib et al.,
third group of atypical PKCs (aPKCs)
2004). Recent reports indicate that PKC is essen-
i, z, l, and m
only require negatively charged phospholipids. All
1
2
tial to cell polarity in epithelial cells, neuroblasts,
Laboratory of Biological Chemistry, Department of Biofunctional Chemistry, Faculty of Agriculture, Kobe University, Nada-ku Hyogo, Japan
Department of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda, Nagano, Japan
*Correspondence to: T. Uno, Laboratory of Biological Chemistry, Department of Biofunctional Chemistry, Faculty of Agriculture, Kobe University,
Nada-ku Hyogo 657-8501, Japan. E-mail: unotom@kobe-u.ac.jp
Received 5 January 2005; Accepted 2 August 2005
� 2006 Wiley-Liss, Inc.
DOI: 10.1002/arch.20098
Published online in Wiley InterScience (www.interscience.wiley.com)
66
Uno et al.
and oocytes (von Stein et al., 2005; Hutterer et al.,
Isolation of cDNA Clones
2004; Betschinger et al., 2005; Djiane et al., 2005),
synapse development (Ruiz-Canada et.al., 2004),
The fat body was dissected from 50 silkworms
and diuretic activity by diuretic hormone (Tobe et
in sterile PBS (50 mM sodium phosphate, pH 7.5,
al., 2005).
and 150 mM NaCl), frozen rapidly in liquid nitro-
In Bombyx mori, inhibitors specific to PKC in-
gen, and stored at �癈 until use. Total RNA was
hibited the secretion of prothoracicotropic hor-
prepared by the acid guanidine phenol extraction
mone, a neuropeptide related to metamorphosis,
method using Sepasol (Nakalai Tesque, Kyoto, Ja-
from the brain to the hemolymph (Shirai et al.,
pan). Day-2 fifth instar larvae were used for cDNA
1997).
protein
cloning. Poly (A) RNA was isolated from total RNA
kinase phosphorylated BRab proteins, which regu-
using a GENE Elute TM mRNA mini prep kit
late
neuro-
(Sigma) according to the manufacturer抯 protocol.
transmitters, or neuropeptides in the neural cell
Powerscript reverse transcriptase (BD Biosciences,
(Uno and Hiragaki, 2003; Uno et al., 2004). Thus,
Palo Alto, CA) was used to synthesize cDNA. cDNA
PKC is important to the neuropeptide or protein
was amplified using degenerate PCR primers de-
secretion of the insect brain. But there is no re-
duced from the PKC amino acid sequences of other
port to express insect protein kinase C in mam-
species. The BPKC alpha cDNA was amplified us-
malian cells and examine the characters of the
ing primers cPKC-1 and cPKC-2. The BPKC iota
expressed insect PKCs.
cDNA was amplified using primers aPKC-1 and
In
the
addition,
vesicle
partially
transport
of
purified
proteins,
+
In this study, two cDNAs (BPKC alpha and
aPKC-2. PCR was performed in a 25-ml volume con-
iota) of PKC were isolated from Bombyx mori. The
taining 70 pmol of each of the primers, 0.25 U of
cDNAs were expressed in mammalian cells. The
KOD plus polymerase (Toyobo, Tokyo, Japan), 200
partially purified PKCs showed protein kinase ac-
nM each of dNTP, 1 mM MgCl2, and 1� accessory
tivities.
buffer. The PCR reaction was carried out in a Gene
Amp PCR system 9700 (Perkin Elmer, Shelton, CT)
with an initial incubation for 2 min at 94癈, fol-
MATERIALS AND METHODS
lowed by 15 cycles of 15 s at 94癈, 15 s at 55癈
Materials
(decreasing 1 degree per cycle), and 1 min at 68癈,
Glutathione sepharose 4B, ECL, and [g-
32
P]ATP
(>1,000 Ci/mmol) were from Amersham Pharmacia Biotech (Uppsala, Sweden). Goat peroxidaseconjugated anti-mouse IgG and mouse anti-V5
monoclonal antibody were from Cell Signaling
Technology (Beverly, MA). Ni-NTA superflow resin
was from Qiagen, Hilden, Germany. Lipofectamine
and pcDNA 3.1/V5-His-Topo were from Novagen,
Madison, WI. Histone IIIs, EGTA, and Bisindolylmaleimide I were from Sigma (St. Louis, MO). In
�
and, finally, 20 cycles of 15 s at 94癈, 15 s at 40癈,
and 1 min at 68癈. The amplified DNA fragments
were subcloned into plasmid and sequenced using
an ABI 310 or 3100 autosequencer (Perkin Elmer).
The 5� and 3� regions of PKC cDNAs were obtained
using the SMART RACE cDNA amplification kit
(BD Biosciences) according to the manufacturer抯
instructions.
The 5� and 3� region of BPKC alpha was amplified with primer cPKC-3 and cPKC-4, respectively.
Nested PCR was performed with primers cPKC-5
Showa
(5�) and cPKC-6 (3�). The 5� and 3� region of BPKC
Shogetsu) of the silkworm, Bombyx
iota was amplified with primer aPKC-3 and aPKC-
mori. The larvae were reared on an artificial diet
4, respectively. Nested PCR was performed with
(Silkmate 2M, Nosan Co., Yokohama, Japan) at
primers aPKC-5 (5�) and aPKC-6 (3�). Finally, the
25癈 under 16L-8D lighting conditions and at 70%
whole coding regions of the BPKC alpha and BPKC
relative humidity. The other chemicals were of the
iota were cloned using primer pairs cPKC-7 and
purest grade commercially available.
cPKC-8, and pairs aPKC-7 and aPKC-8, respectively.
this study, we used a hybrid race (Kinshu
or Shunrei
�
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Protein Kinase C From Bombyx mori
PCR was performed with an initial incubation for
�
�
2 min at 94 , followed by 10 cycles of 10 s at 94 C,
�
15 s at 68 C (decreased at 1 degree per cycle), and
�
3 min at 68 C, and, finally, 30 cycles of 10 s at
�
�
�
94 C, 15 s at 58 C, and 3 min at 68 C.
The primers used (Sigma) are (Y=T or C; R=A
or G; M=A or C; D=A, G or T; N=A, C, G or T):
67
(pH7.6), 10 mM KCl, 1.5 mM MgCl2, 1 mM DTT,
1% NP40 and protease inhibitor cocktail], homogenized,
and
then
cleared
by
centrifugation
at
12,000g for 30 min. The fusion protein was bound
to a Ni-NTA superflow resin equilibrated with
buffer A. After washing, proteins were eluted with
a step-wise increase in imidazole. The sample was
�
cPKC-1; MGNAAYGAYTTYATGGG,
stored at � C. Proteins were determined using
cPKC-2; TCYTTRCACATNCCRAARTC,
BSA (Fraction V, Sigma) as the standard by the
cPKC-3; TGAACGGAGGTGATCTGATG,
method of Lowry et al. (1951).
cPKC-4; CAACGTCATCGTCCTGAATG,
cPKC-5; AATTCAAGGAACCCGTAGCC,
Western Blotting
cPKC-6; CACCGTTGTAGCCCTCATCT,
cPKC-7; GCAGTCTTGCGAGTAGTTGCCTGTG,
Proteins were separated on a 15% polyacryla-
cPKC-8; CCTCTATTTCATTGTGCCATTCACG,
mide gel and blotted using a standard procedure
aPKC-1; GAYGARGAYATHGAYTGGGT,
(Laemmli, 1970). As primary antibody, we used
aPKC-2; TCYTTRCACATNCCRTARTC,
1:5,000 diluted anti-V5 antibody. As secondary an-
aPKC-3; ACGTTGTCCAGCTTGAGGTC,
tibody we used 1:5,000 diluted anti-mouse IgG
aPKC-4; AGGACATCGACTGGGTTCAG,
coupled to peroxidase. Protein bands were visual-
aPKC-5; TGACGAACTCGATCACGAAG,
ized using ECL Western blotting detection reagent.
aPKC-6; CTTCCAAACACCGAGCAGAT,
aPKC-7; TTCTTTTGAGGGCAACGGTTTATTA,
GST-Pull Down Assay
aPKC-8; TTCGCTCGCTCTCGCCATTTTGAAT.
The cDNA fragments containing the entire codConstruction of Expression Plasmid and
ing sequence of bMBD2/3 and BRab14 were am-
Expression of cDNA for BPKCs in HepG2 Cells
plified by PCR with primers containing BamHI or
EcoRI as described previously (Uno et al., 2005).
HepG2 cells were cultured in minimal essential
The amplified fragments were digested with BamHI
medium supplemented with 10% fetal bovine se-
and EcoRI. The digested fragment was inserted into
rum and antibiotics (100 U/ml penicillin and 100
the BamHI and EcoRI sites of an expression vector
streptomycin) on plastic dishes (10-cm di-
in Escherichia coli, pGEX6P2 (Amersham Pharama-
ameter). The cDNA fragments containing the entire
cia). The cDNA was transformed into E. coli strain
coding sequence of BPKC alpha and BPK iota were
BL21. Transformed E. coli cells (BL21) were pre-
amplified by PCR and the amplified fragment was
incubated at 37 C overnight in LB medium. The
subcloned into an mammalian expression vector,
medium was diluted to 1:100 and incubated at
pcDNA3.1/V5-His-TOPO. This cDNA was trans-
37 C for 3 h.
mg/ml
�
�
formed into HepG2 cells using Opti MEM medium
The culture was 3 liters. Expression of fusion
(Gibco BRL, Gaithersburg, MD) and lipofectamine.
protein was then induced by adding 1 mM isopro-
Sixteen hours after transfection, the medium was
pyl
changed and cells were incubated for another 48 h.
additional incubation for 24 h at 16 C . The cells
The cells were collected by centrifugation at 5,000g
were collected by centrifugation at 5,000g for 5
for 5 min, and then stored at � .
min, and then stored at � C. The frozen cells
�
b-D-thiogalactopyranoside (IPTG), followed by
�
�
were suspended in phosphate-buffered saline (PBS)
Partial Purification of PKCs
[140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,
�
All procedures were carried out at 4 C . The frozen cells were suspended in buffer A [10 mM Hepes
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
and 1.8 mM KH2PO4 (pH7.3)], disrupted for 1 min
three times by sonication and then cleared by centrifugation at 12,000g for 30 min.
68
Uno et al.
Fig. 1.
Nucleotide and deduced amino acids sequences
of BPKC alpha (
A)
and BPKC iota (
B).
The nucleotide
and predicted amino acid sequences of the cDNA clone
encoding the protein, BPKC alpha and BPKC iota, are
shown. The arrows indicate the forward and reverse primers for RT-PCR.
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Protein Kinase C From Bombyx mori
69
The fusion protein was applied to a resin bed,
1 ml of glutathione sepharose equilibrated with
PBS. The resin was washed with 20 ml of PBS four
times and used for interacting with BPKCs translated in vitro. Glutathione beads bound to glutathione sulfotransferase (GST) were prepared
using a similar method. Next, cDNAs for BPKC alpha and iota were amplified and subcloned into
pcDNA3.1/V5-His-TOPO
vectors
as
described
above. V5-peptide-tagged BPKC proteins were expressed in vitro using the TNT-coupled reticulocyte system (Promega, Madison, WI; see Fig. 5,
Input). In vitro translated BPKC (25 microliter) was
diluted 40 times with PBS containing 0.2% NP40.
The dilute was mixed with 25 microliter of fusion protein or GST on a glutathione S-sepharose
resin at room temperature for 60 min. After washing four times with 1 ml of PBS containing 0.2%
NP40, proteins were extracted from the resin with
SDS-PAGE sample buffer, separated on a 15% Trisglycine SDS-PAGE gel, and transferred to a nitrocellulose membrane. After blocking, the membrane was
incubated with mouse anti-V5 antibody (1:5,000).
Protein bands were visualized using ECL Western
blotting detection reagent and goat peroxidase-conjugated anti mouse IgG as secondary antibody.
Protein Kinase Assay
The typical reaction mixture with a total volume of 20
TABLE 1.
ml contained 50 mM Tris-HCl (pH 7.5),
Percent Identities of Amino Acid Sequences Deduced From the
Nucleotide Sequences of BPKCs Fragments to Those of the
Corresponding Positions of PKCs*
BPKC
HPKC
b
b
g
d
e
z
h
q
i
m
Figure 1 (continued)
69.6
BPKCi
48.5
l
68.0
50.4
ll
68.0
50.4
64.3
48.4
56.8
39.7
41.9
49.6
45.1
63.4
56.1
45.3
40.5
36.3
50.0
68.4
29.5
21.6
74.4
50.3
44.8
75.8
DPKC
i
a
a
a
*Nucleotide sequences of PKCs were obtained from the GenBank database. HPKC
from Homo sapiens, DPKC from Drosophila melanogaster.
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
70
Uno et al.
Fig. 2.
Comparison of the
deduced amino acid sequence
of BPKC alpha (
A) and BPKC
B) with those of BPKCs.
iota (
DPKC and HPKC from Droso-
phila melanogaster and Homo
sapiens, respectively. The regions
such as the catalytic domain
(CD), cysteine-rich domain
(CRD), and calcium-binding
domain (C2) are boxed.
10 mg/ml phosphatidyl serine, 1 mg/ml dioleine,
RESULTS
6.25 mM MgCl2, 0.125 mM CaCl2, 2 mM dithio-
Isolation of cDNA Clones
threitol, 0.1 mM EDTA , 0.1 or 0.5
mg protein, 0.2
mM [g-32P] ATP. After in-
To obtain the partial sequences of PKCs of
cubation at 30癈 for 15 min, the samples were
Bombyx mori, we synthesized forward and reverse
treated with SDS-sample buffer. After electrophore-
oligonucleotide primers for the RT-PCR, based on
sis, the gel was dried and analyzed by a bioimaging
PKC alpha and PKC iota from the other species
analyzer (BAS 1000, Fujix, Tokyo, Japan). The po-
(Fig. 1). Next, we did RT-PCR using mRNA from
sition of protein on a gel was identified by Coo-
Bombyx mori. The amplified fragments were sub-
masie Brilliant Blue staining. BRab14, BRab8, and
cloned and sequenced.
U protein kinase, and 10
bMBD2/3 proteins were purified as described previously (Uno et al., 2005).
As a result, the partial cDNA fragments coding
PKCs were isolated from Bombyx mori. Next, Smart
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Protein Kinase C From Bombyx mori
71
Figure 2 (continued)
RACE (Rapid Amplification of cDNA Ends) was
insect PKCs (Fig. 2). Furthermore, BPKC iota had
done to get the full-length cDNAs of BPKCs. Finally,
a cysteine-rich domain (CRD) and BPKC alpha had
two clones (BPKC alpha and BPKC iota) from
this site and a calcium-binding site.
Bombyx mori were identified and sequenced (Fig. 1).
Their inserts are 2.52 and 2.98 k bp long, re-
Expression of cDNA for BPKCs in Hep G2
spectively, including the poly A tail. BPKC alpha
Cells and Partial Purification of the
and BPKC iota bear an open reading frame corre-
His-Tagged Protein
sponding to aa 719 and 585, respectively. Compared to the other PKCs, BPKC alpha and BPKC
The mammalian PKCs, which were expressed
iota showed 74.4 and 75.8% similarity to Droso-
in E. coli, do not show protein kinase activity, be-
phila PKCs (Table 1). All of the protein kinase C抯
cause autophosphorylation of PKC is necessary to
have a conserved motifs, which is a catalytic site
change to the activated form (Flipuzzi et al.,1993;
containing the ATP binding site(Quest, 1996).
Dietrich et al., 1989). Probably, insect PKC expres-
These sites of BPKCs were conserved among these
sed in E. coli is thought not to show an activity, so
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
72
Uno et al.
we tried to express BPKCs in mammalian cells
Inhibitions of activity by these reagents were ex-
(HepG2 cells). At first, the cDNAs for BPKC alpha
amined. As a result, activity of BPKC alpha was
and BPKC iota were inserted into an expression
inhibited by EGTA and BM (Fig. 4A, lanes 3 and
vector and expressed in mammalian cultured cells
4), whereas BPKC iota was inhibited by BIM (Fig.
as V5 and His-tagged fusion protein. The fusion
4B, lanes 3 and 4). As BPKC iota does not have a
protein was extracted with buffer containing 1%
calcium-binding site at the primary structure (Fig.
NP40 from the cell and partially purified using a
2), the activity of the expressed BPKC iota was
Ni-superflow column. Immunoblotting using an
thought to be independent on calcium ion.
antibody against the V5-tag peptide indicated that
BPKC alpha and BPKC iota were detected (Fig. 3).
Characteristics of BPKCs
Phosphorylation of histones.
To examine whether
the expressed BPKCs in mammalian cells show protein kinase activity or not, the protein kinase activity was assayed. Histone III was used as a typical
substrate. Both BPKC alpha and BPKC iota showed
protein kinase activities of histone (Fig. 4; lanes 1
and 2). These results indicate that the two insect
PKCs, which were expressed in mammalian cells,
show protein kinase activities.
Inhibition of Kinase Activity
Using a Specific Inhibitor
Kinase activity of mammalian PKC was inhibited by EGTA, calcium chelator, and bisindolylmaleimide I (BM), a PKC inhibitor (Beltman et al., 1996).
Fig. 4.
Phosphorylation of histones using BPKCs. BPKC
Immunoblotting of par-
[BPKC alpha (A) or BPKC iota (B)] was incubated in his-
tially purified BPKCs. The cDNAs
tones, 25 mM Tris HCl (pH 7.5), 1 mg/ml diacyl glyc-
were expressed in HepaG2 cells as
erol, 10 mg/ml phosphatidyl serine, 6.25 mM MgCl2, and
V5- and His-tagged fusion proteins.
0.125 mM CaCl2 and 50
The solubilized fraction was ap-
min. The samples were treated with SDS-sample buffer.
plied to a Ni-resin. The eluate was
The gel was autoradiographed. Lane 1: -histone; Lane 2:
elelctrophoresed and immunoblot-
+ histone; Lane 3: EGTA was added as calcium chelator;
Fig. 3.
mM[g-
32
P]ATP at 25癈 for 25
ted using anti-V5 antibody. Lane1,
Lane 4: Bisinodolyl maleimide I (1
BPKC alpha; Lane2, BPKC iota.
PKC inhibitor.
Archives of Insect Biochemistry and Physiology
mM)
was added as a
February 2006
doi: 10.1002/arch.
Protein Kinase C From Bombyx mori
73
Interaction of Various Proteins
BPKCs and proteins such as bMBP2/3 and BRab14
From the Brain
were examined using the GST pull-down assay (Fig.
5). BPKC was translated as a V5-tagged protein in
We found that various proteins from the brain
vitro
and
incubated
with
GST-fusion
protein
of Bombyx mori were phosphorylated by protein ki-
(Rab14 or bMBD2/3) bound on a glutathione
nase C, which was partially purified from the brain
sepharose. After washing, the bound BPKC was de-
of Bombyx mori (Uno et al., 2004).
tected using V5 antibody. BRab8 was not expressed
Rab proteins regulate the transport of the neu-
as a GST fusion protein in E. coli. Only BRab14
ropeptide and protein in the cell (Stenmark et al.,
was tried as fusion protein of rab proteins. As a
2001; Tang, 2001). Lately, it was reported that rab
result, BPKC alpha and BPKC iota did not interact
proteins were phosphorylated by various protein ki-
with glutathione sulfotransferase (GST) as a con-
nases such as PKC and the activation of protein ki-
trol (Fig. 5; lane 2) but interacted with bMBD2/3
nase regulated the protein transport (Bailly et al.,
(Fig. 5; lane 3) and BRab14 (Fig. 5; lane 4).
1991; Chiariello et al., 1999; Fitzgerald and Reed,
1999). Mammalian PKC iota was reported to inter-
Phosphorylation of Various
act rab2 protein and regulate the protein transport
Proteins by BPKC Alpha
in the early secretory pathway (Tisdale, 2003),
whereas insect MBD2/3 is a methyl DNA binding
The extract from insect brain showed a calcium-
proteins to bind methyl CpG containing DNA and
dependent protein kinase activity of BRabs and
regulate the transcription of the gene. DNA methy-
bMBD2/3 (Uno et al., 2005).
lation modified by DNA methyl transferase has been
Calcium-dependent phosphorylation of pro-
implicated in the regulation of a number of genetic
teins in the brain of Bombyx mori was shown to be
activities during embryo development and cell dif-
important to neuropeptide secretion from the brain
ferentiation (Li et al., 1992; Okano et al., 1999).
into the hemolymph (Shirai et al., 1997). There-
protein
fore, the phosphorylation of BRab8, BRab14, and
(MeCP2) plays important roles in brain develop-
Mammalian
methyl
DNA-binding
bMBP2/3 by BPKC alpha, which has a calcium-
ment and is regulated by phosphorylation (Chen
binding domain and shows a calcium-dependent
et al., 2003). bMBD2/3 was phosphorylated by pro-
activity, were examined in vitro using [g-
tein kinase from the brain of Bombyx mori (Uno et
(Fig. 6). As a result, BPKC alpha phosphorylated
al., 2005). Thus, the interactions between the
all of them. The expressed BPKCs were suggested
Fig. 5.
32
P] ATP
GST pull-down assay of
BPKCs. cDNAs of BPKCs [BPKC alpha ( A ) or BPKC iota ( B )] were
transcribed and translated as V5tagged
proteins
in
vitro.
Gluta-
thone-sepharose binding GST (Lane
2 ), GST-bMBD2/3 (Lane 3), and
GST-BRab14 proteins (Lane 4) were
bound with the translated BPKC
(Lane 1). BPKC proteins interacting
these GST proteins were detected
using V5 antibody.
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
74
Uno et al.
to phosphorylate various substrates from the brain
and regulate protein transport or transcription of
gene in the brain by calcium-dependent signal
transduction.
DISCUSSION
Insect PKCs were isolated and analyzed from
Drosophila and other insects (Altfelder et al., 1991;
Morrison et al., 2000). A genetic approach indicates that insect PKCs relate learning and behavior
(Rui-Canada et al., 2005; Humphries et al., 2003;
Choi et al., 1991). Recently, it was reported that
insect PKC is related to the cell polarity of eye,
asymmetric cell division, and signal transduction
Fig. 6.
for diuretic peptides (Betschinger et al., 2005;
alpha was incubated in proteins (Lane 1: substrate; Lane
Djiane et al., 2005; von Stein et al., 2005; Tobe et
al., 2005). PKC regulates many important signal
Phosphorylation of BRabs and bMBD2/3. BPKC
2: BRab8; Lane 3: BRab14; Lane 4: bMBD2/3), 25 mM
Tris HCl (pH 7.5), 1 mg/ml diacyl glycerol, 10 mg/ml
phosphatidyl serine, 6.25 mM MgCl 2, and 0.125 mM
transactions in the insect brain.
There is little data on phosphorylate substrates
of the insect brain in vitro. We examined whether
CaCl 2 and 50
mM
[g-
32
P]ATP at 25 癈 for 25 min. The
samples were treated with SDS-sample buffer. The gel was
autoradiographed.
insect PKCs phosphorylate substrates in vitro or
not. As shown in Figure 1, two cDNAs for PKC of
insect (BPKC alpha and BPKC iota) were isolated
using RT-PCR and RACE. PKC alpha phosphory-
the cultured cells (Hattula et al., 2002). Insect PKC
lates in a calcium-dependent manner containing
may regulate the neuropeptide secretion to cause
signal transduction (Quest, 1996) and atypical
phenomena such as metamorphosis and diapause
PKC containing PKC iota regulates cell polarity
by phosphorylating rab8 proteins. Rab proteins
and synaptic plasticity (Betschinger et al., 2005;
have conserved GTP binding, GTPase, and effec-
Djiane et al., 2005). These BPKCs were expressed
tor-binding domains (Stenmark et al., 2001; Oster-
in mammalian cells and partially purified. BPKC
meier and Brunger, 1999). The determination of
alpha showed a calcium-dependent kinase activ-
phosphorylated residues of rab8 is in progress to
ity
examine the functional change of rab8 by phos-
for
histone,
whereas
BPKC
iota
showed
a
calcium-independent activity (Fig. 4). Further-
phorylation.
more, GST pull-down experiments (Fig. 5) indi-
Insect MBD protein binds methylated DNA dur-
cate that in vitro translated BPKCs interacted with
ing embryogenesis and represses the transcription
two insect proteins, which are BRab, a small GTP-
from the methylated gene (Ballestar et al., 2001).
binding protein, and bMBD2/3, a methyl DNA-
Mammalian Methyl DNA binding protein regulates
binding
the transcription of neurohormone such as Brain
protein.
BPKC
alpha
phosphorylated
BRab and bMBD2/3 proteins (Fig. 6).
Rab proteins regulate the neuropeptide or neu-
Derived Neuropeptide Factor (BDNF) in the brain
(Chen et al., 2003).
rotransmitter transport in the brain (Tang, 2001;
bMBD2/3 has conserved motifs such as methyl
Stenmark et al., 2001). Specifically, Rab8 regulates
DNA binding and transcriptional repression do-
membrane traffic in developing neurons (Huber
mains interacting with various nuclear proteins.
et al., 1995). The distribution of mammalian Rab8
Similar to rab proteins, the determination of phos-
in the cell is changed by adding PKC activator in
phorylated amino acid residues will clarify the re-
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Protein Kinase C From Bombyx mori
75
lationship between phosphorylation and the tran-
Rab5a, Rab5b and Rab5c are differentially phosphorylated
scriptional regulation by bMBD2/3 protein.
in vitro. FEBS Lett 453:20�.
BPKC alpha phosphorylated rab proteins and
bMBD2/3 proteins in vitro. In vivo calcium-dependent phosphorylation of these proteins in the brain
must be ascertained. Immunoprecipitation of rab
and bMBP2/3 using
32
Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC,
Jaenisch R, Greenberg ME. 2003. Derepression of BDNF
transcription involves calcium-dependent phosphorylation
of MeCP2. Science 302:885�9.
P-phosphorylated proteins
in calcium-stimulated brain are necessary to clarify
the in vivo phosphorylation of these proteins.
Recently, insect atypical PKC containing PKC
iota is found to interact with various proteins such
Choi KW, Smith RF, Buratowski RM, Quinn WG. 1991. Deficient protein kinase C activity in turnip, a Drosophila learning mutant. J Biol Chem 266:15999�006.
Dietrich A, Rose-John S, Marks F. 1989. Expression of the
as Par6, Bazooka, and dPatj proteins, and to be
kinase domain of mouse protein kinase C in E.
related to cell polarity of Drosophila melanogaster
Biochem Int 19:163�2.
coli .
(Betschinger et al., 2005; Djiane et al., 2005; von
Stein et al., 2005). Further work is needed to clarify
interacting proteins with BPKC iota and the role
of BPKC iota for cell polarity in Bombyx mori.
Djiane A, Yogev S, Mlodzik M. 2005. The apical determinants
aPKC and dPatj regulate Frizzled-dependent planar cell
polarity in the Drosophila eye. Cell 121:621�1.
Fitzgerald ML, Reed GL. 1999. Rab6 is phosphorylated in
LITERATURE CITED
thrombin-activated platelets by a protein kinase C-dependent mechanism: effect on GTP/GDP binding and cellu-
Alshuaib WB, Mathew MV, Hasan MY, Fahim MA. 2004. pkc-
lar distribution. Biochem J 342:353�0.
a differentially affects rutabaga and wild-type Drosophila
neuronal potassium current. Int J Neurosci 114:607�1.
Flipuzzzi I, Fabbro D, Imber R. 1993. Unphosphorylated alpha-PKC exhibits phorbol ester binding but lacks protein
Altfelder K, Muller U, Menzel R. 1991. Ca/calmodulin and
kinase activity in vitro. J Cell Biochem 52:78�.
Ca/phospholipid-dependent protein kinases in the neural tissue of the honey bee Apis mellifera. Insect Biochem
Hattula K, Furuhjelm J, Arffman A, Peranen J. 2002. A rab8specific GDP/GTP exchange factor is involved in actin re-
21:479�6.
modeling and polarized membrane transport. Mol Biol
Bailly E, McCaffrey M, Touchot N, Zahraoui A, Goud B,
Cell 13:3268�80.
Bornens M. 1991. Phosphorylation of two small GTP-binding
proteins
of
the
Rab
family
by
p34cdc2.
Nature
Huber LA, Dupree P, Dotti CG. 1995. A deficiency of the
small GTPase rab8 inhibits membrane traffic in develop-
350:715�8.
ing neurons. Mol Cell Biol 15:918�4.
Ballestar E, Pile LA, Wassarman DA, Wolffe AP, Wade PA.
2001. A Drosophila MBD family member is a transcriptional
corepressor associated with specific genes. Eur J Biochem
Humphries MA, Muller U, Fondrk MK, Page Jr RE. 2003. PKA
and PKC content in the honey bee central brain differs in
genotypic strains with distinct foraging behavior. J Comp
268:5397�06.
Physiol A 189:555�2.
Beltman J, McCormick F, Cook SJ. 1996. The selective protein kinase C inhibitor, Ro-31-8220, inhibits mitogen-
Hutterer A, Betschiner J, Petronczki M, Knoblich JA. 2004.
cativated protein kinase phsphatase-1 (MKP-1) expression,
Sequential roles of Cdc42, Par-6, aPKC, and Lgi in the
induces c-jun expression, and activates Jun N-terminal ki-
establishment of epithelial polarity during Drosophila
nase. J Biol Chem 271:27018�024.
embryogenensis. Dev Cell 6:845�4.
Betschinger J, Eisenhaber F, Knoblich JA. 2005. Phosphoryla-
Laemmli UK. 1970. Cleavage of structural proteins during the
tion-induced autoinhibition regulates the cytoskeltal pro-
assembly of the head of bacteriophage T4. Nature 227:
tein lethal (2) giant larvae. Curr Biol 15:276�2.
680�5.
Chiariello M, Bruni CB, Bucci C. 1999. The small GTPases
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Li E, Bestor T, Jaenisch R. 1992. Targeted mutation of DNA
76
Uno et al.
methyltransferase gene results in embryonic lethality. Cell
diacum-corpus allatum complexes of silkworm, Bombyx
69:915�6.
mori. Applied Entomol Zool 32:573�1.
Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ. 1951. Protein measurement with the Folin phenol reagent. J Biol
Stenmark H, Olkkonen VM. 2001. The Rab GTPase family.
Genome Biol 2:3007.1�07.7.
Chem 193:265�5.
Tang BL. 2001. Protein trafficking mechanism associated with
Muller U. 1997. Insect protein kinase C substrate is a fila-
2+
ment interacting protein regulated by Ca
/calmodulin and
neurite outgrowth and polarized sorting in neurons. J
Neurochem 79:923�0.
phosphorylation. Brain Res 757:24�.
Tisdale EJ. 2003. Rab2 interacts directly with atypical protein
Morrison DK, Murakami MS, Cleghon V. 2000. Protein kinases and phosphatase in the Drosophila genome. J Cell
Biol 150:F57朏62.
Nishizuka Y. 1986 Studies and perspectives of protein kinase
C. Science 233:305�2.
Okano M, Bell DW, Haber DA, Li E.1999. DNA methyltransferase Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99:247�7.
Ostermeier C, Brunger AT. 1999. Structural basis of rab effector specificity: Crystal structure of the small G protein
rab3A complexed with the effector domain of rabphilin3A. Cell 96:363�4.
kinase C (aPKC) i/lamda and inhibits aPKCi/lamda-dependent glyceraldehyde-3-phosphate dehydrogenase phosphorylation. J Biol Chem 278:52524�530.
Tobe SS, Zhang JR, Schooley DA, Coast GM. 2005. A study
of signal transduction for the two diuretic peptides of
Diploptera punctata. Peptides 26:89�.
Uno T, Hiragaki S. 2003. Small GTP binding proteins: Rab
GTPases from the brain of
Bombyx mori . Arch Insect
Biochem Physiol 52:130�8.
Uno T, Nomura Y. 2005. Expression , purification and characterization of Methyl DNA Binding Protein from Bombyx
mori. J Insect Sci 5:1�
Quest AFG.1996. Regulation of Protein kinase C: a tale of
lipids and protein. Enzyme Prot 49:231�1.
Uno T, Nakao A, Katsurauma C. 2004. Phosphorylation of
Rab proteins from the brain of Bombyx mori. Arch Insect
Ruiz-Canada C, Ashley J, Moeckel-Cole S, Drier E, Yin J,
Biochem Physiol 57:68�.
Budnik V. 2004. New synaptic bouton formation is disrupted by misregulation of microtubules stability in a PKC
mutants. Neuron 42:567�0.
Von Stein W, Ramrath A, Grimm A, Muller-Borg M, Wodarz
A. 2005. Direct association of Bazooka/Par-3 with the lipid
phosphatase PTEN reveals a link between the PAR/aPKC
Shirai Y, Sumida M, Sakamura Y, Aizono Y. 1997. Carbacholinduced protein phosphorylation in the brain-corpus car-
complex and phosphoinoside signaling. Development
132:1675�86.
Archives of Insect Biochemistry and Physiology
February 2006
doi: 10.1002/arch.
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 422 Кб
Теги
expressions, cloning, molecular, protein, morie, kinases, bombyx
1/--страниц
Пожаловаться на содержимое документа