close

Вход

Забыли?

вход по аккаунту

?

Molecular cloning of a novel 97-kd Golgi complex autoantigen associated with Sjgren's syndrome.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol 40, N o 9, September 1997, pp 1693-1702
0 1997, Amencan College of Rheumatology
1693
-
MOLECULAR CLONING OF A NOVEL 97-kd GOLGI COMPLEX
AUTOANTIGEN ASSOCIATED WITH SJOGREN’S SYNDROME
KEVIN J. GRIFFITH , EDWARD K. L. CHAN, CHIEN-CHENG LUNG, JOHN C. HAMEL, XIAOYING GUO,
KIYOMITSU MIYACHI. and MARVIN J. FRITZLER
Objective. To identify a Golgi complex autoantigen bound by Sjogren’s syndrome (SS) autoantibodies.
Methods. Serum from a patient with secondary
SS and anti-Golgi antibodies was used as a probe to
isolate a complementary DNA (cDNA) insert from a
HeLa cDNA library.
Results. A 3.7-kb cDNA encoding a 56-kd recombinant protein was immunoprecipitated by the human
anti-Golgi serum and immune rabbit serum. Western
blot analysis showed that the immune rabbit sera
recognized a protein of 97 kd (golgin-97), suggesting
that the isolated clone contained a partial cDNA. The 5’
upstream sequence was obtained by rapid amplification
of the cDNA ends. The complete cDNA contained 4,860
basepairs, encoding a protein with a calculated M , of
88 kd. Antibodies to golgin-97 were found in 12 (20%) of
60 sera known to have anti-Golgi autoantibodies, and
the majority of these sera (8 of 12, or 75%) were from
patients who had secondary SS.
Conclusion. Golgin-97 is a unique Golgi complex
antigen that appears to be a target of SS autoantibodies.
The sera of patients with autoimmune diseases
are often characterized by the presence of autoantibodies that target a variety of tissue antigens. Some of these
autoantibodies are known to react with the cell membrane and intercellular matrix, and with nuclear and
Supported by Medical Research Council of Canada grant
17868 and NIH grant AI-39645, and in part by the Sam and Ro3e Stein
Charitable Trust. This is publication 9927-MEM from the Scripps
Research Institute.
Kevin J. Griffith, MSc, Marvin J. Fritzler, PhD, MD: University of Calgary, Calgary, Alberta, Canada; Edward K. L. Chan, PhD,
Chien-Cheng Lung, PhD, John C. Hamel, BSc, Xiaoying Guo, BSc:
The Scripps Research Institute, La Jolla, California; IOyomitsu Miyachi, MD: Keio University, Tokyo, Japan.
Address reprint requests to Marvin J. Fritzler, PhD, MD,
Faculty of Medicine, 3330 Hospital Drive, NW, Calgary, Alberta T2N
4N1, Canada.
Submitted for publication January 7, 1997; accepted in revised form April 29, 1997.
cytoplasmic components (1). Although considerable
progress has been made in our understanding of the
clinical and biologic importance of autoantibodies, it is
only recently that autoantigens in the Golgi complex
have been characterized and their clinical relevance
clarified.
Autoantibodies directed against the Golgi complex were first identified in the serum of a Sjogren’s
syndrome (SS) patient with lymphoma (2). Several isolated reports have described the presence of anti-Golgi
antibodies in SS and a variety of other diseases (3-11).
Immunoblotting and immunoprecipitation studies have
suggested that there are at least 14 different Golgi
complex autoantigens, and their molecular masses range
from 35 kd to 260 kd (12,13).
Molecular cloning approaches have used human
autoantibodies to define several unique Golgi complex
antigens (Table 1). Complementary DNA (cDNA) from
the first identified Golgi complex autoantigen, referred
to as golgin-95, was isolated by using autoantibodies
from a patient with systemic lupus erythematosus (SLE),
and encodes the complete amino acid sequence of the
95-kd protein (14). In addition, cDNA was found to
encode a portion of a second antigen, golgin-160, which
has a molecular mass of 160 kd (14). Sequence analysis
has demonstrated that golgin-95 and golgin-160 are
composed of a-helical coiled-coil domains which share
43% overall sequence similarity, suggesting that these
proteins may be functionally related.
Serum from a patient with scleroderma and secondary SS was used to isolate a cDNA strand that
encodes a 376-kd protein from a HeLa cDNA library
(1516). This autoantigen, termed macrogolgin, is also
characterized by a-helical coiled-coil domains. To date,
macrogolgin constitutes the largest known protein in the
Golgi complex (15,16). This same protein was described
by Linstedt and Hauri in a separate report, and in
keeping with previously published nomenclature, has
been renamed giantin (17). Sohda and colleagues re-
GRIFFITH ET AL
1694
Table 1. Characteristics of golgin-97 and comparison with other Golgi complex autoantigens"
Golgin-97
Golgin-245
Golgin-95
Golgin-160
Giantin
88
767
4,860
5.09
97
245
2,083
6,965
5.15
245
70
620
2,080
5.47
95
NA
NA
1,738
6.09
160
376
3,259
10,300
4.77
390
-
-
-
LO6417
14
LO6148
14
X75304
15
Predicted polypeptide molecular mass, kd
ORF, no. of amino acids
cDNA, no. of bp
PI
Protein-band immunoblot reactivity, kd
Coiled-coil domain
Granins signature sequence
GenBank accession number
Reference number
* NA
=
not available; ORF
=
+
+
+
+
U51587
U31906
39
-
open reading frame; cDNA
=
+
+
+
complementary DNA.
ported a 372-kd Golgi complex autoantigen and identified it as GCP372 (18), but sequence alignments have
revealed that GCP372 has an extra 5 amino acids
(QLSSM) inserted at residue 215 of the giantin amino
acid sequence. Thus, GCP372 and giantin are likely to
be products of alternatively spliced messenger RNA
(mRNA) derived from the same gene.
More recently, serum from a patient with SS and
glomerulonephritis was used to clone a 245-kd Golgi
complex autoantigen, named golgin-245 (19). This protein is distinguished by a signature sequence characteristic of a family of proteins known as granins, and also
has a dominant coiled-coil domain. Subsequent to this
report, another group identified a 230-kd Golgi complex
autoantigen that is related to golgin-245 (20). Studies of
the 230-kd protein have demonstrated alternatively
spliced products, suggesting that there may be further
heterogeneity of this Golgi complex antigen. In a more
recent study, investigators used serum from a patient
with hepatitis B to identify a 230-kd Golgi complex
antigen that is likely the same as the 230/245-kd Golgi
complex antigens (11).
In the present study, we used serum from a
patient with SS to isolate a cDNA clone that encodes a
novel Golgi complex protein, which we have designated
golgin-97. Analysis of the amino acid sequence revealed
the presence of multiple coiled-coil domains. More
importantly, golgin-97 is the second Golgi autoantigen
that has been shown to contain a granin signature
sequence. Golgin-97 is interesting because the majority
of patients with autoantibodies directed against this
protein have SS, a disease known to be associated with
defective glandular secretory functions.
PATIENTS AND METHODS
Patients and antibodies. The prototype serum was
from a 39-year-old Hispanic woman who had secondary SS.
Sixty sera, obtained from the serum banks in the Advanced
Diagnostics Laboratory at the University of Calgary and from
the Keigu Medical Clinic in Tokyo, Japan, were determined to
have anti-Golgi antibodies by indirect immunofluorescence
(IIF) (3,14). The diagnoses of SS,SLE, and systemic sclerosis
were based on published criteria (21-23). Affinity-purified
antibodies were prepared by eluting adsorbed antibodies from
recombinant proteins blotted onto nitrocellulose filters, which
were impregnated with isopropyl thiogalactose (1PTG)pyranoside as previously described (1 4,19).
IIF analysis. IIF was performed with commercially prepared HEp-2 cells as substrate (Immunoconcepts, Sacramento,
CA), using a fluorescein-conjugated goat anti-human IgG
(specific for both light and heavy chains) (14,19). A monoclonal antibody to the coatomer protein /3-COP (Sigma, St. Louis,
MO) was used for colocalization studies. Double-labeling and
colocalization studies utilized rhodamine-conjugated goat antirabbit or anti-mouse IgG antibodies (Pierce, Rockford, IL).
Localization studies with brefeldin A (BFA). HEp-2
cells growing under standard conditions on teflon-masked
slides (Cell-Line Associates, Newfield, NJ) were incubated in
7.5 p V l BFA (Sigma) and processed as previously described
(14). Changes to the distribution of Golgi antigens were
followed by immunoperoxidase staining using the affinitypurified prototype serum (described above).
Western blotting and immunoprecipitation. HeLa or
MOLT-4 cells were extracted using buffer and protease inhibitors, separated by discontinuous sodium dodecyl sulfatepolyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and processed for Western blotting as
previously described (14,24). In vitro transcription and translation (TnT; Promega, Madison, WI) utilized 1 pg of plasmid
DNA, T3 RNA polymerase, rabbit reticulocyte lysate, and
"S-methionine (trans "S-label supplied by ICN Biochemicals,
Irvine, CA) as previously described (14,19). Immunoprecipitation of the "S-labeled in vitro translation products was performed using protein A-Sepharose beads (19).
Sequence analysis of cDNA clones. The prototype
serum was used for immunoscreening recombinants from a
HeLa Uni-ZAP XR cDNA library (catalog no. 937216; Stratagene, La Jolla, CA) as previously described (14,19). Positive
clones were isolated and subcloned in vivo into pBluescript
plasmid using R408 helper phage. The nucleotide sequences of
a single clone of interest, designated cdf, were determined by
using dye terminator sequencing and an automated sequencer
from Applied Biosystems (Foster City, CA). Since cdf is a
partial sequence, rapid amplification of the cDNA ends
GOLGI COMPLEX AUTOANTIGEN CLONE IN SS
(RACE) was performed to obtain overlapping 5‘ clones (5’RACE-ready cDNA) from human placenta cDNA supplied by
Clontech Laboratories (Palo Alto, CA) (25,26). DNA sequences were determined in both strands and compiled using
SeqEd software (Applied Biosystems).
Confirmation studies. Independent confirmation that
the 5’-RACE cDNA clones were derived from a single mRNA
was sought by Northern blotting. Total cellular RNA was
isolated from HeLa cells, fractionated by electrophoresis,
transferred to nitrocellulose membranes, and hybridized with
appropriate 32P-labeled cDNA fragments as previously described (19).
In addition, total HeLa RNA was analyzed by mapping
with reverse transcriptase-polymerase chain reaction (RTPCR). One set of sense and antisense primers was designed,
and their positions with respect to the putative full-length
cDNA are indicated in Figure l a : #38 sense 5’GCCAGGAATTCAACATGGTTGCAAAACTGAAG-3 ’
and #39 antisense 5’-CATGCGGCCGCTTTATTGGGTAGTCCCCTCTAGG-3’. RT-PCR was performed using the
one-tube method as previously described (19), such that all
reactants were added simultaneously and the PCR steps were
programmed to follow immediately after the RT reaction using
a thermocycler (Eppendorf, Madison, WI). The RT reactions were performed at 50°C for 1 hour using Superscript I1
(Bethesda Research, Gaithersburg, MD). For PCR analysis of
the #38/#39 primer pairs, Tuq polymerase (Bethesda Research) was used for 25 cycles at 60°C for 5 seconds, 70°C for
2.5 minutes, and 94°C for 5 seconds. Amplification products
were analyzed by standard electrophoretic procedures using
1.5% agarose gels as previously described (19).
Recombinant protein production and immunization.
Plasmids transformed in Escherichia coli strain XL-1 Blue cells
(Stratagene) were used to prepare recombinant proteins from
the IPTG-induced recombinant cells according to the method
of Adam et a1 (27). The final pellet of inclusion bodies was
washed with 1M urea in 0.1M Tris HCl (pH 7.3) on ice for 1
minute to remove residual bacterial proteins, and extracted
with 8M urea, 0.2% P-mercaptoethanol in 0.1M Tris buffer.
The recombinant proteins were tested for immunoreactivity by
immunoblotting or used for immunization of New Zealand
white rabbits as previously described (14J9).
Computer analysis of nucleic acid and protein sequences. Nucleic acid and protein sequences were analyzed by
the University of Wisconsin Genetics Computer Group (GCG)
Sequence Analysis software package, version 7.2, for UNIX
computers (28). Comparisons with known sequences were
performed by BLAST (29) on the Internet server. Secondary
structural analysis for coiled-coil motifs was performed using
the software program “COILS” (30).
1695
a
4
0
3
2
4
cdf
3567bp
C9 541bp
0
.
.
.-.
5 kb
*70444 946bp
35-3 798bp
-35-5 669bp
+
+
#38
#39
b
6
%6’
# 3 a m
p g RNA
1 .3 M
cp’
- 23
- 9.4
- 6.6
- 4.4
2as-
45kb
+
as-
1
- 2.3
- 2.0
- 1.3
- 1.1
- 0.87
- 0.6
Figure 1. a, Schematic representation of the overlapping golgin-97
complementary DNA (cDNA) ytrand. The cDNA was obtained by
immunoscreening a HeLa cDNA library using a prototype human
serum, and by 5’-rapid amplification of the cDNA ends (C9 and 35-5).
The combined cDNA sequence contains 4,860 bp. b, Northern blot
analysis of HeLa messenger RNA (mRNA). Both 5’ (35-5) and 3’ (cdf)
cDNA probes hybridized to a single mRNA of -5 kb. c, Reverse
transcriptase-polymerase chain reaction (RT-PCR) mapping of
golgin-97 mRNA using HeLa total RNA as substrate. The expected
amplification product for primer pair #38/39 was 2,347 bp. The results
showed that the primer pair gave a single RT-PCR product with
migration consistent with the expected size (arrow).
RESULTS
Cloning and characterization of golgin-97 cDNA.
When the prototype serum was used to screen 5 X lo5
plaques from the HeLa Uni-ZAP cDNA expression
library, 3 clones were isolated. O ne clone (cdf) remained
reactive throughout the purification protocol and was
chosen for further study. T he 3.7-kb cD N A insert was
subcloned in vivo into pBluescript. The prototype serum
and affinity-purified antibodies from cdf phage plaques
(Figure 2a) showed staining of the Golgi complex, which
was similar to the staining demonstrated by human
antibodies directed against golgin-245 (Figure 2b).
GRIFFITH ET AL
1696
Evidence supporting the localization of the reactive antigen to the Golgi complex came from HeLa cells
treated with 7.5 p M BFA. These studies demonstrated
redistribution of the antigen and an apparent increase in
staining after 5 minutes of exposure to the drug (Figures
3a and b), but a dramatic loss of staining after 10
minutes’ exposure (Figure 3c). Restoration of Golgi and
vesicular staining was observed 90 minutes after removal
of the BFA (Figure 3d). The sensitivity of golgin-97 to
BFA resembles the rapid disappearance of p-COP (31),
golgin-95, golgin-160 (14), and golgin-245 (19) after
exposure of tissue culture cells to the drug.
Sequence analysis. Northern blotting showed
that the full-length cDNA for cdf would be -5 kb
(Figure lb). To obtain the complete cDNA, the 5’-
Figure 2. Indirect immunofluorescence detection of anti-Golgi antibodies on HEp-2 cells. a, Staining pattern of the affinity-purified
prototype human serum, demonstrating strong reactivity with the
Golgi complex. b, A similar pattern of staining produced by sera from
a patient with antibodies to golgin-245. c, Affinity-purified human
antibody from unrelated phage plaques, showing no staining of the
Golgi complex. d, Rabbit anti-recombinant protein cdf, which produces a similar staining pattern as the prototype human serum. On
confocal microscopy, this reactive antigen colocalizes to the same
cytoplasmic structure as the monoclonal antibody to 0-COP (data not
shown). (Original magnification x 400.)
Affinity-purified antibodies from unrelated phage
plaques did not stain the Golgi complex (Figure 2c).
Rabbit antibodies to recombinant cdf (Figure 2d) produced a staining Dattern that resembled the human
affinity-purified
and this reactive antigen was
localized by confocal microscopy (14) to the Same
lar structure as the Golgi-specific murine monoclonal
antibody to p-COP (data not shown).
-
1
Figure 3. Effect of brefeldin A (BFA) on golgin-97. HEp-2 cells were
left untreated (a), or were treated with 7 . 5 BFA for S minutes (b)
or 10 minutes ( c ) ,and then probed by immunoperoxidase staining with
the prototype anti-Golgi serum, Treated cells were examined
90 minutes after removal of the BFA, after replenishing with fresh
media (d). (Original magnification X 400.)
GOLGI COMPLEX AUTOANTIGEN CLONE IN SS
I
1: 1
1?1
1697
GCACTGGCAGA;GTGC(GGT~GGTC~~~~~CT~GCCCGCTGGGCGGT~G~~T~GGTGA~~~C~GG~CCGGCG~TCACGAGAGG_C~GA.;~.;~~~~~TTT.;~~~~C?CCC^A
; A C A C - c n c . ; A c A ~ G A C ~ C - A A ~ G T T ~ ~ A G A T ~ G ~ A G A T C C T G T G r ? G C C A T A A G C C C ~ r G G C ~ ~ A ~;I A;AA'TGCAGCTASCTTGGATG?
TTTAAGTG
CT';RP.ACTTTGTA^IGCGCCTC.I.:TCTGRATCCTGAACACAGGCAC~A.;GACTACTGAGAGC~CtiTCATCTGTGCAGG~rhGCCACA~AGCA~~~T
TTGCAAAACTGAr\TAA~.LG.AT
1 3 F A K L K K ? 1
361 TGCAGAAGAGACTGCTGTTGCTCAGAGGCCAGGAGGTGCTACTAGGATCCCACGGTCTGTGAGCAAGGAATCAGTTGCCTCAATGGGAGCTGACTCAGGAGATGACTTTGCTTCCGATGG
10
A E E T A V A Q R P G G A T R I P R S V S K E S V A S M G A D S G D D F A S D G
481
50
601
90
721
AAGCAGCTCCAGAGAAGATCTTTCATCCCAGCTTCTGAGAAGGAATGAACAGATACGGAAGTTAGAGGCCAGACTTTCTGACTATGCTGAACAGGTCCGAAACTTGCAGAAGAT~GA
S S S R E D L S S Q L L R R N E Q I R K L E A R L S D Y A E Q V R N L Q K I K E
GAAGCTTGAAATTGCATTAGAAAAACACCAGGATTCTTCCATGCGGAAATTTCAAGAGCAGAATGAGACATTCCAAGCCAACAGAGCCAAAATGGCAG~GGACTGGCTTTGGCATTAGC
K L E I A L E K H Q D S S M R K F Q E Q N E T F Q A N R A K M A E G L A L A L A
CAGAAAGGACCAGGAATGGTCAGAAAAGATGGATCAGCTTGAAAAGGAG~TATTCTGACAGCCCAGTTACAGGAAATGAAG~CCAGAGTATGAATCTTTTCC~GGAGAGATGA
R
130
K
D
Q
E
W
S
E
K
M
D
Q
L
E
K
E
K
N
I
L
T
A
Q
L
Q
E
M
K
N
Q
S
M
N
L
F
Q
R
R
D
E
641
AATGGATGAATTAGAGGGGTTCCAGCAGCAGGAACTAAGTAAAATAAAGCACATGCTTTT~GAAGAAAGTCTAGGGAAAATGGAACAAG~TTCGAGGCACGAACCAGAG~CT
170
M D E L E G F Q Q Q E L S K I K H M L L K K EIE S L G K M E Q E LIE A R T R E L
961 TAGTCGTACCCAGGAGGAGTTGATGAACTCCAATCAGATGTCATCAGACTTAAGCCAGAAGCTAGAAGAATTGCAGAGACACTACTCAACGCTGGAAGAGCAGAGAGATCATGTGATAGC
210
S R T Q E E L M N S N Q M S S D L S Q K L E E L Q R H Y S T L E E Q R D H V I A
1081
250
1201
TTCARRAACAGGTGCAGAAAGTAAGATCACAGCCCTGGAACAAAAGGAACAAGAGCTCCAAGCACTCATTCAGCAGCTTTCCATTGATTTGC~GGTCACTGCTGAAACTC~GAGM
S K T G A E S K I T A L E Q K E Q E L Q A L I Q Q L S I D L Q K V T A E T Q E K
AGAAGACGTTATCACACATTTGCAAGAGAAGGTTGCATCCTTGGAGAAGAGACTAGAACAGAACTTATCAGGAGAAGAACACGTGCAAGAACTCCTGAAAGAGAAAACACTTGCTGAGCA
E D V I T H L Q E K V A S L E K R L E Q N L S G E E H V Q E L L K E K T L A E
Q
GAATTTGGAGGATACCAGACAACAGCTCTTGGCAGCCAGAAGCAGCCAGGCTAAGGCCATTAACACCCTGGAGACTCGGGTGAGAGAACTGGAGCAGACCTTCCAGGCCTCTGAGGAGCA
330
N L E D T R Q Q L L A A R S S Q A K A I N T L E T R V R E L E Q T L Q A S E E
Q
290
1321
1441
GCTCCAACAGAGCAAGGGCATTGTGGCTGCCCAGGAAACTCAGATACAGGAGCTCGCTGCCGCCAACCAGGAGAGCAGCCATGTGCAGCAGCAGGCCCTTGCTCTGGAGCAGCAGTTCTT
370
L Q Q S K G I V A A Q E T Q I Q E L A A A N Q E S S H V Q Q Q A L A L E Q Q F L
1561
410
GGAGCGCACCCAGGCGCTAGAAGCCCAGATAGTGGCCCTGGAGAGAACGCGGGCAGCTGACCAGACCACCGCAGAGCAAGGGATGAGACAACTGGAGCAAGAAAATGCAGCCCTTAAAGA
E R T Q A L E A Q I V A L E R T R A A D Q T T A E Q G M R Q L E Q E N A A L
K
E
1 6 8 1 ATGCAGGAATGAATATGAACGTTCTTTACAAAATCACCAATTTGAACTAAAGAAGCTGAAGGAAGAATGGAGCCAAAGAG~TTGTGAGCCTGGCCATGGCTCAAGCCCTGGAGGAGGT
450
C R N E Y E R S L Q N H Q F E L K K L K E E W S Q R E I V S V A M A Q A L E E V
1801 GCGGAAGCAAAGGGAAGAGTTCCAGCAACAGGCAGCTAACCTGACAGCCATAATAGACGAGAAGGAACAGAATCTGCGGG~CCGAAGTGCTTCTCCAGAAAGAGChG~AGATTCT
490
R K Q R E E F Q Q Q A A N L T A I I D E K E Q N L R E K T E V L L Q K E Q E I L
1921
CCAGCTGGAGCGAGGTCACAACTCTGCCCTGCTGCAGATACACCAGCTGCAGGCCGAGCTGGAGGCCCTGAGGACCCTCAAGGCGGAGGAGGCTGCAGTGGTCGCGGAGCAGI~AGGACCT
530
2041
Q
L
E
R
G
H
N
S
A
L
L
Q
I
H
Q
L
Q
A
E
L
E
A
L
R
T
L
K
A
E
E
A
A
V
V
A
E
Q
E
D
L
GCTGAGGCTGCGGGGCCCATTGCAGGCCGAAGCACTCTCAGTCAATGAGTCGCACGTGACCTCGAGGGCCATGCAGGACCCTGTGTTCCAGCTTCCAACTGCAGGAAGAACACCAAATGG
L
570
R
L
R
G
P
L
Q
A
E
A
L
S
V
N
E
S
H
V
T
S
R
A
M
Q
D
P
V
F
Q
L
P
T
A
G
R
T
P
N
G
TGAGGTTGGGGCCATGGATCTCACACAGCTACAGAAGGAGAAACAGGACTTGGAGCAGCAACTTCTGGAGARRAATAAGACCAT~GCAGATGCAGCAGCGGATGCTGGAGCTCCGG~
610
E V G A M D L T Q L Q K E K Q D L E Q Q L L E K N K T I K Q M Q Q R M L E L R K
2161
2 2 8 1 GACTCTGCAGAAGGAGCTGAAAATCAGACCCGATAATGAGCTCTTCGAAGTCCGGGAGAAACCTGGACCTGAGATGGCAAACATGGCGCCTTCCGTCACGAAT~CACTGACCTGACAGA
650
T L Q K E L K I R P D N E L F E V R E K P G P E M A N M A P S V T N N T D L T D
2401
690
2521
730
2641
2761
2881
3001
3121
3241
3361
3461
3601
3721
3841
3961
4081
4201
4321
4441
4561
4681
4801
TGCCCGCGAGATCAACTTTGAGTACCTTAAACATGTGGTTTTAAAATTCATGTCTTGTCGCGAATCCGAGGCTTTTCATCTTATAAAAGCTGTGTCAGTGTTCCTGAACTTTTCCCMGA
A R E I N F E Y L K H V V L K F M S C R E S E A F H L I K A V S V L L N F S Q E
GGAGGAGAACATGCTCAAGGAAACTCTGGAATATAAGATGTCATGGTTTtiGGTCCAAACCAGCTCCCAAGGGCAGCATCCGGCCGTCTATCTC~CCCTCGGATACCATGGTC
A G
E E N M L K E T L E Y K M S W F G S K P A P K G S I R P S I S N P R I P W S U 7 6 7
GGGACTACCCAAGGATGGAGCTCCGTGGGTTGACACTTTTTCTGTGAAAAGAACACTGACACACCAGTCTGGGTGGGTTTTTAATCACTGTAACTGCAGTATTTTGTACAAGTGTCTAAA
CATTGTTTACAAGACTAAGGCCCACTTCCCTGCAGGCTGACCTGAACCTCAGGGGGTAGCTGATCCTGTCATTCTGGTCACCAAACAGGAGGGTCCTGGCACTACCCAGATTTCCACAGT
GCTGCTAATATCCCAGCTCCAGCCAGCACCCCATCTGCACCTGAATCCTCTAACTTCACGGTAGCACTTACAGCTGAAGCCATCAGCATCTGGCAGGCACACCTGAGTCACCATGTAGCG
CTGCTACTGGAGGTAGAGACGGCCCTTTGAGATGGTGCCCAGCAGGCCAAACCCACCTGCCTCTGCCAGGAACAGCCAACTCCATGGGAACTCTATGGGAGTGGCTTTT~TTCAGA
TGAGTTAGAAGCTTTTTATCCCTTCCTCTCAAGAAAATATTCTTTCACCCTGTCTCTCAAACCACCTAGAACTTTAGAGGATCCATCTTTAAGGGCCGGTGTGGATGAATGAGAAAATGC
ACCTTTCTGACAGTATCTCCACTTTACTTAAG~CTAGCAAATATATG~GACCCTTAGTACCAAATACACTCAATTGCCTTTTTAATGAATGTACTTGTCTTGGATAGGTTGCTG
GTAAACCATTTTAAACTATTTTTTATAGCTGAAGTTCTTCACTACTATAAACGTCTTCTGTACTATAAAATCCATTTAACTGGTGTTCTTAAAATCAGAGCGTCCAGAGGAAATTCTTCC
TAAAACTAGGATTCCTGTTCCTTTGTCTTCTCACTCGCACTCTGGCACTGCTCCCTCTGAAGTGCAGTGGGATCTCGTGTGCTTTGTCTTGATTCTGTGCTGCGCTGCCGCTGGGCGATG
CAGACCACCTGTCTTCTACTGAAGGACAGTCCGCTGTCTCCAGTGGGGGCAGCAGCTGTCCCCCAGCCTCGATGGAGACATTGGGGCAGTCTGCCTTGTCTGTGGAGCTGCTCTCTCTCC
CTCATCCCACCCCAAATACTTAAAATGACACTACACCCAGACGGCGCCCAGCTGGCTGCAGCACTTGTAGCATGCACATGACTCTGGTAGTAACCAAC~CTTGTTTTATCGATTCC
T
C
G
T
T
T
A
C
T
G
A
G
G
A
A
A
G
G
G
A
A
C
A
T
G
C
T
G
G
T
T
C
T
G
G
A
A
A
A
C
TGGAGCCTCTAAATTTATTATCCATTATCCAGTGATGGAAAGTTGTATTTCTCAATCATGCTTAGGGCCAAAATAGGTATATAAAATGTGTCACAG~CACGCATTTGC~CGTTAA
CCTAACGAAATTTCCATGAAGAACCAAGTCAGGGCAGCATCTCCTTAGTCCCAGCTCAGGCTCTCTGCCTTCCAGAGGCCGCTTCTCCAGTGACTAACCTCCTCCTCTGGCTCCTCCTTG
CAGACAGTTATCCCTTGTTTAGAACACGAATTTCCATTTACCTGGTGGGAACACGAAACAGGAGTCTCTTCTGTTCTGCAAGTTTGATGGGT~GAGGTAGCCTTTTTTCAAAGTAGGAT
TTCCTTTTTCMCTGTTCCAGGAAAGAATCTCTAAGACTGGGTAGCTCACAGCCAGCCAAAGGCAGCTACATTTCCACAGAAGCCCGTCCGCTGCCTCCGTGGCTTCTCCAGCCATTGAA
CTGGTCCCACACGCACCCCAGGCCCCACTCCTCGGCAGTTTCAGGTGTAGCTGTGGGGCCCGTTCCTAGGTCTGTACTCACTTTAGGGAGGCTTCACTGACTAGGCTTTCCTCCTGCATG
TTGAATTTCCTTCAGCTTTAAGAGGAAGAGTGGAATAAATATTCTAAGTGATTTAATGCACTTTGACTTGTATAAAACTTTCTGTGTTAGCGACGGTATCTATAGCCCTTTATACGAGCG
ATGGATCTTGAGCTCTCCTTCCATGTTGTAAATAGGGATTGTATTCTTGAAAACTGCTGTAGCAAATTCATCTGTGGTGCAATACACTTTTTG~GCTCTTCAATCCAGATGC~
8
4860
Figure 4. Nucleotide and deduced amino acid sequences of the golgin-97 antigen. Sequencing of both DNA strands was performed
with custom synthetic oligonucleotide primers. The open reading frame starts at nucleotide 343 and ends at nucleotide 2635 (boxed).
The large box shows the signature sequence for granins 1 at amino acids 193-202. Single underline indicates the in-frame stop codons
in the 5'-noncoding regions and the putative polyadenylation signal. Double underline indicates the GC-rich regions in the
5'-noncoding region.
RACE methodology was used (26). In the first round of
5'-RACE, several overlapping, independent clones were
obtained. The longest cDNA insert, C9, contained 541
basepairs and represented an open reading frame extending 5' from the cdf cDNA (Figure la).
When the nucleotide sequence of C9 was used to
search for similar sequences in the GenBank, a cDNA
sequence (GenBank accession no. T48886), corresponding to an expressed sequence tag (EST) clone derived
from the Washington University-Merck EST Project,
was identified. The cDNA was derived from a human
placenta library and was subcloned into the pBluescript
GRIFFITH ET AL
1698
SK vector. This clone (ID no. 70444) was obtained
directly from the Integrated Molecular Analysis of
Gerome Expression (I.M.A.G.E.) Consortium (Washington University-Merck, St. Louis, MO). When the
complete nucleotide sequence for clone 70444 was determined (1,143 bp), it was apparent that there were only
335 bp of sequence identical to the sequence of golgin97. There were 661-bp upstream and 197-bp downstream sequences that were likely to be introns, since the
junctions were consistent with intron-exon and exonintron junctions, respectively. The origin of clone 70444
was not further investigated, since it did not provide us
with the complete 5’ sequence of golgin-97.
To obtain the remaining 5‘ sequence, a second
round of 5’-RACE was initiated with newly designed
primers based on the overlapping 5’ sequence of C9 and
70444. Several overlapping cDNA were obtained and
the longest cDNA inserts, 35-3 and 35-5, contained 798
bp with an open reading frame extending 5’ of C9 and
70444 (Figure la). The combined sequence derived from
overlapping cDNA contained a total of 4,860 bp (Figures l a and 4). The ATG start site was found at
nucleotide position 335 and corresponded well with the
sequence identified by Kozak (32) for a methionine
initiation codon. Based on analysis using the GCG
program PEPTIDESORT, the combined sequence was
found to encode a protein that has an open reading
frame of 767 amino acids, a predicted molecular weight
of 88 kd, and a PI of 5.09 (Table 1). The nucleotide
sequence of this complete cDNA has been submitted to
the GenBank under accession number U51587.
Confirmation that the 5’-RACE clones were derived from a single mRNA was obtained by Northern
blotting, when the 5’ fragment 35-5 hybridized to a
common band of -5 kb (Figure lb), a size consistent
with the full-length cDNA reported herein. The 5’ probe
35-5 corresponded to -90% of the cDNA insert of clone
35-3. A second independent confirmation was provided
by RT-PCR mapping data (Figure lc). The results
showed that the pair of designed primers, which were
each derived from different cDNA fragments, produced
RT-PCR products of -2.3 kb.
The deduced amino acid sequences were used to
search the GenBank, EMBL, and NBRF data banks for
homologous sequences. There were no apparent transmembrane, nuclear localization, or other signal motifs.
Similar to golgin-95 and golgin-160 (14), -20% similarity of amino acid sequences was found with the myosin
heavy chain, nuclear mitotic apparatus (NuMA) protein,
and kinetochore-associated protein CENP-E. However,
a
V
.
1
I00
200
300
400
500
600
700
Residue Position
+
b
11
r
+ granins-1 signature
sequence
WGmEQm gotgin-97
ESLSAIEAEL granin
0
1
100
200
300
400
Residue Position
Figure 5. Structurdl features of golgin-97 Multiple coiled coils were
detected throughout the length of golgin-97 (a), while only 1 short
coiled coil wds found in the C-terminal domain of human chromogranin (b) Arrow indicates the location of the granins-1 5igndture
sequence
there was no significant sequence similarity with p-COP
or other mammalian Golgi components.
Granin signature sequence and coiled-coil motifs. The decapeptide, ESLGKMEQEL, at amino acids
193-202 (Figures 4 and 5a) was identified as a granins-1
signature sequence, which has the consensus pattern
[DE]- [SN]-L-[SAN]-x(2) [DEIxEL (33,34). Note that a
single mismatch was allowed at the fourth position,
where the small amino acid Gly was present in place of
Ser, Ala, or Asn. The PI of golgin-97 (5.09) is similar to
that of granins, and the values for glutamic and aspartic
acid content (14% and 3%, respectively) account, in
large part, for the anionic PI.
Secondary structure analysis using the program
“COILS” (30) identified coiled coils throughout the
length of golgin-97 (Figure 5a).
Characterization of the recombinant protein.
The reactivity of the recombinant protein encoded by
the cdf cDNA was tested against antibodies in the
prototype patient serum and against rabbit antibodies
obtained by immunization with the recombinant
golgin-97 protein. In immunoblotting analysis (Figure
6b), the recombinant protein from the cdf clone was
reactive with the prototype serum (lane l), with the
antibodies affinity purified from the cdf recombinant
protein (lane 3), and with immune rabbit serum (data
not shown), but not with normal human serum (lane 2).
1699
GOLGI COMPLEX AUTOANTIGEN CLONE IN SS
The reactivity with the recombinant protein was confirmed by parallel experiments that used the in vitrotranslated product derived from the cdf cDNA (Figure
6a). The recombinant protein produced by the cdf
partial-length cDNA was -56 kd (Figure 6a, lane 1) and
was immunoprecipitated by the prototype human serum
(lane 3) and immune rabbit sera (lane S), but not by
normal human serum (lane 4) or preimmune rabbit
serum (lane 6).
Immunoblot analysis of HeLa cell extracts
showed reactivity with 2 human sera that immunoprecipitated the recombinant golgin-97 proteins (Figure
7a). Both sera (lanes 1 and 2) reacted with a 97-kd
protein, whereas no reactivity was seen with normal
human serum (lane 3). Similarly, rabbit antirecombinant protein derived from clone cdf demonstrated reactivity with a 97-kd protein (Figure 7b, lane
2), whereas preimmune rabbit serum showed no reactivity (lane 1). The prototype human serum (lane 3)
reacted with 2 proteins. One of these proteins had a
molecular mass of -240 kd, and was previously identified as golgin-245 (19). The other was the 97-kd protein
recognized by immune rabbit serum.
Association of golgin-97 autoantibodies with secondary SS. When the 60 sera with anti-Golgi antibodies,
as determined by IIF, were tested for reactivity by
i
97.4-
2
3
4
5
6
1
2
3
- 97
- 66
66 -
- 45
45 -
-31
1
2
3
1
2
3
-
-200
116 97.4-
-116
200
66
- 97.4
-
- 66
45 -
Figure 7. Immunoblot analysis of HeLa whole cell extracts separated
by 10% gel sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
a, Human sera that immunoprecipitated the in vitro-translated cdf
complementary DNA product, reacting with a 97-kd protein (lanes 1
and 2), but not with normal human serum (lane 3). b, Cell extracts
probed using rabbit antibodies raised against golgin-97 recombinant
protein, reacting with a 97-kd protein (lane 2) that had the same
migration as the prototype human serum (lane 3). Preimmune rabbit
serum (lane 1) did not show reactivity. The prototype human serum (a,
lane 2 and b, lane 3) also reacted with a protein of higher molecular
mass (-240 kd). All sera were diluted 1:200, except the prototype
serum, which was diluted 150. Molecular mass markers are shown on
the left (a) and right (b).
immunoprecipitation of the TnT product, 12 (20%)
bound the recombinant golgin-97. The diagnosis in 8 of
the 12 patients was secondary SS, of whom 1 had
rheumatoid arthritis (RA), 1 had idiopathic pulmonary
fibrosis, and 2 had proliferative glomerulonephritis without evidence of a systemic rheumatic disease such as
SLE, RA, or SS. There were no other obvious unique
clinical features in these patients, such as central nervous system disease, endocrine dysfunction, or coexistent infectious diseases.
DISCUSSION
Figure 6. Immunoreactivity of recombinant protein cdf. a, Immunoprecipitation of the "S-methionine-labeled recombinant protein,
which was obtained from the coupled in vitro transcription and
translation of cdf complementary DNA, showing migration at -56 kd
in a 4-20% gradient-gel sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (lane 1). This protein was immunoprecipitated by the
prototype serum (lane 3) and the immune rabbit sera (lane 5), but not
by protein A in the absence of serum (lane 2), by normal human serum
(lane 4), or by preimmune rabbit serum (lane 6). b, Immunoblot
analysis of the recombinant protein produced in Escherichia coli,
showing reactivity with the prototype serum (lane 1) and with antibodies affinity purified with recombinant phage protein (lane 3), but
not with normal human serum (lane 2). All sera were diluted 1:200,
except the prototype serum, which was diluted 1:50. Molecular mass
markers are shown on the left (a) and right (b).
Golgin-97 represents the fifth unique Golgi complex autoantigen to be cloned and characterized. The
other Golgi complex autoantigens are golgin-95, golgin160 (14), golgin-245 (19), and giantin (1S,17).
It is interesting that golgin-97 is the second Golgi
autoantigen that we have identified with a granin signature sequence. A review of available golgin-95, golgin160, and giantin sequences showed no sign of granin
signatures, even when one mismatch was allowed. The
granins are a family of acidic proteins present in the
secretory granules of a wide variety of endocrine and
neuroendocrine cells (33,34). Two consensus sequences
1700
have been reported. The granins-1 signature is located
at the carboxyl-terminus of the proteins and has been
identified in all granin family proteins with the exception
of murine secretogranin 2. The second consensus sequence, granins-2, has been described in chromogranins
A and B, and is characterized by 2 cysteine residues
bound together near the amino-terminus of the protein.
The acidic charge of these proteins has been attributed
to a high content of glutamic and aspartic acid. The
function of these proteins, or signatures, has not been
clearly defined, but current evidence suggests that one of
their functions is modulator-processing or packaging of
neuropeptides.
The similarities between granins, golgin-97, and
golgin-245 are remarkable and suggest that they have
similar functions. Although the relationship between
anti-Golgi antibodies and SS remains to be determined,
given that the sera used for the cloning of both golgin245 and golgin-97 came from patients with SS, and given
the existence of other reports of anti-Golgi antibodies in
patients with SS (2,6,35), it is intriguing to consider that
these autoantibodies may occur in response or related to
secretory defects in SS exocrine glands. Interestingly, the
breast cancer genes BRCAl and BRCA2 have recently
been reported to encode the granins-1 signature sequence, and the respective proteins have been shown to
be present in certain secretory granules (36). Although
the relationship of these findings to breast cancer continues to be debated (37,38), the putative gene product
of BRCAl has been reported as a secreted protein (36).
The observation that all Golgi complex autoantigens cloned to date are predominantly coiled-coil structures is also interesting, and may be another clue to their
function. Coiled-coil domains have been noted in other
autoantigens, including NuMA (39), lamin B (40), myosin heavy chain (41), 52-kd SS-A/Ro (42,43), and
80/86-kd Ku antigens (44). Although certain proteins
with coiled coils are able to bind DNA and are thought
to be predominantly regulatory in their function (45),
this structure also mediates the dimerization of certain
transactivators (46) and is essential for recombination of
certain viral proteins (47) and oligomerization of viral
envelope proteins (48).
Antibodies directed against the Golgi complex
have been reported in the sera of patients with SS and
other systemic rheumatic diseases (2-6,12,13,35,49),
Raynaud’s phenomenon (4), active Wegener’s granulomatosis (7), idiopathic cerebellar ataxia (S), paraneoplastic cerebellar degeneration (50), stiff man syndrome
(51), and viral infections including the Epstein-Barr
virus (52), hepatitis B ( l l ) , and the human immunode-
GRIFFITH ET AL
ficiency virus (53). Of interest, the prototype serum was
from a patient who had glomerulonephritis and who
developed the clinical features of SS several years later.
This observation, in conjunction with the first report of
Golgi autoantibodies in an SS patient with lymphoma
(2), and in conjunction with other studies that have used
SS sera to clone and identify unique Golgi complex
autoantigens (2-6,15-20), suggests that anti-Golgi antibodies may be useful in identifying a subset of patients
with SS who have features in addition to keratoconjunctivitis sicca. Retrospective and prospective clinical studies of patients with anti-Golgi complex antibodies are
under way to investigate the possibility that these patients have unique clinical features.
In the present study, we identified a unique Golgi
complex autoantigen that reacted with sera from patients with secondary SS. Seventy-five percent of patients who had anti-golgin-97 antibodies had secondary
SS. The function of the autoantigen is not clear, but the
evidence suggests that the Golgi complex autoantigens
are part of a unique family of Golgi complex proteins,
because 1) they do not have sequence homology or
similarity with other known Golgi complex proteins, 2)
they are all characterized by multiple coiled-coil domains, 3) they have sequence similarities to known
motor proteins, and 4) at least 2 of them (golgin-97 and
golgin-245) contain the granin signature sequence.
These observations suggest that the Golgi complex autoantigens, including golgin-97, may participate in
protein-protein interactions and transport of newly synthesized proteins from the Golgi complex to secretory
granules. Golgin-97 is particularly interesting because
the majority of patients with autoantibodies directed
against this protein have secondary SS, a disease known
to be associated with defective glandular secretory functions. Additional studies are under way to determine
how Golgi complex autoantibodies arise, whether they
are pathogenic, and whether they are associated with a
unique clinical subset.
ACKNOWLEDGMENTS
The authors thank Joan Miller, Cheryl Hanson, and
Winona Wall for their assistance.
REFERENCES
1. Von Muhlen CA, Tan EM: Autoantibodies in the diagnosis of
systemic rheumatic disease. Semin Arthritis Rheum 24:323-358,
1995
2. Rodriguez JL, Gelpi C, Thomson TM, Real FJ, Fernandez J:
GOLGI COMPLEX AUTOANTIGEN CLONE IN SS
Anti-Golgi complex autoantibodies in a patient with Sjiigren’s
syndrome and lymphoma. Clin Exp Immunol49:579-.586, 1982
3. Fritzler MJ, Etherington J, Sokoluk C, Kinsella TD, Valencia DW:
Antibodies from patients with autoimmune disease react with a
cytoplasmic antigen in the Golgi apparatus. J Immunol 132:29042908; 1984
4. Gentric A, Blaschek MA, Le Noach JF, Johanet C, Jouquan J,
Lamour A, Abuaf N, Pennec YL, Youinou P: Serological arguments for classifying Raynaud’s phenomenon as idiopathic.
J Rheumatol 17:1177-1181, 1990
5. Hong HS, Morshed SA, Tanaka S, Fujiwara T, Ikehara Y,
Nishioka M: Anti-Golgi antibody in rheumatoid arthritis patients
recognizes a novel antigen of 79 kDa (doublet) by Western blot.
Scand J Immunol36:78.5-792, 1993
6. Blaschek MA, Pennec YL, Simitzis AM, Le Goff P, Lamour A,
Kerdraon G, Jouquan J, Youinou P: Anti-Golgi complex autoantibodies in patients with primary Sjogren’s syndrome. Scand
J Rheumatol 17:291-296, 1988
7. Mayet WJ, Hermann E, Csernok E, Knuth A: A human renal
cancer line as a new antigen source for the detection of antibodies
to cytoplasmic and nuclear antigens in sera of patients with
Wegener’s granulomatosis. J Immunol Methods 14357-68, 1991
8. Gaspar ML, Marcos M-AR, Gutierrez C, Martin MJ, Bonifacino
JS, Sandoval IV: Presence of an autoantibody against a Golgi
cisternal membrane protein in the serum and cerebrospinal fluid
from a patient with idiopathic late onset cerebellar ataxia. J Neuroimmunol 17:287-299, 1988
9. Tanaka K, Igarashi S, Yamazaki M, Nakajima T: Paraneoplastic
cerebellar degeneration: successful early detection and treatment
of cancer through characterization of the anti-Purkinje cell antibody. Intern Med 31:1339-1342, 1992
10. Rodriguez M, Truh LI, O’Neill BP, Lennon VA: Autoimmune
paraneoplastic cerebellar degeneration: ultrastructural localization of antibody-binding sites in Purkinje cells. Neurology 38:
1380-1386, 1988
11. Funaki T, Fujiwara T, Hong HS, Misumi Y, Nishioka M, Ikehara
Y: Identification and characterization of a 230-kDa Golgiassociated protein recognized by autoantibodies from a patient
with HBV hepatitis. Cell Struct Funct 21:63-72, 1996
12. Kooy J, Toh BH, Gleeson P A Heterogeneity of human anti-Golgi
auto-antibodies: reactivity with components from 35 to 260 kDa.
Immunol Cell Biol 72:123-127, 1994
13. Renier G, Rousselet MC, Carrere F, Croue A, Andre C, Oksman
F, Chevailler A, Hurez D: Golgi autoantibodies and autoantigens.
J Autoimmun 7:133-143, 1994
14. Fritzler MJ, Hamel JC, Ochs RL, Chan EKL: Molecular characterization of two human autoantigens: unique cDNAs encoding
9.5- and 160-kD proteins of a putative family in the Golgi complex.
J Exp Med 178:49-62, 1993
1.5. Seelig HP, Schranz P, Schroter H, Wiemann C, Griffiths G, Renz
M: Molecular genetic analyses of a 376-kilodalton Golgi complex
membrane protein (Giantin). Mol Cell Biol 14:2.564-2.576, 1994
16. Seelig HP, Schranz P, Schroter H, Wiemann C, Renz M:
Macrogolgin-a new 376 kD Golgi complex outer membrane
protein as target of antibodies in patients with rheumatic diseases
and HIV infections. J Autoimmun 757-91, 1994
17. Lindstedt AD, Hauri HP: Giantin, a novel conserved Golgi
membrane protein containing a cytoplasmic domain of at least 350
kDa. Mol Biol Cell 4:679-693, 1993
18. Sohda M, Misumi Y, Fujiwara T, Nishioka M, Ikehara Y: Molecular cloning and sequence analysis of a human 372-kDa protein
localized in the Golgi complex. Biochem Biophys Res Commun
20S:1399-1408, 1994
19. Fritzlcr MJ, Lung C, Hamel JC, Griffith K, Chan EKL:
Molecular characterization of golgin-245: a novel Golgi complex protein containing a granin signature. J Biol Chem 270:
31262-31268, 199.5
1701
20. Erlich R, Gleeson PA, Campbell P, Dietzsch E, Toh B: Molecular
characterization of trans-Golgi p230. J Biol Chem 271 :8328-8337,
1996
21. Fox R1, Robinson CA, Curd JG, Kozin F, Howell FV: Sjogren’s
syndrome: proposed criteria for classification. Arthritis Rheum
29577-585, 1986
22. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield
NF, Schaller JG, Tala1 N, Winchester RJ: The 1982 revised criteria
for the classification of systemic lupus erythematosus. Arthritis
Rheum 2.5:1271-1277, 1982
23. Masi AT, Rodnan GP: Preliminary criteria for the classification of
systemic sclerosis (scleroderma). Bull Rheum Dis 31:l-6, 1981
24. Towbin H, Staehclin T, Gordon J: Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76:43504354, 1979
25. Apte AN, Siebert I’D: Anchor-ligated cDNA libraries: a technique
for generating a cDNA library for the immediate cloning of 5‘
ends of mRNA. BioTechniques 15:890-893, 1993
26. Lung C, Chan EKL: Simplifying 5‘ RACE in the hunt for
full-length cDNAs. Trends Genet 12:389-391, 1996
27. Adam SA, Nakagawa T, Swanson MS, Woodruff TK, Dreyfus G:
mRNA polyadenylate binding protein: gene isolation and sequencing and identification of a ribonucleoprotein consensus sequence.
Mol Cell Biol 6:2932-2943, 1986
28. Devereux J, Haeberli P, Smithies 0: A comprehensive set of
sequence analysis programs for the VAX. Nucleic Acids Res
12:387-39.5, 1984
29. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local
alignment search tool. J Mol Biol 21.5:403-410, 1990
30. Lupas A, van Dyke M, Stock J: Predicting coiled coils from protein
sequences. Sciencc 2.52:1162-1164, 1991
31. Orci L, Tagaya M, Amherdt A, Perrelett A, Donaldson JG,
Lippincott-Schwartz J, Klausner RD, Rothman JE: Brefeldin A, a
drug that blocks secretion, prevents the assembly of non-clathrincoated buds on Golgi cisternae. Cell 64:1183-1195, 1991
32. Kozak M: An analysis of 5‘honcoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 1m2.5-8 148, 1987
33. Simon J, Aunis D: Biochemistry of the chromogranin A protein
family. Biochem J 262:l-13, 1989
34. Huttner WB, Gerdes H, Rosa P: Thc granin (chromogranini
secretogranin) family. Trends Biochem Sci 16:27-30, 1991
3.5. Kooy J, Toh B-H, Pettit JM, Erlich R, Gleeson PA: Human
autoantibodies as reagents to conserved Golgi components. J Biol
Chem 267:202.55-20263, 1992
36. Jensen RA, Thompson ME, Jetton TL, Szabo CI, van der Meer R,
Helou B, Tronick SR, Page DL, King MC, Holt JT: BRCAl is
secreted and exhibits properties of a granin. Nat Genet 12:303308, 1996
37. Chen Y, Chen CF, Riley DJ, Allred DC, Chen PL, von Hoff D,
Osborne CK, Lee WH: Aberrant subcellular localization of
BRCAl in breast cancer. Science 270:789-791, 1995
38. Steeg PS: Granin expectations in breast cancer? Nat Genet
12:223-22.5, 1996
39. Yang CH, Lambie EJ, Snyder M: NuMA an unusually long
coiled-coil related protein in the mammalian nucleus. J Cell Biol
116:1303-1317, 1992
40. Pollard KM, Chan EKL, Grant BJ, Sullivan KF, Tan EM, Glass
C A In vitro post-translational modification of lamin B cloned
from a human T-cell line. Mol Cell Biol 10:2164-2175, 1990
41. Cunningham MW, Antone SM, Gulizia JM, McManus BA, Gauntt
CJ: a-helical coiled-coil molecules: a rolc in autoimmunity against
the heart. Clin Immunol Immunopathol 68:118-123, 1993
42. Chan EKL, Hamel JC, Buyon JP, Tan EM: Molecular definition
and sequence motifs of the 52-kD component of human SS-AIR0
autoantigen. J Clin Invest 8758-76, 1991
43. Chan EKL, Di Donato F, Hamel JC, Tseng C, Buyon JP: 52-kD
GRIFFITH ET AL
1702
44.
45.
46.
47.
48.
49.
SS-NRo: genomic structure and identification of alternatively
spliced transcript encoding a novel leucine zipper-minus autoantigen expressed in fetal and adult heart. J Exp Med 182:983-992,
1995
Yaneva M, Wen J, Ayala A, Cook R: cDNA-derived amino acid
sequence of the 86-kDa subunit of the Ku antigen. J Biol Chem
264:13407-1 3411, 1989
Abel T, Maniatis T: Action of leucine zippers. Nature 341:24-25,
1989
Landschulz WH, Johnson PF, Adashi E, Graves BJ, McKnight SL:
Isolation of a recombinant copy of the gene encoding CEBP.
Genes Dev 2:786-800, 1988
Buckland R, Malvoisin E, Beauverger P, Wild F: A leucine zipper
structure present in the measles virus fusion protein is not required
for its tetramerization but is essential for fusion. J Gen Virol
73:1703-1707, 1992
Tucker S, Srinivas R, Copmans R: Molecular domains involved in
oligomerization of the Friend leukemia virus envelope protein.
Virology 16:2431-2444, 1991
Rossie KM, Piesco NP, Charley MR, Oddis CV, Steen VD, Fratto
50.
51.
52.
53.
J, Deng JS: A monoclonal antibody recognizing Golgi apparatus
produced using affinity purified material from a patient with
connective tissue disease. Scand J Rheumatol 21:109-115, 1992
Hida C, Tsukamoto T, Wan0 H, Yamamoto T Ultrastructural
localization of anti-Purkinje cell antibody-binding sites in paraneoplastic cerebellar degeneration. Arch Neurol 51:555-558, 1994
Solimena M, Aggujaro D, Muntzel C, D i r k R, Butler M, de
Camilli P, Hayday A. Association of GAD-65, but not of GAD-67,
with the Golgi complex of transfected Chinese hamster ovary cells
mediated by the N-terminal region. Proc Natl Acad Sci U S A
90:3073-3077, 1993
Huidbuchel E, Blaschek M, Seigneurin JM, Lamour A, Berthelot
JM, Youinou P: Anti-organelle and anti-cytoskeletal autoantibodies in the serum of Epstein-Barr virus-infected patients. Ann Med
Interne (Paris) 142:343-346, 1991
Gentric A, Blaschek M, Julien C, Jouquan J, Pennec Y, Berthelot
JM, Mottier D, Casburn-Budd R, Youinou P: Nonorgan-specific
autoantibodies in individuals infected with type 1 human immunodeficiency virus. Clin Immunol Immunopathol59:487-494, 1991
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 042 Кб
Теги
cloning, complex, associates, molecular, syndrome, autoantigen, sjgren, golgi, novem
1/--страниц
Пожаловаться на содержимое документа