close

Вход

Забыли?

вход по аккаунту

?

Overexpression Nanog Activates Pluripotent Genes in Porcine Fetal Fibroblasts and Nuclear Transfer Embryos.

код для вставкиСкачать
THE ANATOMICAL RECORD 294:1809–1817 (2011)
Overexpression Nanog Activates
Pluripotent Genes in Porcine Fetal
Fibroblasts and Nuclear Transfer
Embryos
LI ZHANG, YI-BO LUO, GERELCHIMEG BOU, QING-RAN KONG,
YAN-JUN HUAN, JIANG ZHU, JIAN-YU WANG, HUI LI, FENG WANG,
YONG-QIAN SHI, YAN-CHANG WEI, AND ZHONG-HUA LIU*
Department of Life Science, Northeast Agriculture University, Heilongjiang Province, China
ABSTRACT
Nanog as an important transcription factor plays a pivotal role in
maintaining pluripotency and in reprogramming the epigenome of somatic cells. Its ability to function on committed somatic cells and embryos
has been well defined in mouse and human, but rarely in pig. To better
understand Nanog’s function on reprogramming in porcine fetal fibroblast
(PFF) and nuclear transfer (NT) embryo, we cloned porcine Nanog CDS
and constructed pcDNA3.1 (þ)/Nanog and pEGFP-C1/Nanog overexpression vectors and transfected them into PFFs. We studied the cell biological changes and the expression of Nanog, Oct4, Sox2, Klf4, C-myc, and
Sall4 in transfected PFFs. We also detected the development potential of
the cloned embryos harboring Nanog stably overexpressed fibroblasts and
the expression of Oct4, Sox2, and both endogenous and exogenous Nanog
in these embryos. The results showed that transient overexpression
Nanog in PFF could activate the expression of Oct4 (5-fold), C-myc (2fold), and Sall4 (5-fold) in somatic cells, but they could not be maintained
during G418 selection. In NT embryos, although Nanog overexpression
did not have a significant effect on blastocyst development rate and blastocyst cell number, it could significantly activate the expression of endogenous Nanog, Oct4, Sox2 to 160-fold, 93-fold, and 182-fold, respectively (P
< 0.05). Our results demonstrate that Nanog could interact with and activate other pluripotent genes both in PFFs and embryos. Anat Rec,
C 2011 Wiley-Liss, Inc.
294:1809–1817, 2011. V
Key words: pig; Nanog; overexpression; pluripotent genes;
activation
INTRODUCTION
Nanog is a novel pluripotent gene that plays a crucial role
in maintaining the undifferentiated state of mouse embryonic stem cells (mESCs) and inner cell mass (Chambers
et al., 2003; Mitsui et al., 2003). We all know there are three
ways to erase the developmental programming of differentiated cell nuclei, nuclear transfer (NT) into enucleated
oocytes, cell fusion with pluripotent stem cells or introduction of combination defined transcriptional factors into somatic cells. In generating induced pluripotent stem cells
(iPSCs), Nanog is not included in the classic four factors
(Oct4, Sox2, Klf4, and C-myc), but it plays important role in
reprogramming by interacting with these pluripotent-associC 2011 WILEY-LISS, INC.
V
Additional Supporting Information may be found in the
online version of this article.
Li Zhang and Yi-Bo Luo contributed equally to this work.
Grant sponsor: The National Basic Research Program of China;
Grant number: 2009CB94100; Grant sponsor: National Natural
Science Foundation of China; Grant number: 30871431.
*Correspondence to: Zhong-Hua Liu, Department of Life Science, Northeast Agriculture University, Heilongjiang Province,
China. Fax: þ86045 155191747. E-mail: liu086@yahoo.com
Received 18 April 2011; Accepted 12 June 2011
DOI 10.1002/ar.21457
Published online 3 October 2011 in Wiley Online Library
(wileyonlinelibrary.com).
1810
ZHANG ET AL.
ated genes. Actually, Nanog with Lin28 could replace Klf4
and C-myc then directly participate in reprogramming
human somatic cells (Yu et al., 2007; Choi et al., 2009;
Hanna et al., 2009). The activation of endogenous Nanog is
indispensable for generating iPSCs that had the ability to
contribute to adult chimeras (Takahashi and Yamanaka,
2006; Okita et al., 2007). Besides, Nanog is essential for
transforming the dedifferentiated intermediates to ground
state pluripotency in reprogramming process (Silva et al.,
2008). Overexpression Nanog in ESCs could enhance the
transfer of pluripotency in fusion experiment and overexpression Nanog is adequate to convert epiblast stem cells to
ground state pluripotency (Silva et al., 2009).
Pig is considered as a useful and meaningful animal
model in therapeutic and biomedical research, such as
bioreactor and xenotransplantation. ESCs have been considered as a useful tool for generating transgenic pig.
However, the research of these potential applications progressed slowly, because no authentic porcine ESCs is
available to date (Li et al., 2004; Brevini et al., 2007; Kim
et al., 2007; Hall, 2008; Kim et al., 2010). Although three
groups announced recently they had established iPSCs in
pig by introduced human or mouse derived transcriptional factors (Oct4, Sox2, Klf4, and C-myc), none of them
successfully applied the iPSCs in generating chimeras,
which is the basic standard to define pluripotency (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009). Only
one report showed that porcine mesenchymal stem cells
(MSCs) transduced with six human transcription factors
(Nanog,Oct4, Sox2, Klf4, C-myc, and Lin28) could generate chimeras and suggested the insufficient endogenous
Nanog expression may be responsible for the failure of
generating chimeras (West et al., 2010). A recent report
also mentioned that pig iPSCs generated by six genes had
higher percentage of undifferentiated colonies during the
early passages (Wu et al., 2009). All the work reminded us
to pay attention to the Nanog’s function on reprogramming in pig, especially on the interaction with other pluripotent genes. Most of studies were merely confined to
Nanog expression patterns by immunofluorescence and
real time-PCR in porcine embryos and somatic stem cells,
but the function of its role in cellular reprogramming and
early embryo development by cooperating with other
genes is still not defined. (Blomberg et al., 2008; Goel
et al., 2008; Magnani and Cabot, 2008; Hall et al., 2009).
In this study, we cloned Nanog CDS and subcloned it to
pcDNA3.1 (þ) and pEGFP-C1 vector. After transfecting the
vectors into porcine fetal fibroblast (PFF), we systematically
detected the biological characteristics of these cells and the
expression of Oct4, Sox2, Nanog, Klf4, C-myc, and Sall4
both in transient and stable transfected PFF. We also constructed NT embryos derived from Nanog overexpressed
PFF and analyzed the development potential in vitro. The
expression of the pluripotency master genes, Oct4, Sox2,
and Nanog in different stages of early embryos was also
detected by quantitative Real time-PCR. This research could
help us to better understand the role of Nanog in cellular
reprogramming and early embryos development in pig.
MATERIALS AND METHODS
Gene Cloning and Vector Construction
The Nanog gene was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) using total
RNA extracted from pools of MII stage oocytes using Tri-
zol (Invitrogen). And the total RNA was reverse transcript using High Capacity cDNA Reverse Transcription
Kit (ABI). The PCR amplification was carried out for one
cycle with denaturing at 94 C for 4 min, and 35 subsequent cycles with denaturing at 95 C for 30 s, annealing
at 56.5 C for 30 s, extension at 72 C for 30 s, and a final
extension at 72 C for 10 min. The sense primers 50 -AT
GAGTGTGGATCCAGCTTGTC-30 and antisense primer
50 -TCACATATCTTCAGGCTGTATG-30 are used for
Nanog cloning. To construct the pcDNA3.1 (þ)/Nanog
plasmid, the Nanog cDNA was insert into pcDNA3.1 (þ)
(Invitrogen) between HindIII and XhoI. Nanog cDNA
was also inserted into pEGFP-C1 (Invitrogen) between
BglII and XhoI to generate pEGFP-C1/Nanog that
expresses GFP-Nanog fusion protein.
Cell Culture and Transfection
Pig Fetal Fibroblasts (PFF) were isolated from 35-daysold male fetus, which were dissected by scalpel blade in
PBS buffer and then treated in collagenase/DNAse I at
37 C for 45 min. The solution was mixed with PFF culture
medium: DMEM (high glucose) supplemented with 10%
FBS and penicillin/streptomycin (all the reagents are
from Gibco), centrifuged at 1,000 rpm for 5 min and suspended in PFF culture medium. The cells were passaged
in PFF culture medium without any antibiotics.
For transfection experiment, cells were plated in a
3.5-cm plate to achieve 80–90% confluence within 24 h
in PFF culture medium without penicillin/streptomycin.
Cells were transfected with Lipofactamine 2000 (Invitrogen) according the instruction with a ratio of 3:1 transfection reagent (ml): DNA (mg). Cells were passaged 24 h
after transfection. Selection medium DMEM (high glucose supplemented with 10% FBS and 500 ug/mL G418)
replaced the PFF culture medium after cells adhesion.
Cells for stable selection were rendered by G418 selection for 20 days, when the untransfected cells died completely, while cells for transient transfection were
harvested at 24 h later after transfection.
Immunofluorescence
Porcine fibroblasts were seeded and cultured for up to 3
days before analysis. Growth medium was removed, and
the cells were fixed with 4% Para formaldehyde/PBS (pH
7.4) for at least 40 min, followed by permeabilization with
1% TritonX-100 at room temperature for 30 min, blocked
in 1% BSA supplemented PBS for 1 h and then incubated
with rabbit anti-Nanog antibody (Santa Cruz; 1:200) overnight at 4 C. After three washes with PBS containing
0.1% Tween 20 and 0.01% Triton X-100 for 5 min each,
fibroblast cells were labeled with 1:200 FITC-conjugated
IgG for 1 h at room temperature. After washing in PBS
containing 0.1% Tween 20 and 0.01% Triton X-100, the
cells were co-stained with Hoechst33342 (10 mg/mL in
PBS) and imaged on a Nikon Eclipse 80i microscope.
Oocytes In-Vitro Maturation
Pig (Sus scrofa) ovaries from prepubertal gilts were collected at a local slaughterhouse and transported to the
laboratory in an insulated container at 37 C. Antral follicles between 5 and 8 mm in diameter were aspirated
manually with a disposable 10-cc syringe and an 18-gauge
NANOG ACTIVATES PORCINE GENES EXPRESSION
needle. Follicular fluid was pooled and allowed to settle by
gravity. Cumulus-oocytes complexes (COCs) were resuspended in Hepes-buffered medium containing 0.01% polyvinyl alcohol (PVA). Under a dissecting microscope, COCs
with multiple layers of intact cumulus cells were selected
for the experiments. Around 50–75 COCs were placed in
500 mL of tissue culture medium 199 (TCM-199; Gibco
BRL, Grand Island, NY) containing 0.14% PVA, 10-ng/mL
epidermal growth factor, 0.57-mM cysteine, 0.5-IU/mL pig
FSH, and 0.5-IU/mL ovine LH. COCs were matured for
42–44 h at 39 C and 5% CO2 in air, 100% humidity. All
chemicals were obtained from Sigma Chemical Company
(St. Louis, MO) unless stated otherwise.
In Vitro Fertilization, NT and Embryos Culture
Following short time incubation at 39.5 C, the
extended semen was resuspended with DPBS (0.1%
BSA), and washed 2 times with DPBS (0.1% BSA) by
centrifugation at 2,000 rpm for 4 min. The spermatozoa
concentration was measured using a hemocytometer and
the proportion of motile sperm was determined. The
spermatozoa were diluted with mTBM to optimal concentration. Cumulus-free matured oocytes were washed
three times in mTBM IVF medium. Approximately, 30–
35 oocytes were transferred into 50-mL droplets of IVF
medium covering with mineral oil that had been equilibrated for 30 min at 39.5 C in 5% CO2 in air before adding the sperm. 50-mL sperm sample was added to the
fertilization droplets containing oocytes, giving a final
sperm concentration of 6 104 cells/mL. Oocytes were
coincubated with sperm in mTBM for 5 h. Then the
oocytes were washed and cultured in PZM-3.
The in-vitro mature oocytes were enucleated by aspirating the first polar body and the adjacent cytoplasm in
manipulation droplet (TCM-199-HEPES enriched with
0.3% BSA). Nanog stably overexpressed PFF were used
as donor cells and were placed under the zona pellucida
of enucleated oocytes. Fusion/activation was induced by
successive DC impulse of 1.2 kv/cm for 30 ls. Constructed embryos were cultured in PZM-3 at 39 C under
5% CO2 in air. The blastocysts were collected at 156 h,
and then were stained in DPBS enriched with 10 mg/L
Hoechst33342 in dark. After staining, the blastocysts
were transferred to slides with 7-uL glycerol on it, covering with cover glass and mounting by nail polish. The
wavelength of 488 nm was used to detect whether the
blastocysts were GFP positive.
1811
Quantitative Real-Time Polymerase
Chain Reaction
Real-time PCR was performed using the SYBR Premix
Ex TaqTM (TaKaRa) and the 7300 Real-Time PCR System (Applied Biosystems), with the following parameters: 95 C for 10 s, followed by 40 cycles at 95 C for 5 s
and at 61 C for 34 s. Negative controls in the PCR assay
including an RT reaction are completed by the same procedure with no templates. For each cDNA sample, both
target and reference genes were amplified independently
on the same plate and in the same experimental run in
triplicate.
Statistical Analysis
The levels of gene expression among three groups
were analyzed using analysis of variance (ANOVA) and
t-test by Stat View (SAS Institute, Cary, NC); P values
<0.05 were considered significantly different.
RESULTS
Cloning of Porcine Nanog CDS and
Construction of pcDNA3.1 (1)/Nanog and
pEGFP-C1/Nanog Vector
The complete cDNA of Nanog was cloned from RNA of
MII stage oocytes by RT-PCR. Confirmed by DNA
sequencing, CDS of Nanog was composed of 915 nucleotides, and shared 99.8% identity with porcine Nanog in
NCBI (GenBank accession no.FJ882402.1), and there
are two nucleotide substitutions at 562 (G to A) and 572
(A to G) site. The alignment showed that the similarities
of Nanog CDS sequence of pig with human, mouse, rat,
bovine, goat and monkey were 80.3, 72.4, 72.2, 86.0,
86.7, and 79.5%, and the similarities of amino acid
sequence were 72.9, 60.5, 61.0, 81.9, 83.3, and 72.6%,
respectively. The homeodomain shared 100% identity
with porcine Nanog in NCBI, 98% identity with bovine
and goat, and the lowest identity with mouse and rat.
The amplified PCR product was subcloned into the
pcDNA3.1 (þ) and pEGFP-C1 to produce the pcDNA3.1
(þ)/Nanog (PC-Nanog), pEGFP-C1/Nanog (PG-Nanog)
vectors. The Blast results of CDS and encoded amino
acids from different species were present in Supporting
Information Figure 1.
Successful Expression of Exogenous
Nanog in PFF
RNA Isolation and Reverse Transcription
Total RNA was extracted from pools of MII oocytes
(100–200) using the Absolutely RNA Microprep Kit
(Stratagene). Total RNA was extracted from pools of
embryos (40–80) at the following stages: 2-cell, 4-cell, 8cell, morula and blastocyst. Oocytes and embryos were
washed three times in PVA-PBS (nuclease free) and
lysed in 100-lL lysis buffer (Stratagene), and then
stored at 80 C until total RNA isolation. High-Capacity
cDNA Reverse Transcription Kit (ABI) was used for
gene cloning. PrimeScriptV RT reagent Kit was used to
perform Reverse transcription for Real time-PCR according to manufacturer’s instructions (TaKaRa).
R
We used PG-Nanog to express GFP-NANOG fusion
protein to confirm the expression and the localization of
exogenous Nanog. After transient transfection, PFF
were transformed from the normal phenotype into proliferative phenotype that the shape of cells became round
and small (Fig. 1B). We found the GFP-Nanog was localized in the nuclei of both stably and transiently transfected PFF (Fig. 1C,D). Real time-PCR results
demonstrated that Nanog mRNA was successfully
expressed in transient and stable transfected PFF (Fig.
2A). Immunofluorescence analysis also showed that
Nanog protein was expressed in PFF stably transfected
by PC-Nanog (Fig. 2B).
1812
ZHANG ET AL.
Fig. 1. The morphology of transfected PFF and expression of GFPNanog fusion protein. The morphology of pcDNA3.1 (þ) transiently
transfected PFF (A) and pcDNA3.1 (þ)/Nanog (PC-Nanog) transiently
transfected PFF (B). GFP-Nanog fusion protein was localized in the
nuclei of pEGFP-C1/Nanog (PG-Nanog) stably transfected PFF (C)
and transiently transfected PFF (D). GFP expression was visualized
under blue light. Both of cells in (A) and (B) were observed at 24 h after transfection without G418 selection.
Activation of Pluripotent Genes by Nanog
Overexpression in PFF
0.05), compared with the control group (Fig. 3A). We
then analyzed the expression level of these pluripotent
genes in transfected PFF after G418 selection for 20
days (Fig. 3B).Compared with the control group, Nanog
expression increased by 20-fold (Fig. 2B). But the
expression of Oct4, Sox2, C-myc declined significantly (P
< 0.05). The expression of Klf4 and Sall4 changed
insignificantly.
To clarify if Nanog can interact with other pluripotent
genes in PFF, we detected the expression level of Nanog
at 1, 5, 10, and 15 days post-transfection without G418
selection by Real-time PCR. Compared with the Nanog
expression level in PFF, Nanog expression after transient transfection were 2664, 123, 64, 9-fold at 1, 5, 10,
and 15 days, respectively. Nanog peaked at Day 1 and
decreased gradually (Supporting Information Figure 2).
Based on these data in our preliminary experiment, we
examined the expression level of pluripotent genes Oct4,
Sox2, C-myc, Klf4, and Sall4 at Day 1 after transfection
when Nanog expression was at the peak. The expression
level of Oct4, Sox2, Klf4, C-myc, and Sall4 were 4.7- and
5.4-fold, 1.4- and 0.9-fold, 1.4- and 1.3-fold, 2.2 and 1.6fold, 4.9- and 1.9-fold in PFF transfected by PC-Nanog
and PG-Nanog, respectively. The expression level of
Oct4, Sall4, and C-myc increased significantly (P <
Activation of Endogenous Oct4, Sox2, and
Nanog in NT Embryos Derived from Nanog
Overexpressed PFF
We used pcDNA3.1 (þ) empty vector and pcDNA3.1
(þ)/Nanog vector stably transfected cells as donor cells
for SCNT. All reconstructed embryos were in vitro cultured at 6.5 days, and there were no statistic differences
in the fusion rate, cleavage rate, and the blastocyst rate
and the blastocyst cell numbers among the three groups.
NANOG ACTIVATES PORCINE GENES EXPRESSION
1813
Fig. 2. Nanog protein successfully expressed in PFF. Relative expression of Nanog in transiently transfected PFF and stably transfected PFF by PC-Nanog and PG-Nanog (A). Immunofluorescence results
also showed that Nanog protein was expressed in PFF stably transfected by PC-Nanog. Nuclei were
stained by Hoechst33342 (B).
We analyzed Oct4, Sox2, both endogenous Nanog and
whole amount of Nanog expression level by Real timePCR in NT embryos derived from Nanog overexpressed
PFF (NT-Nanog). We used different primers for detecting
exogenous Nanog and whole amount expression of
Nanog in embryos. Exogenous Nanog expression could
be obtained by the different values. We found exogenous
Nanog peaked at 4-cell stage, while endogenous Nanog,
Oct4 and Sox2 got to the highest level at morula stage,
the transcripts increased by 159-fold, 93-fold, and 180fold, respectively (Fig. 4B). In blastocysts, all the three
genes expression decreased to a very low level (Fig. 4B).
As controls we also detected genes expression both in in
vitro fertilized (IVF) and NT embryos. There were no
obvious variation in the Oct4 and Sox2 expression
among the different cleavage embryos, only Nanog had a
significant increase in 8-cell embryos both in IVF and
NT embryos (P < 0.05). In NT embryos, Nanog expression was significantly lower than that in IVF embryos at
morula stage (P < 0.05).
DISCUSSION
Transient Elevation of Nanog Expression can
Activate Pluripotent Genes Expression
Nanog is one of the core transcription factors involved
in cellular pluripotency. Although high throughput studies showed there was a list of Nanog target genes in different types of cell line, few results provided directly
data showing Nanog interacting with and regulating
other genes by classical experimental approaches, especially in porcine committed cells and embryos. Oct4,
Sox2, Klf4, and C-myc are the key factors both in
mESCs and iPSCs. Sall4 is also an important component
of the transcription regulatory net works in ES cells by
cooperating with Nanog and plays positive roles in the
generation of pluripotent stem cells from blastocysts and
fibroblasts (Wu et al., 2006; Tsubooka et al., 2009). All
the endogenous genes we looked at in this study have
direct or indirect relations with Nanog.
Results in this study clearly showed ectopic expressed
porcine Nanog in PFF could upregulate Oct4, C-myc,
and Sall4 but could not active Sox2 and Klf4. It indicated that porcine Nanog had similar properties in PFF,
at least partially, which were described for Nanog in primate and mouse ESCs. In both humans and mice,
research shows that Nanog could bind to the upstream
element of Oct4 and cooperate with other core transcription factors to activate Oct4 expression thereby maintaining the pluripotency (Boyer et al., 2005; Rodda
et al., 2005; Pan and Thomson, 2007). In mESCs, Nanog
interacts with Sall4 in a way similar with that of Oct4
and Sox2 to activate each other, thus helps to set up the
pluripotency regulatory circuits (Wu et al., 2006). It is
also found that C-Myc is a downstream factor of Nanog
(Loh et al., 2006). Klf4 could promote cell proliferation
by suppressing p53 expression. Since p53 is a negative
regulator of Nanog, Klf4 may be an upstream factor in
the activation of Nanog during reprogramming by suppressing p53 expression (Zhang et al., 2010). So
1814
ZHANG ET AL.
transient transfection of Nanog in our study could not
activate Klf4 directly. However, it is unexpected that
Nanog could activate Sox2 in NT embryos but could not
upregulate Sox2 expression in PFF. One possibility is
that Nanog shares different targets between porcine
embryos and fibroblasts. Microarray analysis confirms
that there is very little overlap of Nanog’s target genes
in cell lines derived from different tissues, suggesting
that Nanog’s target genes are variable in a tissue specific manner (Piestun et al., 2006). The genome is demethylated in ESCs and embryos, so Nanog is prone to
occupy its target sites in many promoters (Boyer et al.,
2005). Another possible explanation is that Nanog is not
enough to activate Sox2 in PFF, but along with additional transcription factors existed in embryos to activate Sox2 successfully.
Pluripotent Genes Expression Cannot be
Maintained During G418 Selection
Fig. 3. Relative expression of pluripotent-related genes after transient and stable transfection by PC-Nanog and PG-Nanog in PFF.
Genes expression in transiently transfected PFF was detected at 24 h
after transfection and in stably transfected PFF with G418 selection
for 20 days. Fold difference was calculated with respect to the PFF
transfected by pcDNA3.1 (þ) empty vector. Bars represent the means
standard errors of three independent experiments.
In our experiment, after 20 days’ G418 selection, the
expression of Oct4, C-myc and Sall4 gradually silenced,
although Nanog could still be maintained at comparatively high level. We speculate that transient high Nanog
expression can activate part of the pluripotency related
genes in PFF, but it is not enough for inducing PFF to a
fully pluripotent state, thus cannot set up the stable regulatory circuit. Pan et al. also indicate that the key pluripotent factors always work together to control the whole set
of pluripotency machinery rather than work individually
(Pan and Thomson, 2007). So in a partially transformed
PFF, these activated pluripotent genes can be easily
silenced in many ways including DNA highly methylating. And C-myc as the target transcriptional factors of
Nanog has the function in loosing chromosome structure,
which makes many transcriptional factors prone to
Fig. 4. Constructed embryos using PFF, PC and PC-Nanog stably
transfected PFF as donor cells develop to blastocysts in vitro (40)
(A). Relative expression of endogenous Nanog, whole amount of
Nanog, Oct4 and Sox2 in porcine IVF, NT and NT-Nanog embryos at
different stages (B). Nanog histogram height of green bars represents
total Nanog mRNA relative expression; Histogram height of purple
bars represents endogenous Nanog expression. Exogenous Nanog
expression could be obtained by the different values, which in figure
4B are the green parts. Different subscripts represent significant differences among the three kinds of embryos at the same development
stages after t-test by Stat View (P values <0.05). Fold difference was
calculated with respect to the MII stage oocytes.
1815
NANOG ACTIVATES PORCINE GENES EXPRESSION
TABLE 1. Primers for quantitative Real time-PCR
Gene
Primer sequences (50 to 30 )
Product size (bp)
GenBank accession no.
Klf4
F:TGGGTGCGGAGGAACTGCTA
R:GGGACTGACCTTGGTAATGGAGC
F:CCCCTACCCGCTCAACGACA
R:AGCCAAGGGTTCGGGACTGC
F:GAAGGTGTTCAGCCAAACGAC
R:CGATACTTGTCCGCTTTC
F:AACCAGAAGAACAGCCCAGAC
R:TCCGACAAAAGTTTCCACTCG
F:ATCCACCTCCGCTCCCATACC
R:CGTTGCCTGCCGTCATCTTGT
F:AGCCTCCAGCAGATGCAAGAACTCT
R:TTCTGCCACCTCTTACATTTCATTCG
F:AGCCCCAGCTCCAGTTTCAGC
R:AATGATCGTCACATATCTTCAGGCTGTA
F:GCCCGAAGCGTTTACTTTGA
R:CCGCGGTCCTATTCCATTATT
153
NM_001005154.1
133
NM_001005154.1
185
NM_001113060.1
155
NM_001123197.1
166
NM_001114673.1
181
FJ882402.1
104
FJ882402.1
C-myc
Oct4
Sox2
Sal14
Nanog
EndoNanog
18SrRNA
93
NR_002170.3
TABLE 2. Development potential of NT embryos produced by different donor cells
Donor cells
pCDNA transfected PEF
pCDNA3.1(þ)/Nanog transfected PEF
PEF(F-7)
No. of
embryos
produced
No. of
embryos fused
(% SD)
No. of embryos
cleaved
(% SD)
No. of
blastocysts
(% SD)
Nuclear
numbers
of blastocysts
242
243
224
168(70.2 14.9)
210(86.4 4.3)
168(75.1 9.6)
67(40.2 11.6)
83(39.1 20.2)
86(43.8 22.8)
21(12.1 5.0)
28(14.1 3.4)
33(17.8 7.9)
49 4.6
50 5
67 2.6
binding to the genome DNA site. Following with Nanog
expression decreased intensively, C-myc has an extraordinary reduction in PFF, which made other pluripotent
genes (Oct4, Sox2, and Nanog) difficult to bind to the target site in condensed chromosomes. As a result, the transcription factors are degraded and represent significant
reduction. That might be the reason that Oct4, Sox2, and
C-myc were inhibited in Nanog stable expressed PFF.
Exogenous Nanog Activates Endogenous Oct4,
Sox2, and Nanog Expression in NT Embryos
Nanog is a critical regulator for embryonic development and plays an important role in lineage differentiation by cooperating with Oct4, which has been defined in
mouse, but are still not clearly understood in pig
(Strumpf et al., 2005; Messerschmidt and Kemler, 2010).
Immunofluorescence studies demonstrate that Nanog
expression cannot be detected in in vitro porcine blastocysts and Oct4 is not confined to the ICM, which is not
identical with the studies in mouse (Kuijk et al., 2008).
In this study, we find that there is expression of Nanog,
Oct4, and Sox2 both in IVF and NT porcine embryos
from 2-cell to morula stage, which keeps a comparatively
stable level except there is an elevation of Nanog at 8cell stage. However, all of these three genes expression
is downregulated at blastocyst stage, which is partially
coincident with the previous reports (Magnani and
Cabot, 2008; Xing et al., 2009). Although overexpression
Nanog in transgenic NT embryos could activate endogenous Nanog, Oct4, and Sox2 expression and the level is
much higher than that is in IVF and normal NT
embryos, these genes expression is still downregulated
at blastocyst stage. Combining with the result that the
expression of all these three genes have no influence on
the embryos’ development in vitro which is assessed by
blastocyst rate and blastocyst cell number, we speculate
that Nanog cooperating with Sox2 and Oct4 may function as a key regulating factor in ICM/trophoblast and
epiblast /hypoblast differentiation at a relatively late
stage of porcine blastocysts compared with mouse
embryos. After all, there exists a long spanning blastocyst stage and different developmental process in porcine embryos. And a recent study also demonstrated
that Nanog was detected later in the epiblast and hypoblast of spherical blastocysts of pig (Wolf et al., 2011).
But in early developmental stages before morula, it
must play other regulatory roles different with that in
the later stage, which is still needed to be identified.
Formation of ES-like Colony Observed in
Nanog Overexpressed PFF
Another interesting phenomenon in our study is that
we observed the formation of ES-like colonies (Supporting Information Figure 3). Both sizes and shapes of
these colonies were not disciplinary with unclear cell
boundaries. By removal of these colonies, the rest of the
basal cells could regenerate colonies through passaging.
But after 15–20 days, it would not reoccur. To exclude
the possibility that transfection and followed prolonged
antibiotic selection cause considerable stress on the cultured cells, we also ran the control experiments that
transfection with pcDNA3.1(þ) empty vector in PFF, but
we did not find the colonies that we observed in PFF
transfected either by pcDNA3.1(þ)/Nanog or by pEGFPC1/Nanog. Previous studies point that overexpression
Nanog in fibroblasts results in increased cell proliferation and transformation of foci-forming phenotype
(Zhang et al., 2005). Although overexpression Nanog in
1816
ZHANG ET AL.
human ESCs and MSCs can enhance colony formation
(Darr et al., 2006; Liu et al., 2009). These results indicate that in PFF the porcine Nanog can promote colony
formation as in human ESCs and MSCs, other than just
promote cell proliferation that also happens in other species fibroblast. Actually, we examined changes in cell
doubling time in Nanog transfected cells and the results
showed that Nanog could also promote the proliferation
of PFF (Supporting Information Figure 4). We presume
this phenomenon caused by Nanog overexpression may
be also associated with LIF/Stat3 signal pathway,
because our results showed there was expression elevation of LIF, LIFr, Gp130, and Stat3 in the Nanog transient overexpression PFF (Supporting Information
Figure 5). Primers are shown in Supporting Information
Table 1. All the information strongly suggests that
Nanog should be one of the key factors for porcine iPSCs
induction.
ACKNOWLEDGEMENTS
The authors are grateful to Jun-Yu Ma at Northeast
Agricultural University for his valuable discussions. The
authors are also thankful to colleagues in the ‘‘Lab of
Embryo Biotechnology’’ for their helpful discussions.
LITERATURE CITED
Blomberg LA, Schreier LL, Talbot NC. 2008. Expression analysis of
pluripotency factors in the undifferentiated porcine inner cell
mass and epiblast during in vitro culture. Mol Reprod Dev
75:450–463.
Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker JP,
Guenther MG, Kumar RM, Murray HL, Jenner RG, Gifford DK,
Melton DA, Jaenisch R, Young RA. 2005. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122:947–
956.
Brevini TA, Antonini S, Cillo F, Crestan M, Gandolfi F. 2007. Porcine embryonic stem cells: facts, challenges and hopes. Theriogenology 68(Suppl 1):S206–S213.
Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S,
Smith A. 2003. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643–655.
Choi KD, Yu J, Smuga-Otto K, Salvagiotto G, Rehrauer W, Vodyanik M, Thomson J, Slukvin I. 2009. Hematopoietic and endothelial differentiation of human induced pluripotent stem cells. Stem
Cells 27:559–567.
Darr H, Mayshar Y, Benvenisty N. 2006. Overexpression of NANOG
in human ES cells enables feeder-free growth while inducing
primitive ectoderm features. Development 133:1193–1201.
Esteban MA, Xu J, Yang J, Peng M, Qin D, Li W, Jiang Z, Chen J,
Deng K, Zhong M, Cai J, Lai L, Pei D. 2009. Generation of
induced pluripotent stem cell lines from Tibetan miniature pig. J
Biol Chem 284:17634–17640.
Ezashi T, Telugu BP, Alexenko AP, Sachdev S, Sinha S, Roberts
RM. 2009. Derivation of induced pluripotent stem cells from pig
somatic cells. Proc Natl Acad Sci USA 106:10993–10998.
Goel S, Fujihara M, Minami N, Yamada M, Imai H. 2008. Expression of NANOG, but not POU5F1, points to the stem cell potential
of primitive germ cells in neonatal pig testis. Reproduction
135:785–795.
Hall V. 2008. Porcine embryonic stem cells: a possible source for cell
replacement therapy. Stem Cell Rev 4:275–282.
Hall VJ, Christensen J, Gao Y, Schmidt MH, Hyttel P. 2009. Porcine
pluripotency cell signaling develops from the inner cell mass to
the epiblast during early development. Dev Dyn 238:2014–2024.
Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP,
van Oudenaarden A, Jaenisch R. 2009. Direct cell reprogramming
is a stochastic process amenable to acceleration. Nature 462:595–
601.
Kim HS, Son HY, Kim S, Lee GS, Park CH, Kang SK, Lee BC,
Hwang WS, Lee CK. 2007. Isolation and initial culture of porcine
inner cell masses derived from in vitro-produced blastocysts. Zygote 15:55–63.
Kim S, Kim JH, Lee E, Jeong YW, Hossein MS, Park SM, Park SW,
Lee JY, Jeong YI, Kim HS, Kim YW, Hyun SH, Hwang WS. 2010.
Establishment and characterization of embryonic stem-like cells
from porcine somatic cell nuclear transfer blastocysts. Zygote
18:93–101.
Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP,
Colenbrander B, Roelen BA. 2008. Differences in early lineage
segregation between mammals. Dev Dyn 237:918–927.
Li M, Li YH, Hou Y, Sun XF, Sun Q, Wang WH. 2004. Isolation and
culture of pluripotent cells from in vitro produced porcine
embryos. Zygote 12:43–48.
Liu TM, Wu YN, Guo XM, Hui JH, Lee EH, Lim B. 2009. Effects of
ectopic Nanog and Oct4 overexpression on mesenchymal stem
cells. Stem Cells Dev 18:1013–1022.
Loh YH, Wu Q, Chew JL, Vega VB, Zhang W, Chen X, Bourque G,
George J, Leong B, Liu J, Wong KY, Sung KW, Lee CW, Zhao XD,
Chiu KP, Lipovich L, Kuznetsov VA, Robson P, Stanton LW, Wei
CL, Ruan Y, Lim B, Ng HH. 2006. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem
cells. Nat Genet 38:431–440.
Magnani L, Cabot RA. 2008. In vitro and in vivo derived porcine
embryos possess similar, but not identical, patterns of Oct4,
Nanog, and Sox2 mRNA expression during cleavage development.
Mol Reprod Dev 75:1726–1735.
Messerschmidt DM, Kemler R. 2010. Nanog is required for primitive endoderm formation through a non-cell autonomous mechanism. Dev Biol 344:129–137.
Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi
K, Maruyama M, Maeda M, Yamanaka S. 2003. The homeoprotein Nanog is required for maintenance of pluripotency in mouse
epiblast and ES cells. Cell 113:631–642.
Okita K, Ichisaka T, Yamanaka S. 2007. Generation of germlinecompetent induced pluripotent stem cells. Nature 448:313–317.
Pan G, Thomson JA. 2007. Nanog and transcriptional networks in
embryonic stem cell pluripotency. Cell Res 17:42–49.
Piestun D, Kochupurakkal BS, Jacob-Hirsch J, Zeligson S, Koudritsky M, Domany E, Amariglio N, Rechavi G, Givol D. 2006. Nanog
transforms NIH3T3 cells and targets cell-type restricted genes.
Biochem Biophys Res Commun 343:279–285.
Rodda DJ, Chew JL, Lim LH, Loh YH, Wang B, Ng HH, Robson P.
2005. Transcriptional regulation of nanog by OCT4 and SOX2. J
Biol Chem 280:24731–24737.
Silva J, Barrandon O, Nichols J, Kawaguchi J, Theunissen TW,
Smith A. 2008. Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol 6(10):e253. doi:10.1371/
journal.pbio.0060253.
Silva J, Nichols J, Theunissen TW, Guo G, van Oosten AL, Barrandon O, Wray J, Yamanaka S, Chambers I, Smith A. 2009. Nanog
is the gateway to the pluripotent ground state. Cell 138:722–737.
Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak
K, Beck F, Rossant J. 2005. Cdx2 is required for correct cell fate
specification and differentiation of trophectoderm in the mouse
blastocyst. Development 132:2093–2102.
Takahashi K, Yamanaka S. 2006. Induction of pluripotent stem cells
from mouse embryonic and adult fibroblast cultures by defined
factors. Cell 126:663–676.
Tsubooka N, Ichisaka T, Okita K, Takahashi K, Nakagawa M,
Yamanaka S. 2009. Roles of Sall4 in the generation of pluripotent
stem cells from blastocysts and fibroblasts. Genes Cells 14:683–
694.
West FD, Terlouw SL, Kwon DJ, Mumaw JL, Dhara SK, Hasneen K,
Dobrinsky JR, Stice SL. 2010. Porcine induced pluripotent stem
cells produce chimeric offspring. Stem Cells Dev 19:1211–1220.
Wolf XA, Serup P, Hyttel P. 2011. Three-dimensional localisation of
NANOG, OCT4, and E-CADHERIN in porcine pre- and peri-implantation embryos. Dev Dyn 240:204–210.
NANOG ACTIVATES PORCINE GENES EXPRESSION
Wu Q, Chen X, Zhang J, Loh YH, Low TY, Zhang W, Sze SK, Lim
B, Ng HH. 2006. Sall4 interacts with Nanog and co-occupies
Nanog genomic sites in embryonic stem cells. J Biol Chem
281:24090–24094.
Wu Z, Chen J, Ren J, Bao L, Liao J, Cui C, Rao L, Li H, Gu Y, Dai
H, Zhu H, Teng X, Cheng L, Xiao L. 2009. Generation of pig
induced pluripotent stem cells with a drug-inducible system. J
Mol Cell Biol 1:46–54.
Xing X, Magnani L, Lee K, Wang C, Cabot RA, Machaty Z. 2009.
Gene expression and development of early pig embryos produced
by serial nuclear transfer. Mol Reprod Dev 76:555–563.
1817
Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane
JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin, II,
Thomson JA. 2007. Induced pluripotent stem cell lines derived
from human somatic cells. Science 318:1917–1920.
Zhang J, Wang X, Chen B, Suo G, Zhao Y, Duan Z, Dai J. 2005.
Expression of Nanog gene promotes NIH3T3 cell proliferation.
Biochem Biophys Res Commun 338:1098–1102.
Zhang P, Andrianakos R, Yang Y, Liu C, Lu W. 2010. Kruppel-like
factor 4 (Klf4) prevents embryonic stem (ES) cell differentiation
by regulating Nanog gene expression. J Biol Chem 285:9180–
9189.
Документ
Категория
Без категории
Просмотров
10
Размер файла
1 108 Кб
Теги
pluripotent, nuclear, embryo, transfer, nano, overexpression, genes, porcine, fetal, activated, fibroblasts
1/--страниц
Пожаловаться на содержимое документа