close

Вход

Забыли?

вход по аккаунту

?

PKC-mediated USP phosphorylation is required for 20E-induced gene expression in the salivary glands of Drosophila melanogaster.

код для вставкиСкачать
116
Sun and Song
Archives of Insect Biochemistry and Physiology 62:116�7 (2006)
PKC-Mediated USP Phosphorylation Is Required for
20E-Induced Gene Expression in the Salivary Glands
of Drosophila melanogaster
1
Xiaoping Sun
2
and Qisheng Song *
Ecdysone receptor (EcR) and its heterodimer, ultraspiracle protein (USP), are ligand-dependent transcriptional factors that
mediate the action of molting hormone 20-hydroxyecdysone. The activities of transcriptional factors are subjected to regulation
not only by transcriptional/translational mechanisms, but also by posttranslational mechanisms such as phosphorylation. Protein kinase consensus recognition sequence analysis of Drosophila EcR and USP reveals multiple phosphorylation sites for
protein kinase C (PKC) and casein kinase II (CKII) on EcR and USP sequence. By using specific protein kinase inhibitors, we
have shown that PKC, not CKII, is responsible for USP phosphorylation. Inhibition of PKC activity by protein kinase inhibitors
blocked USP phosphorylation, resulting in inhibition of 20E-induced gene expression at both transcriptional and translational
levels. The composite data suggest that PKC-mediated USP phosphorylation is required for 20E-induced gene expression in the
salivary glands of Drosophila melanogaster. Arch Insect Biochem Physiol 62:116�7, 2006.
� 2006 Wiley-Liss, Inc.
KEYWORDS : nuclear receptor; transcriptional and translational expression; protein kinase; inhibitor
INTRODUCTION
The action of 20E is mediated by ecdysone receptor (EcR). Biochemical and molecular studies
Insect steroid hormones, mainly 20-hydroxy-
have demonstrated that heterodimerization be-
ecdysone (20E), trigger and coordinate the molting
tween EcR and its heterodimer partner ultraspiracle
and metamorphosis of insects at specific times dur-
protein (USP) is required for ligand- and DNA-
ing the insect life cycle (Riddiford, 1993). 20E di-
binding and for gene transcription (Koelle, 1992;
rectly induces a small set of early genes including
Yao et al., 1992, 1993; Thomas et al., 1993). Genes
the Broad-Complex (BR-C), E74 and E75 (Burtis et
for both EcR and USP have been cloned and se-
al., 1990; Segraves and Hogness, 1990; DiBello et
quenced from Drosophila (Koelle et al., 1991;
al., 1991). These genes encode transcription factors
Henrich et al., 1990; Oro et al., 1990; Shea et al.,
that transduce and amplify the hormonal signal by
1990), and subsequently from several other dipteran
regulating a large set of late secondary-response
and lepidopteran species (Cherbas and Cherbas,
genes (Ashburner et al., 1974; Urness and Thummel,
1996; Henrich et al., 1999) as well as from other
1995; Crossgrove et al., 1996). It is the stage- and
arthropods such as the ixodid tick Amblyomma
tissue-specific activation of these target genes that
americanum (Guo et al., 1997) and the fiddler crab
directs insect molting and metamorphosis.
Uca pugilator (Durica et al., 2002).
1
2
Division of Biological Sciences, University of Missouri, Columbia, Missouri
Division of Plant Sciences, University of Missouri, Columbia, Missouri
Presented at the XXII International Congress of Entomology in a Symposium entitled 揑nsect Signal Transduction Systems: Current Knowledge and Future
Directions,� Brisbane, Australia, 2004.
*Correspondence to: Dr. Qisheng Song, Division of Plant Sciences, 1-31 Agriculture Building, University of Missouri, Columbia, MO 65211.
E-mail: SongQ@missouri.edu
� 2006 Wiley-Liss, Inc.
DOI: 10.1002/arch.20130
Published online in Wiley InterScience (www.interscience.wiley.com)
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
In Drosophila, EcR encodes three ecdysone re-
progesterone
relative
to
its
117
unphosphorylated
ceptor isoforms, EcR-A, EcR-B1, and EcR-B2, through
counterpart. In addition, PR activity is highest in
alternative splicing (Talbot et al., 1993). These three
the S phase and lower in the G0/G1 phases of the
isoforms differ only in their N-terminal A/B do-
cell cycle, but impaired during the G0/M concomi-
main, implying that these sequences are respon-
tant with lowered PR phosphorylation. Thus, post-
sible for directing specific physiological responses
translational modification serves as an important
to
receptor
mechanism for modulating the structure, activity,
isoforms may explain partially how a single hor-
and lifetime of many proteins including receptors
20E.
Existence
of
three
ecdysone
mone drives such a variety of tissue- and stage-spe-
and enzymes. It is the phosphorylation resulting
cific responses. Indeed, it has been shown that
from hormonal signal that activates the function
expression of these three EcR isoforms is differen-
of nuclear receptors.
tially regulated according to the developmental fate
In insects, both EcR and USP have been dem-
of larval and adult structures (Talbot et al., 1993;
onstrated to be phospho-proteins (Song and Gil-
Robinow et al., 1993; Truman et al., 1994). Ge-
bert, 1998; Song et al., 2003; Rauch et al., 1998;
netic analyses using isoform-specific mutations
Nicola� et al., 2000) and EcR and USP phosphory-
have provided direct evidence that EcR isoforms
lation is regulated by 20E. High levels of EcR and
are functionally distinct (Bender et al., 1997;
USP phosphorylation in the absence of 20E in both
Schubiger et al., 1998). By comparison with EcR抯
Manduca sexta and Drosophila melanogaster (Song
complexity, usp encodes a single USP protein that
and Gilbert, 1998; Song et al., 2003) suggest that
is the Drosophila homolog of the vertebrate retin-
their phosphorylation is perhaps also regulated by
oid X receptors (RXRs) (Henrich et al., 1990; Oro
ligand-independent signaling pathways as reported
et al., 1990; Shea et al., 1990). It is the hetero-
in vertebrate systems (Weigel, 1996; Lange 2004).
dimerization between USP and each of the three
isoforms of EcR that provides a mechanism for
achieving transcriptional diversity and tissue- and
stage-specific response to 20E stimulation.
Both EcR and USP are members of the nuclear
receptor
superfamily
and
are
ligand-activated
transcriptional factors. The activities of nuclear receptors are subjected to regulation not only by transcriptional/translational mechanisms, but also by
posttranslational mechanisms such as phosphorylation. Studies of other transcription factors in vertebrates have shown that phosphorylation can play
roles in nuclear translocation, DNA binding, interactions with other proteins, and transactivation.
Transcription factors are frequently phosphorylated
at multiple sites and phosphorylation is generally
accepted as a positive regulator of steroid receptor
Phosphorylation of EcR and USP plays roles in
mediating the ligand- and perhaps also DNA-binding activity in the prothoracic glands of M. sexta.
20E-induced expression and phosphorylation of a
specific isoform of USP in the Manduca prothoracic glands have been associated with changes in
ecdysteroidogenic activity both in vivo and in vitro
(Song and Gilbert, 1998), suggesting a feedback
mechanism
by
which
ecdysteroid
synthesis
is
downregulated. Thus, phosphorylation provides
another layer of mechanisms to regulate the function of the EcR/USP complex.
Although EcR and USP are phosphoproteins
(Song et al., 2003; Song and Gilbert, 1998; Rauch
et al., 1998; Nicola� et al., 2000) and phosphorylation has been implicated in mediating the ligandand DNA-binding activities of the EcR/USP complex (Song and Gilbert, 1998), the effect of EcR
function (Weigel, 1996; Lange, 2004). Phosphory-
and USP phosphorylation on 20E-induced gene
lation of steroid receptors may serve to integrate
expression has not yet been explored. In the present
signals initiated by growth factors with responses
study, we investigated the effect of USP phospho-
to steroid hormones in endocrine tissues. For ex-
rylation on the expression of 20E-induced genes
ample, phosphorylated progesteron receptors (PR)
and proteins. Our results indicate that protein ki-
are ultrasensitive to subphysiological levels of
nase C (PKC)-mediated phosphorylation of USP
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
118
Sun and Song
mM
100
at both transcriptional and translational levels in
arin, respectively, for the indicated time periods.
the salivary glands of D. melanogaster.
chelerythrine chloride or 10
mg/ml
is required for the expression of 20E-induced genes
hep-
After incubation, salivary glands were collected
in 1.5-ml Eppendorf tubes, homogenized on ice
MATERIALS AND METHODS
in phosphate-buffered saline (PBS) (136 mM NaCl,
1.1 mM K2HPO4, 2.7 mM KCl, 8.0 mM Na2HPO4,
Insects
pH 7.4) using a disposable pestle and centrifuged
D. melanogaster (wild type
ore
) was reared on ar-
tificial blue diet (Fisher Scientific, Cat. No. 22315)
�
at 24 C under constant darkness. The early wandering third instar larvae was synchronized as described by Andres and Thummel (1994) and used
�
at 16,000g for 10 min at 4 C to remove debris.
The protein concentration was determined using
the BioRad protein bioassay kit (Reagent A: Catalog No.500-0113; Reagent B: catalog No.500-0114).
To monitor the expression and phosphorylation
of USP in the kinase inhibitor-treated salivary
for tissue dissection and RNA extraction.
glands, protein samples were subjected to SDSPAGE and Western blot analysis using AB11 USP-
Reagents
specific mAb as a probe as described previously
Chemical reagents used for buffers, sample
(Song et al., 2003).
preparation, tissue culture, electrophoresis, and
Western blot analysis were obtained from Sigma (St.
Louis, MO), Fishers (Houston, TX), BioRad (Her-
RT-PCR Analysis of 20E-Induced Gene Transcription in
the PKC Inhibitor-Treated Glands
cules, CA), and Pierce (Rockford, IL). The kits for
RNA extraction, genomic DNA elimination, firststrand cDNA synthesis for RT-PCR, and some substrates were indicated specifically in the text. AB11
USP-specific monoclonal antibody (mAb) was provided by Dr. F. C. Kafatos (Harvard University).
(a predetermined effective concentration) for 30
min and then stimulated with 0.5
mM 20E for the
indicated time periods of 0, 6, 12, and 24 h, respectively. The control received no 20E stimulation.
each treatment using Qiagen Rneasy� Mini Kit
Protein Kinase Inhibitors
(Catalog No. 74104) and RNA concentration was
Salivary glands were dissected from early wandering stage under Ringer抯 solution (3.6 mM NaCl,
54.3 mM KCl, 8.0 mM CaCl2, and 28.3 mM MgCl2)
and immediately placed in a 24-well tissue culture
ml of Grace抯 insect tissue cul-
ture medium. After dissection, the medium was
carefully removed from the well, and replaced with
500
mM PKC inhibitor chelerythrine chloride
After incubation, total RNA was insolated from
Dose and Temporal Response of USP to
plate containing 500
Salivary glands were dissected and incubated
with100
ml of fresh Grace抯 medium containing the in-
dicated concentrations of protein kinase inhibitors
determined by measuring the absorbance at 260
nm in a spectrophotometer. RT-PCR was performed
for estimation of gene expression levels in salivary
glands. Prior to RT-PCR, the extracted total RNA
was treated with RNase-free DNase I (Promega,
Catalog No. M6101) to eliminate any potential genomic DNA contamination. The first-strand cDNA
synthesis was primed using oligo (dT) based on
the SupperScript� First-Strand synthesis kit (Invitrogen, Catalog No. 11904-018). About 1.5
mg
(general protein kinase inhibitor H89 or PKC-spe-
total RNA from each sample was used for the first-
cific inhibitor chelerythrine chloride or CKII-spe-
strand synthesis. The rp49 gene was used for nor-
cific inhibitor heparin) and incubated for 6 h at
malization of the compared templates. The PCR
room temperature. Control group received Grace抯
cycle numbers for each gene were chosen empiri-
medium only. For temporal response study, sali-
cally to avoid saturation. The PCR cycle number
vary glands were incubated with 200
mM
H89 or
was constant for a particular sequence in the mul-
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
TABLE 1.
Selected Primers for Ecdysone Response Genes
RESULTS
Forward primer
Reverse primer
cccgtcaggttctacatgct
cggtttcttggtggtgttct
E74A
ccctttatcgacgatgcact
tgtccattcgcttctcaatg
E74B
atgtgtccagctccagctct
ccgttttggtactgctccag
E75B
cctcaagcagcgcgagtt
gaggcgtggctggtcatc
agcagcgtcacttcgaaact
cagcgtcttgatcagcacat
E78A
caggaggacctcatcaagga
ctgctaggccaaaagattgc
E78B
gcagcaacaccaccaactg
ttcagcgtgttggcaaagt
cgacaatgatgcacacgttc
gcattctatccgctcgaaca
tacaggcccaagatcgtgaa
gacaatctccttgcgcttct
Dose and Temporal Response of USP to
Intermolt puffs
Sgs4
119
Protein Kinase Inhibitors
Early-puffs
Early-late puffs
DHR3
Protein kinase consensus sequence analysis revealed that USP has 10 potential phosphorylation
sites, with 5 sites for PKC and 5 for CKII (Song et
al., 2003; Rauch et al., 1998). To investigate which
protein kinase is responsible for USP phosphory-
Stage-specific puffs
FTZ-F1A
Control
Dros RP49
lation, salivary glands from early wandering larvae
were incubated for 6 h with the indicated doses of
protein kinase inhibitor H89 or PKC-specific inhibitor chelerythrine chloride or CKII-specific in-
tiple samples analyzed. The amplification product
was analyzed in1.5% EtBr agar gel and visualized
using the AlphaImagerTM digital system (Alpha
Innotech Corporation, San Leandro, CA). The 20E
responsive genes and the corresponding primers
used in RT-PCR were listed in Table 1.
Profiles in the PKC Inhibitor-Treated Glands
using AB11 USP mAb as a probe to monitor the
changes
in
USP
phosphorylation
patterns.
As
shown in Figure 1, the common protein kinase inhibitor H89 inhibited USP phosphorylation in a
phorylated USP band (p56) started to disappear
when the glands were incubated with 100
mM H89
and diminished completely when treated with 200
Salivary glands from early wandering larvae were
dissected in Ringer抯 solution and preincubated for
mM PKC
inhibitor chelerythrine chloride and then stimulated with 0.5
subjected to SDS-PAGE and Western blot analysis
dose- and temporal-dependent manner. The phos-
2D Gel Analysis of 20E-Inducted Protein Expression
30 min in Grace抯 medium containing 100
hibitor heparin, respectively. The glands were
mM 20E (a predetermined effective
dose) for 6 h (the predetermined time period). The
control received no 20E stimulation. At end of the
incubation, the glands were collected, homogenized, and centrifuged and protein concentration
quantified as described above. The resulting protein sample from each treatment was subjected to
2D gel electrophoresis and silver staining as described previously (Sun et al., 2003). In brief, the
first dimensional isoelectric focusing (IEF) was performed using BIORAD PROTEIN IEF Cell and
ReadyStrip� IPG Strips (PH 3� 11cm, Catalog
mM
or higher. Meanwhile, the intensity of the un-
phosphorylated USP band (p54) was increased accordingly (Fig. 1a). Temporal response study revealed
that the phosphorylated USP band started to decline
1 h after incubation with 200
mM
H89 and disap-
peared completely at 6-h incubation (Fig. 1b).
When the salivary glands were incubated with
the PKC-specific inhibitor chelerythrine chloride,
chelerythrine chloride inhibited USP phosphory-
mM
and
when
the
lation at the concentration as low as 50
maximum
inhibition
was
glands were treated with 100
observed
mM. Meanwhile, the
intensity of the unphosphorylated USP band was
nearly doubled (Fig. 2a). Temporal response of
USP to the PKC inhibitor indicated that the PKC
inhibitor was able to block USP phosphorylation
in the glands incubated with chelerythrine chlo-
number 165-4000) according to the manufacturer抯
ride for as short as 1 h. USP phosphorylation was
instructions. Each IPG strip was soaked in rehy-
completely inhibited by chelerythrine chloride at
dration buffer containing 100
3 h incubation (Fig. 2b). The results suggest that
mg protein per treat-
ment. After isoelectric focusing, the IPG strip was
PKC, which phosphorylates the USP, was inhib-
equilibrated and subjected to SDS-PAGE (12.5%
ited by chelerythrine chloride, resulting in the dis-
gel) and silver staining.
appearance of the p56 phosphorylated USP band.
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
120
Fig. 1.
Sun and Song
Effect of the general protein kinase inhibitor H89
or for the indicated period of time in the presence or ab-
mM H89 (b). Protein samples were prepared
on USP phosphorylation in the salivary glands of D.
sence of 200
melanogaster . The salivary glands from early wandering
from the glands and subjected to SDS-PAGE and Western
third instar larvae were incubated for 6 h in Grace抯 me-
blot analysis using AB11 USP specific mAb as a probe.
dium containing the indicated concentrations of H89 (a)
Figure 3 reveals that the phosphorylated and
expected, the PKC inhibitor also blocked 20E-in-
unphosphorylated USP bands in the glands treated
duced USP phosphorylation (Fig. 4) in a similar
with the CKII inhibitor heparin decreased at a simi-
manner as shown in the basal level inhibition (Fig.
lar rate in the dose and temporal response studies,
2). All data suggest clearly that PKC, not CKII, is
suggesting that CKII has no effect on USP phos-
responsible for USP phosphorylation.
phorylation, but inhibits its expression. It is not
clear that whether the decline in the phosphory-
RT-PCR Analysis of 20E-Induced Gene Transcription in
lated and unphosphorylated USP was due to the
the PKC Inhibitor-Treated Glands
inhibition of USP expression or the increase in USP
breakdown by proteases.
To investigate whether PKC-mediated USP phos-
To investigate whether the PKC inhibitor was
phorylation affects 20E-induced gene transcription,
mM
able to block USP phosphorylation in the presence
salivary glands were preincubated with 100
of 20E, the glands were preincubated with 100
PKC inhibitor chelerythrine chloride for 30 min
mM
mM
PKC inhibitor chelerythrine chloride for 30 min
and then challenged with 0.5
and then challenged with 0.5
dicated time periods. After incubation, the glands
Fig. 2.
mM 20E for 6 h. As
Effects of the PKC-specific inhibitor chelerythrine
20E for the in-
chelerythrine chloride (a) or for the indicated period of
mM
chloride on USP phosphorylation in the salivary glands
time in the presence or absence of 100
of D. melanogaster. The salivary glands from early wander-
chloride ( b). Protein samples were prepared from the
ing third instar larvae were incubated for 6 h in Grace抯
glands and subjected to SDS-PAGE and Western blot analy-
medium
sis using AB11 USP specific mAb as a probe.
containing
the
indicated
concentrations
of
Archives of Insect Biochemistry and Physiology
July 2006
chelerythrine
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
Fig. 3.
Effects of the CKII-specific inhibitor heparin on
121
for the indicated period of time in the presence or ab-
mg/ml heparin (b). Protein samples were pre-
USP phosphorylation in the salivary glands of D. melano-
sence of 10
gaster. The salivary glands from early wandering third in-
pared from the glands and subjected to SDS-PAGE and
star larvae were incubated for 6 h in Grace抯 medium
Western blot analysis using AB11 USP specific mAb as a
a
containing the indicated concentrations of heparin ( ) or
probe.
were collected and analyzed using RT-PCR for tran-
completely blocked the expression of these 20E-
scriptional expression of 8 randomly selected 20E
induced genes. Similar response patterns were ob-
response genes (Table 1). These genes represent 4
served for the above-mentioned genes in the glands
different response types, i.e., intermolt puff, early-
incubated with 20E for 12 and 24 h although larger
puff, late-puff, and stage-dependent puff genes
variation did occur. However, 20E had no effect
(Table 1). Figure 5 reveals that 20E induced the
on the expression of the intermolt puff gene Sgs4,
expression of the early-puff genes E74A and E75B
neither did the PKC inhibitor. For the stage-spe-
and the late-puff genes DHR3, E78A, and E78B
cific puff FTZ-F1A gene, it expressed only in con-
when the glands were incubated with 20E for 6 h
trol glands 6 h after incubation with medium and
and that the PKC inhibitor completely or nearly
was inhibited by 20E.
Fig. 4.
dicated concentrations of chelerythrine chloride before
Effects of the PKC-specific inhibitor chelerythrine
mM
b).
chloride on 20E-stimulated USP phosphorylation in the
being challenged with 0.5
salivary glands of D. melanogaster. The salivary glands from
samples were prepared from the glands and subjected to
early wandering third instar larvae were incubated for 6 h
SDS-PAGE and Western blot analysis using AB11 USP spe-
in Grace抯 medium containing the indicated concentra-
cific mAb as a probe. CC: chelerythrine chloride.
a
tions of 20E ( ) or preincubated for 30 min with the in-
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
20E for 6 h (
Protein
122
Fig. 5.
Sun and Song
Effects of the PKC inhibitor chelerythrine chlo-
expression of 8 selected genes. The rp49 gene was used
ride on the expression of 20E-induced genes (RT-PCR).
for normalization of the compared templates. The tran-
The salivary glands from early wandering third instar lar-
scripts were analyzed in 1.5% EtBr agar gel and visual-
vae of D. melanogaster were preincubated for 30 min with
ized using the AlphaImagerTM digital system (Alpha
mM) and then challenged with
Innotech Corporation, San Leandro, CA). CC: chelerythrine
chelerythrine chloride (100
20E (0.5
mM
) for the indicated periods of time. Total
chloride. CK: control.
RNA was insolated for RT-PCR analysis of transcriptional
As expected, the PKC inhibitor had no influence
20E or both. When compared to the control, which
on FTZ-F1A gene expression. 20E also failed to in-
was incubated with medium only (Fig. 6a), 20E
duce the expression of E74B transcript, but the PKC
induced or increased the expression of a set of pro-
inhibitor was able to induce E74B expression, sug-
teins (Fig. 6b, protein spots 1�. Meanwhile, 20E
gesting that E74B may be negatively regulated by
also inhibited or decrease the expression of sev-
receptor phosphorylation. Neither 20E nor PKC in-
eral proteins (Fig. 6b, protein spots 7�). The PKC
hibitor had any effect on the expression of rp49
inhibitor alone had no effect on protein expres-
control transcript. These results suggest that PKC-
sion profiles except protein spots 12 and 13, which
mediated phosphorylation is required for the ex-
were induced only by the PKC inhibitor (Fig. 6c).
pression of 20E-induced genes and inhibition of PKC
As expected, the PKC inhibitor inhibited or reduced
activity results in inhibition of USP phosphorylation
the expression of 20E-induced proteins (Fig. 6d,
and subsequent 20E-induced gene transcription.
protein spots 1�. It must be noted that only the
major protein spots affected by PKC, 20E, or both
2D Gel Analysis of 20E Induced-Protein Expression in
were labeled and discussed. Although the identi-
the PKC Inhibitor-Treated Glands
ties of these proteins are not known, the data
clearly indicate that PKC-mediated USP phospho-
Figure 6 shows the protein expression profiles
in the glands incubated with the PKC inhibitor or
rylation is also required for 20E-induced protein
expression.
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
Fig. 6.
Effects of the PKC inhibitor chelerythrine chlo-
glands incubated with 0.5
123
mM 20E. c: Protein profile from
mM)
ride on the expression of 20E-induced proteins. The sali-
the glands incubated with chelerythrine chloride (100
vary glands from early wandering third instar larvae of D.
only. d: Protein profile from the glands preincubated with
melanogaster were preincubated for 30 min with chel-
chelerythrine chloride (100
erythrine chloride (100
mM) and then challenged with 20E
lenged with 20E (0.5
mM) for 30 min and then chalmM) for 6 h. 20E-induced (spots
mM) for 6 h. The resulting protein sample from each
#1�, 20E-inhibited (spots #7�), the PKC inhibitor in-
treatment was subjected to 2D gel electrophoresis and sil-
duced proteins (spots #12 and #13), and 20E-induced but
ver staining. a: Protein profile from the control glands
blocked by the PKC inhibitor are indicated by arrows. CC:
incubated with medium only. b: Protein profile from the
chelerythrine chloride.
(0.5
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
124
Sun and Song
DISCUSSION
in the glands incubated with the PKC inhibitor
chelerythrine chloride or the common inhibitor H89.
USP is a phosphoprotein in several insect spe-
After PKC was demonstrated to be responsible
cies including D. melanogaster (Song et al., 2003),
for USP phosphorylation, it is critical to know
M. sexta (Song and Gilbert, 1998), C. tantans
whether the PKC-mediated USP phosphorylation
(Rauch et al., 1998), and T. molitor (Nicola� et al.,
plays any roles in regulating the expression of 20E-
2000). Phosphorylation of USP as well as EcR
induced genes and proteins. To investigate that, a
modulates the ligand- and perhaps also the DNA-
set of randomly selected 20E response genes, rep-
binding activity of the EcR/USP complex in Man-
resenting 4 different response groups (Table 1),
duca (Song and Gilbert, 1998). Although the
were used as tools to monitor the transcriptional
putative phosphorylation sites of USP for PKC and
activities of these genes in the glands that were
CKII have been reported in Drosophila and Chiro-
preincubated with the PKC inhibitor chelerythrine
nomus, based on kinase consensus recognition se-
chloride followed by 20E challenge. By using RT-
quence analysis (Song et al., 2003; Rauch et al.,
PCR to measure the transcriptional activities of
1998), the kinase responsible for its phosphoryla-
these selected genes, we found that inhibition by
tion and the role of USP phosphorylation in 20E-
chelerythrine chloride of the PKC-mediated USP
induced gene transcription have not yet been
phosphorylation blocked the transcriptional ex-
explored. The present study demonstrated for the
pression of 20E-induced genes, i.e., the early-puff
first time in Drosophila that PKC is responsible
gene E74A and E75B and the late-puff gene DHR3,
for USP phosphorylation and that inhibition of
E78A, and E78B (Fig. 5), but had no effect on the
PKC activity results in inhibition of USP phospho-
genes that were not induced by 20E under the ex-
rylation and 20E-induced gene expression at both
transcriptional and translational levels, suggesting
that PKC-mediated USP phosphorylation is required for 20E-induced gene expression.
Protein phosphorylation is regulated by protein
kinase, which phosphorylates proteins and by protein phosphatase, which dephosphorylates proteins.
When the salivary glands from early wondering larvae were incubated with the common protein kinase inhibitor H89 that inhibits both PKC and CKII
at different concentrations (Fig. 1) and the PKC specific inhibitor chelerythrine chloride in the absence
(Fig. 2) or presence (Fig. 4) of 20E, the phosphorylated USP band declined or disappeared in a
dose- and time-dependent manner while the unphosphorylated USP band increased accordingly. These
results indicate that the PKC inhibitors blocked PKC
perimental conditions, i.e., the intermolt puff gene
Sgs4, the stage-dependent puff gene FTZ-F1A, and
the early-puff gene E74B. Similarly, the PKC inhibitor also blocked the expression of 20E-induced proteins (Fig. 6, spots 1� although the identities of
these proteins are not known. These results suggest that the PKC-mediated phosphorylation of
USP is required for the expression of 20E-induced
genes and proteins.
Although the PKC inhibitor chelerythrine chloride inhibited PKC activity, thus blocking USP
phosphorylation and 20E-induced gene transcription, chelerythrine chloride might also inhibit EcR
phosphorylation. Protein consensus recognition
sequence analysis of Drosophila EcR reveals multiple phosphorylation sites on EcR sequence, with
10 sites for PKC, 11 sites for CKII, and a single site
for PKA (Rauch et al., 1998). It is likely that PKC
activities and USP phosphorylation was stopped. On
is also the key kinase responsible for EcR phos-
the other hand, protein phosphatase activity was not
phorylation. Unfortunately, we do not have a good
affected by the PKC inhibitor. Protein phosphatase
antibody to track the PKC-mediated EcR phospho-
continuously dephosphorylated the existing phos-
rylation patterns as we did for USP. We could not
phorylated USP by removing phosphate group(s)
exclude the possibility that other chaperon proteins
from USP protein, resulting in the decline or com-
associated with the EcR/USP complex (Arbeitman
plete disappearance of the phosphorylated USP band
and Hogness, 2000; Song et al., 1997) are also
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
125
regulated by PKC. Arbeitman and Hogness (2000)
lation could also be regulated by ligand-indepen-
have shown that chaperone proteins are essential
dent pathway(s) as reported in vertebrates (Weigel,
for the DNA-binding of the EcR/USP complex.
1996). It is possible that 20E stimulates USP phos-
Elimination of any one of six chaperon proteins
phorylation at specific sites different from the ones
will proportionally reduce ecdysone response element
enhanced by ligand-independent pathway(s). We
(EcRE) recognition while none of these chaperones
could not exclude the possibility that 20E stimu-
is necessary for ligand-binding. In vertebrates,
lates USP phosphorylation at the same sites as
phosphorylation of chaperon proteins can cause
ligand-independent mechanisms do, but at a dif-
conformational change of these proteins and dis-
ferent level.
sociate them from steroid receptor, thus activating
In Drosophila, six PKC isoforms have been
the receptor (Weigel, 1996; Lange, 2004). For ex-
identified based on the available genomic sequence
ample, in the absence of hormone, PRs are com-
(Shieh et al., 2002), including two classical PKCs
plexed
Upon
(PKC53E and eye-PKC), two novel PKCs (PKC98E
exposure to progesterone, the ligand-activated re-
with
several
chaperon
proteins.
and PKCdelta), an atypical PKC (DaPKC), and a
ceptor undergoes a conformational change, disso-
PKC-related kinase. DaPKC is essential for early
ciates from chaperon proteins, dimerizes, and
embryonic development and Eye-PKC plays a role
interacts with specific progesterone response ele-
in the regulation of visual signaling, a G-protein
ments in the promoter regions of target genes. It
coupled phospholipase Cbeta-mediated cascade.
is unclear whether the EcR/USP complex is acti-
No information is available on which PKC isoform
vated via phosphorylation in a similar manner as
is responsible for USP or EcR phosphorylation.
in the vertebrate system. Nevertheless, the fact that
Identification and characterization of the PKC
chelerythrine chloride blocked the transcriptional
isoform responsible for EcR and USP phosphory-
and translational expression of 20E-induced genes
suggests that the PKC-mediated phosphorylation
of USP, presumably EcR as well, is required for 20E-
lation are currently underway. The data from our
previous and present studies suggest that phosphorylation plays important roles in regulating the
ligand- and DNA-binding activities of the EcR/USP
induced gene expression.
Our previous data from Manduca (Song and
complex and 20E-induced gene expression.
Gilbert, 1998) and Drosophila (Song et al., 2003)
show clearly that 20E is responsible for enhancing
LITERATURE CITED
USP expression and phosphorylation in both species. These results are consistent with the recent
Andres AJ, Thummel CS. 1994. Methods for quantitative
analysis
reports from two independent labs that USP is a
phosphoprotein and its phosphorylation is regulated by 20E (Rauch et al., 1998; Nicola� et al.,
of
transcription
in
larvae
and
prepupae.
In:
Goldstein LSB, Fyrberg EA, editors. Drosophila melanogaster:
practical uses in cell and molecular biology. New York:
Academic Press. p. 565�3.
2000). Although the in vitro enhancement of USP
phosphorylation by 20E in Drosophila salivary
glands is small (about 20% increase compared to
Arbeitman MN, Hogness DS. 2000 Molecular chaperones activate the Drosophila ecdysone receptor, an RXR heterodimer. Cell 101:67�.
the control) (Fig. 4), it is sufficient to induce the
expression of 20E-induced genes that lead to molt-
Ashburner M, Chihara C, Meltzer P, Richards G. 1974. Tem-
ing and metamorphosis. Blocking 20E-induced
poral control of puffing activity in polytene chromosomes.
USP phosphorylation inhibits 20E-induced gene
expression as shown in Figure 5. In the unstim-
Cold Spring Harbor Symp Quant Biol 38:655�2.
Bender M, Imam FB, Talbot WS, Ganetzky BS, Hogness燚S.
ulated glands from early wandering larvae, approxi-
1997. Drosophila ecdysone receptor mutations reveal func-
mate 40% of the total USP is in phosphorylation
tional differences among receptor isoforms. Cell 62:413�
form (Figs. 1�, suggesting that USP phosphory-
423.
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
126
Sun and Song
Burtis KC, Thummel CS, Jones CW, Karim FD, Hogness DS.
ultraspiracle during metamorphosis and in vivo induction
1990. The Drosophila 74EF early puff contains E74, a com-
of its phosphorylation by 20-hydroxyecdysone. Insect Mol
plex ecdysone-inducible gene that encodes two eto-related
Biol 9:242�9.
proteins. Cell 61:85�.
Oro AE, McKeown M, Evans RM. 1990. Relationship between
Cherbas P, Cherbas L. 1996. Moleculor aspects of ecdysteroid
hormone action. In: Gilbert LI, Tata JR, Atkinson BG, edi-
the product of the Drosophila ultraspiracle locus and the
vertebrate retinoid X receptor. Nature 347:298�1.
tors. Metamorphosis: postembryonic reprogramming of
gene expression in amphibian and insect cells, 3rd ed. San
Riddiford LM. 1993. Hormones and Drosophila development.
Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Diego: Academic Press. p 175�1.
Press.
Crossgrove K, Bayer CA, Fristrom JW, Guild GM. 1996. The
Drosophila Broad-Complex early gene directly regulates
late gene transcription during the ecdysone-induced puff-
Rauch P, Grebe M, Elke C, Spindler K-D, Spindler-Barth M.
1998. Ecdysteroid receptor and ultraspiracle from Chiro-
nomus tentans (Insecta) are phosphoproteins and are regu-
ing cascade. Rev Biol 180:745�8.
lated differently by molting hormone. Insect Biochem Mol
DiBello PR, Withers DA, Bayer CA, Fristrom JW, Guild GM.
Biol 28:265�5.
1991. The Drosophila Broad-Complex encodes a family
of
related
proteins
containing
zinc
fingers.
Genetics
Robinow S, Talbot WS, Hogness DS, Truman JW. 1993. Programmed cell death in the Drosophila CNS is ecdysone-
129:385�7.
regulated and coupled with a specific ecdysone receptor
Durica DS, Wu X, Anilkumar G, Hopkins PM, Chung A C-K.
isoform. Development 119:1251�59.
2002. Characterization of crab EcR and RXR homologs and
expression during limb regeneration and oocyte matura-
Schubiger M, Wade AA, Carney GE, Truman JW, Bender燤.
1998. Drosophila EcR-B ecdysone receptor isoforms are
tion. Mol Cell Endocrinol 189:59�.
required for larval molting and for neuron remodeling durGuo X, Harmon MA, Laudet V, Mangelsdorf DJ, Palmer MJ.
1997. Isolation of a functional ecdysteroid receptor homologue form the ixodid tick Ambloymma americanum (L.).
Insect Biochem Mol Biol 27:945�2.
ing metamorphosis. Dev 125:2053�62.
Segraves WA, Hogness DS. 1990. The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila
encodes two new members of the steroid receptor super-
Henrich VC, Sliter TJ, Lubahn DL, MacIntyre A, Gilbert LI.
1990. A member of steroid/thyroid hormone receptor superfamily in Drosophila melanogaster shows extensive sequence similarity with a mammalian counterpart. Nucleic
Acids Res 18:4143�48.
family. Genes Dev 4:204�9.
Shea MJ, King DL, Conboy MJ, Mariani BD, Kafatos FC. 1990.
Proteins that bind to Drosophila chorion cis-regulatory
elements: a new C2H2 zinc finger protein and a C2H2
steroid receptor-like component. Genes Dev 4:1128�40.
Koelle MR. 1992. Molecular analysis of the Drosophila ecdysone receptor complex. Ph.D. thesis, Stanford University,
Shieh BH, Parker L, Popescu D. 2002. Protein kinase C (PKC)
isoforms in Drosophila. J Biochem 132:523�7.
Stanford, CA.
Song Q, Gilbert L I. 1998. Alterations in ultraspiracle (USP)
Koelle MR, Talbot WS, Segraves WA, Bender MT, Cherbas P,
Hogness DS. 1991. The Drosophila EcR gene encodes an
ecdysone receptor, a new member of the steroid receptor
content and phosphorylation state accompany feedback
regulation of ecdysone synthesis in the insect prothoracic
gland. Insect Biochem Mol Biol 28:849�0.
superfamily. Cell 67:59�.
Song Q, Alnemri ES, Litwack G, Gilbert LI. 1997. An imLange CA. 2004. Making sense of cross-talk between steroid
munophilin is a component of the insect ecdysone recep-
hormone receptors and intracellular signaling pathways:
tor (EcR) complex. Insect Biochem Mol Biol 27:973�2.
who will have the last word? Mol Endocrinol 18:269�8.
Song Q, Sun X, Jin XY. 2003. 20E regulated USP expression
Nicola� N, Bouhin H, Quennedey B, Delachambre J. 2000.
Molecular cloning and expression of Tenebrio
molotor
and phosphorylation in Drosophila melanogaster. Insect
Biochem Mol Biol 33:1211�18.
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
USP Phosphorylation and 20E-Induced Gene Expression
127
Sun X, Song Q, Barrett BA. 2003. Effects of ecdysone ago-
Urness LD, Thummel CS. 1995. Molecular analysis of a ste-
nists on the expression of EcR, USP and other specific pro-
roid-induced regulatory hierarchy: the Drosophila E74A
teins in the ovaries of the codling moth (Cydia pomonella
protein directly regulates L71-6 transcription. EMBO J
L.). Insect Biochem Mol Biol 33:829�0.
14:6239�46.
Talbot WS, Swyryd EA, Hogness DS.1993. Drosophila tissues
with different metamorphic responses to ecdysone express
Weigel NL. 1996 Steroid hormone receptors and their regulation by phosphorylation. Biochem J 319:657�7.
different ecdysone receptor isoforms. Cell 73:1323�37.
Yao TP, Forman BM, Segraves WA, Oro AE, McKeown M,
Thomas HE, Stuttenberg HG, Stewart AF. 1993. Hetero-
Cherbas P, Evans RM. 1992. Drosophila ultraspiracle
dimerization of the Drosophila ecdysone receptor with re-
modulates ecdysone receptor function via heterodimer for-
tinoid X receptors and ultraspiracle. Nature 362:471�5.
mation. Cell 71:63�.
Truman JT, Talbot WS, Fahrbach SE, Hogness DS. 1994. Ecdys-
Yao TP, Forman BM, Jiang ZY, Cherbas L, Chen JD, McKeown
one receptor expression in the CNS correlates with stage-
M, Cherbas P, Evans RM. 1993. Functional ecdysone re-
specific responses to ecydsteroids during Drosophila and
ceptor is the product of EcR and ultraspiracle genes. Na-
Manduca development. Dev 120:219�4.
ture 366:476�9.
Archives of Insect Biochemistry and Physiology
July 2006
doi: 10.1002/arch.
Документ
Категория
Без категории
Просмотров
0
Размер файла
1 214 Кб
Теги
expressions, induced, pkc, required, drosophila, 20e, mediated, phosphorylation, melanogaster, gland, salivary, genes, usp
1/--страниц
Пожаловаться на содержимое документа